First Report of Rhizoctonia solani AG-4-HG-II on Garden Pink in Buenos Aires, Argentina

During 2001, basal stem rot, wilt, and plant death were observed on 30% of the plants in a crop of Dianthus plumarius L. ‘Telstar’ in Buenos Aires. Pieces of diseased stems ≈1 cm long were surface-disinfested in 2% NaOCl for 1 min and cultured on 2% potato dextrose agar (PDA), pH 7, at 22 to 24°C. After 7 days, an identical fungus was consistently isolated from pieces of infected tissue. Colonies initially were white, turned brown after 2 to 3 days, and eventually formed irregularly shaped sclerotia. Cultures exhibited morphological characteristics typical of Rhizoctonia solani Kühn (2) and were identified with known anastomosis group tester isolates (1). Positive anastomosis was observed with tester strains of R. solani AG-4-HG-II. One isolate was tested for pathogenicity by placing two pieces of PDA (1 cm2) containing 7-day-old mycelial growth ≈0.5 cm from the base of healthy 2-month-old plants. Control plants were treated with sterile pieces of PDA using the same procedures. Ten replicate plants were used for each treatment. Plants were maintained at 22 to 24°C under 95 to 100% relative humidity and a 12-h light/dark photoperiod. After 7 days, symptoms developed that were similar to those originally observed, and Koch's postulates were satisfied by reisolating the fungus. To our knowledge, this is the first report of R. solani AG4-HG-II causing disease on D. plumarius in Argentina. References: (1) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN, 1991. (2) C. C. Tu and J. W. Kimbrough. Mycologia 65:941, 1973.

Download Full-text

First Report of Rhizoctonia solani AG-4 on Epipremnum aureum in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pdis.2001.85.1.96c ◽

2001 ◽

Vol 85 (1) ◽

pp. 96-96 ◽

Cited By ~ 1

Author(s):

E. R. Wright ◽

P. E. Grijalba ◽

L. Gasoni

Keyword(s):

Rhizoctonia Solani ◽

Buenos Aires ◽

Its Region ◽

Anastomosis Group ◽

Causal Agent ◽

Basal Stem Rot ◽

First Report ◽

Brown Discoloration ◽

Epipremnum Aureum ◽

Petri Plate

Root and basal stem rot, blighting, and wilting have been observed on Epipremnum aureum (Linden ex André) plants in many nurseries in and near Buenos Aires since 1997. Infected stem tissues show an intense dark brown discoloration and water soaking near the stem base that eventually leads to plant death. To determine the causal agent of the disease, small pieces of diseased tissue were surface-sterilized for 2 min in 2% sodium hypochlorite and plated on potato-dextrose agar (PDA). Whitish colonies that eventually turned brown developed in 2 to 3 days at 22 to 24°C. Irregularly shaped sclerotia were observed. Isolates typical of Rhizoctonia solani Kuhn exhibited mycelia with branches inclined in the direction of growth, constricted at the point of union with the main hyphae, with a septum in the branch near the constriction. No telemorph was observed. Nuclei in living hyphal mats were stained directly on a microscope slide coated with water agar according to the method of Tu and Kimbrough (4) and were examined at 400× magnification. The cells were multinucleate. Anastomosis group was determined by using known tester isolates of Rhizoctonia spp. (3). Positive anastomosis was observed with tester strains of AG-4 HG-II. The polymerase chain reaction was performed according to the protocol of Boysen et al (1) in order to confirm the anastomosis group. Primers used for the amplification of the ITS region were ITSI and LROR. Amplification of the ITS region indicated lack of variation with AG-4 tester strain. The pathogenicity of the isolate was determined with the inoculum-layer technique (2), consisting of a 7-day-old petri plate culture of the pathogen in PDA that is removed from the dish and placed intact on the soil, 2 to 4 cm under the roots of 10 healthy plants. Some leaves of the plants were placed in contact with the inoculated substratum. For a control, PDA was placed under the roots of other plants. Plants were maintained at 22 to 24°C, with close-to-saturation humidity. After 6 to 10 days, symptoms were similar to those previously observed. Initially leaves that had been placed in contact with the substratum showed dark areas with a watersoaked area 2 to 3 cm in diameter. These lesions expanded over the entire leaf blade moving into the petioles and stems killing the plant. One hundred percent of inoculated plants were infected. Koch's postulates were satisfied after reisolating the fungus. The characteristics of the causal agent are those of multinucleate isolates of R. solani belonging to the anastomosis group AG-4 HG-II (3). This is the first report of R. solani causing disease on E. aureum in Argentina. References: (1) M. Boysen, M. Borja, C. Del Corral, O. Salazar, and V. Rubio. Curr. Genet. 29:174–181, 1996. (2) A. F. Schmitthenner and J. W. Hilty. Phytopathology 52:177–178, 1962. (3) B. Sneh, L. Burpee, and A. Ogoshi. 1991. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. (4) C. C. Tu and J. W. Kimbrough. Mycologia 65:941–944, 1973.

Download Full-text

First Report of Colletotrichum gloeosporioides on Chinese Rose in Argentina

Plant Disease ◽

10.1094/pdis.2000.84.12.1345b ◽

2000 ◽

Vol 84 (12) ◽

pp. 1345-1345 ◽

Cited By ~ 1

Author(s):

M. C. Rivera ◽

E. R. Wright ◽

S. Carballo

Keyword(s):

Colletotrichum Gloeosporioides ◽

Buenos Aires ◽

Morphological Characteristics ◽

Disease Prevalence ◽

Potato Dextrose Agar ◽

Conidial Suspension ◽

First Report ◽

Hibiscus Rosa Sinensis ◽

Leaf Drop ◽

Stems And Leaves

Chinese rose (Hibiscus rosa-sinensis L.) is a shrub frequently planted in Argentina. In November 1999, dieback and anthracnose symptoms were detected on stems and leaves of plants cv. Hawaii cultivated in Buenos Aires. Disease prevalence was 50%. Pieces of infected tissues were surface-sterilized for 1 min in 2% NaOCl, plated on potato-dextrose agar and incubated at 24 ± 2°C. The isolate that was consistently recovered from diseased tissues was identified as Colletotrichum gloeosporioides (Penz.) Penz. and Sacc., based on morphological characteristics (1,2). Teleomorph stage was not observed. Inoculation for pathogenicity testing was carried out by spraying a conidial suspension (6.5 × 106 conidia per ml) on plants with previously punctured leaves and pruned stems. Inoculated plants with unwounded tissues, as well as noninoculated controls, were included. Five replications of each treatment were done. Plants were incubated in moist chambers at 24°C. Whitish areas of 0.3 to 0.5 cm diameter surrounded by a purple halo developed on all punctured leaves within 10 days. Stem blight and leaf drop were observed. The center of the lesions was covered by black acervuli 14 days after inoculation. Unwounded and noninoculated controls remained symptomless. The pathogen was reisolated from inoculated leaves, completing Koch's postulates. This is the first report of C. gloeosporioides causing disease on Chinese rose in Argentina. References: (1) J. A. Bailey and M. J. Jeger, eds. 1992. Colletotrichum. CAB International, Surrey, England. (2) B. C. Sutton. 1980. The Coelomycetes. CMI, Kew.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Stem Rot and Wilt of Sunflower Caused by Sclerotinia minor in Spain

Plant Disease ◽

10.1094/pdis.2002.86.6.697d ◽

2002 ◽

Vol 86 (6) ◽

pp. 697-697

Author(s):

M. L. Molinero-Ruiz ◽

J. M. Melero-Vara

Keyword(s):

Helianthus Annuus ◽

Root Rot ◽

Mycelial Growth ◽

Disease Incidence ◽

Potato Dextrose Agar ◽

Stem Rot ◽

Sclerotinia Minor ◽

Stem Base ◽

First Report ◽

White Mycelium

In 2001, sunflower (Helianthus annuus L.) plants with symptoms of stem and root rot and wilt were observed in Soria, Spain. Light brown, water-soaked lesions developed on the collar of infected plants and extended along the stem, affecting the pith and causing early and sudden wilt. White mycelium and sclerotia (0.5 to 2 mm long) formed in the pith of stems. The sclerotia were disinfested in NaClO (10% vol/vol) for 1 min, transferred to potato dextrose agar (PDA), and incubated at 20°C. The fungus consistently obtained was identified as Sclerotinia minor Jagger (1). Pathogenicity was confirmed in a greenhouse experiment (15 to 25°C, 13 h light). Seven-week-old plants of six genotypes of sunflower (‘Peredovik’, HA89, HA821, HA61, RHA274, and HA337) were inoculated by placing one PDA disk with active mycelial growth adjacent to each basal stem just below the soil line and covering it with peat/sand/silt (2:2:1, vol/vol). Six plants of each genotype were inoculated without wounding, and another six were inoculated immediately after stem base wounding with a scalpel; six wounded and uninoculated plants were used as controls. First symptoms (wilting) appeared 4 days after inoculation in all genotypes. Two weeks after inoculation, the percentage of dead plants ranged from 33 to 92% (depending on cultivar), white mycelium was observed at the base of affected plants, and sclerotia were present in the pith of diseased plants. There was no effect of plant wounding on disease incidence or severity, and the fungus was reisolated from inoculated plants. To our knowledge, this is the first report of S. minor in Spain. Reference: (1) L. M. Kohn. Mycotaxon IX 2:365, 1979.

Download Full-text

First Report of a Bionectria sp. Associated with a Stem Rot of Cardon Cactus (Pachycereus pringlei) in Baja California Sur, Mexico

Plant Disease ◽

10.1094/pdis-08-11-0698 ◽

2012 ◽

Vol 96 (2) ◽

pp. 292-292 ◽

Cited By ~ 2

Author(s):

R. J. Holguín-Peña ◽

L. G. Hernández-Montiel ◽

H. Latisnere ◽

E. O. Rueda-Puente

Keyword(s):

Gulf Of California ◽

Baja California ◽

Morphological Characteristics ◽

Potato Dextrose Agar ◽

Control Measures ◽

World Heritage Site ◽

Stem Rot ◽

Baja California Sur ◽

First Report ◽

Pachycereus Pringlei

Giant cardon (Pachycereus pringlei ((S.Watson) Britton & Rose) is the most common cactus in northwestern Mexico and is endemic to the Baja California Peninsula and Sonora Desert. A large part of the peninsula (El Vizcaino Biosphere Reserve and Gulf of California) now consists of protected areas and is classified as a World Heritage site by UNESCO ( http://whc.unesco.org/en/list/1182 ). Cardon cactus is an important ecological resource for indigenous people and is used as feed for range cattle. Since 2000, in the central and southern part of the State of Baja California Sur, an apical stem rot has spread to ~17% of the natural cardon population around San Pedro (23°29′N, 110°12′W), La Paz (24°08′N, 110°18′W), and El Comitán (24°05′N, 110°21′W). Affected cacti display necrosis of apical branches, dry rot, cracks in the stem and branches, bronzing of mature spines surrounding the affected area, and reddish brown gummy exudate. Thirty samples from the edges of symptomatic lesions were surface disinfected for 2 min in 0.8% (wt/vol) NaOCl and ethanol (70%), rinsed in sterile, distilled water, and grown on potato dextrose agar at 27°C. A cottony, brownish fungus was consistently isolated from affected tissues. Koch's postulates were performed in pots of 10 cm in diameter with 5-year-old cacti inoculated (9-day-old mycelia) and incubated (15 days) at room temperature (26°C). The rough, dry, brownish, circular lesions that appeared were the same as those observed in the field. Healthy cacti inoculated with potato dextrose agar plugs were symptomless. The fungus was always reisolated from infected cacti and morphological examinations (2) were performed: one-septate, olive-green, smooth, ellipsoidal conidium and two-celled ascospores (15 to 20 × 5 to 7 μm) were present. Also present were conidial masses from monomorphic, penicillate conidiophores in sporodochia. Cottony and white-to-light yellow PDA colonies were observed. Genomic DNA was extracted from lyophilized hyphae using the method described by O'Donnell (1) or with a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). The internal transcribed spacer (ITS) regions 1 and 2 of the 5.8, 18, and 28S ribosomal RNA genes were amplified with the primer pairs ITS1 and ITS4 (3). The expected amplicon of 571 bp was sequenced and compared with fungal sequences available from the GenBank-EMBL database using the BlastN and CLUSTAL programs (MegAlign, DNASTAR, Madison, WI). The closest nucleotide similarity had 99% identity with a Bionectria sp. (GenBank Accession No. HM849058.1). To our knowledge, on the basis of morphological characteristics, DNA comparisons, and pathogenicity tests, this is the first report of a Bionectria sp. causing an apical stem rot disease in cardon cacti in Mexico. Since there are no control measures in Mexico there is a permanent risk that the disease will spread to healthy areas. References: (1) K. O'Donell et al. Mycologia 92:919, 2000. (2) H. J. Schroers. Stud. Mycol. 46:1, 2001. (3) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Azalea Petal Blight Caused by Pestalotiopsis guepini in Argentina

Plant Disease ◽

10.1094/pdis.2000.84.1.100c ◽

2000 ◽

Vol 84 (1) ◽

pp. 100-100 ◽

Cited By ~ 6

Author(s):

M. C. Rivera ◽

E. R. Wright

Keyword(s):

Buenos Aires ◽

Morphological Characteristics ◽

Potato Dextrose Agar ◽

Commonwealth Mycological Institute ◽

Conidial Suspension ◽

Koch’S Postulates ◽

First Report ◽

Pure Cultures ◽

Pathogenicity Testing ◽

Koch's Postulates

The most important azalea (Rhododendron spp.) growing area in Argentina is located in the outskirts of Buenos Aires. A disease of the azalea flower was detected during surveys conducted during September 1998. Irregular brown spots were uniformly distributed on petals and resulted in a flower blight that did not lead to abscission of petals. Pieces of infected petals were surface-sterilized for 1 min in 2% NaOCl, plated on potato dextrose agar, and incubated at 24 ± 2°C. Pure cultures were identified as Pestalotiopsis guepini (Desmaz.) Steyaert (synamorph P. guepini Desmaz.) based on morphological characteristics (1,2). Inoculation for pathogenicity testing was carried out by spraying a conidial suspension (1 × 106 conidia per ml) on plants with previously punctured petals. Inoculated plants with unwounded flowers, as well as noninoculated controls, were included. Plants were incubated in moist chambers at 24°C. Symptoms appeared on all punctured flowers within 4 to 5 days. Petals were blighted by 9 days after inoculation and were covered with black acervuli by 12 days after inoculation. Unwounded and noninoculated controls remained symptomless. The pathogen was reisolated from inoculated flowers, completing Koch's postulates. Pathogenicity of P. guepini on azalea leaves in Argentina was reported in 1991. This is the first report of P. guepini causing disease on azalea flowers in Argentina. References: (1) J. E. M. Mordue. CMI Descr. Pathog. Fungi Bact. No. 320, 1971. (2) B. C. Sutton. 1980. The Coelomycetes. Commonwealth Mycological Institute, Kew, England.

Download Full-text

First report of Rhizoctonia solani Kühn AG 2-2 LP in Zoyzia japonica Steud in Brazil

Summa Phytopathologica ◽

10.1590/0100-5405/221916 ◽

2020 ◽

Vol 46 (4) ◽

pp. 289-298

Author(s):

Maria Aurea Saboya Chiaradia Picarelli ◽

Flavia Rodrigues Alves Patricio ◽

Ricardo Harakava ◽

Eliana Borges Rivas ◽

Addolorata Colariccio

Keyword(s):

Rhizoctonia Solani ◽

Mycelial Growth ◽

Its Region ◽

Anastomosis Group ◽

Large Patch ◽

First Report ◽

Rdna Its ◽

Rdna Its Region ◽

Important Disease

ABSTRACT The use of cultivated grasses in Brazil has grown by 40% between 2010 and 2015, and the species Zoysia japonica Steud, especially the cultivar ‘Esmeralda’, corresponds to 81% of the grass market in the country. The most important disease affecting zoysia grass, known as large patch, is caused by Rhizoctonia solani and occurs in the Brazilian lawns particularly during winter months. The aim of this study was to contribute to the identification and characterization of the anastomosis group of R. solani isolates from lesions typical of large patch collected from ‘Esmeralda’ grass at gardens and golf courses in the states of São Paulo and Bahia, Brazil. All 12 obtained isolates presented dark-brown colonies with aerial mycelial growth, multinucleated hyphae and absence of concentric zonation or sclerotia, and showed their greatest mycelial growth rate at 25°C. In pathogenicity experiments, except three out of R. solani isolates, reduced the growth of zoysia grass. Based on the analysis of sequences of the rDNA-ITS region, the isolates clustered with reference isolates of the anastomosis group AG 2-2 LP. Phylogenetic inference showed that the Brazilian isolates are grouped into two clades that shared the same common ancestral with 96% bootstrap. One of the clades includes only Brazilian isolates while the other one also includes American and Japanese R. solani isolates AG 2-2 LP. This is the first report and characterization of R. solani AG 2-2 LP in zoysiagrass in Brazil.

Download Full-text

First Report of Sclerotinia Stem Rot Caused by Sclerotinia sclerotiorum on Hibiscus trionum in New York

Plant Disease ◽

10.1094/pdis-93-6-0673a ◽

2009 ◽

Vol 93 (6) ◽

pp. 673-673

Author(s):

J. Strauss ◽

H. R. Dillard

Keyword(s):

United States ◽

Sclerotinia Sclerotiorum ◽

The United States ◽

Potato Dextrose Agar ◽

Stem Rot ◽

Stem Tissue ◽

Sclerotinia Stem Rot ◽

American Phytopathological Society ◽

First Report ◽

Hibiscus Trionum

Hibiscus trionum L. (Venice mallow) is an annual weed widely distributed in the United States. In September of 2008, Venice mallow plants with bleached stems and necrotic tissues were observed in a commercial field of cabbage (Brassica oleracea L. cv. Moreton) in Geneva, NY. White, cottony mycelium and dark sclerotia were readily found on the stems and in the stem pith. Cabbage plants in direct contact with diseased Venice mallow also displayed signs and symptoms of infection by Sclerotinia sclerotiorum (Lib.) de Bary. Sclerotia from within diseased Venice mallow stems were placed in 9-cm-diameter petri plates on potato dextrose agar amended with 0.1 g/liter each of chloramphenicol and streptomycin (ABPDA) and incubated at room temperature. In addition, diseased stem tissue was surface disinfested for 3 min in 0.525% sodium hypochlorite solution, rinsed for 3 min in sterile distilled water, and placed on ABPDA. After 5 days, hyphae from the colony margin were excised and transferred to potato dextrose agar (PDA) plates. Fungal cultures consisting of white mycelia and medium-sized (~4 mm), black, irregular sclerotia were consistently recovered and identified as S. sclerotiorum based on morphological characteristics (1). Pathogenicity of two isolates (one from a sclerotium and one from stem tissue) was determined by inoculating seven 43-day-old Venice mallow plants growing in greenhouse pots (65 mm in diameter). Mycelia plugs (7 mm in diameter) were excised from 2-day-old PDA cultures of each isolate and placed on the stems at the soil line. Seven control plants were inoculated with noncolonized PDA plugs. All plants were enclosed in plastic bags for 72 h and placed under shade in the greenhouse with temperatures from 20 to 38°C (average 27°C). Symptoms similar to those observed in the affected fields were evident within 2 days after inoculation, while control plants remained symptomless. S. sclerotiorum was successfully recovered from infected plant tissue, fulfilling Koch's postulates. The experiment was repeated with similar results. To our knowledge, this is the first report of Sclerotinia stem rot of Hibiscus trionum caused by S. sclerotiorum (2,3). References: (1) L. Buchwaldt. Sclerotinia White Mold. Page 43 in: Compendium of Brassica Diseases, 1st ed. S. R. Rimmer et al., eds. The American Phytopathological Society, St. Paul, MN, 2007. (2) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, MN, 1989. (3) C. Wehlburg et al. Index of Plant Diseases in Florida. Fla Dep. Agric. Consum. Serv. Bull. 11, 1975.

Download Full-text

Effects of Long-Wave UV Light on Monilinia Growth and Identification of Species

Plant Disease ◽

10.1094/pdis.1999.83.1.62 ◽

1999 ◽

Vol 83 (1) ◽

pp. 62-65 ◽

Cited By ~ 48

Author(s):

A. De Cal ◽

P. Melgarejo

Keyword(s):

Short Distance ◽

Mycelial Growth ◽

Uv Light ◽

Dark Period ◽

Morphological Characteristics ◽

Potato Dextrose Agar ◽

Long Wave ◽

The World ◽

Identification Of Species ◽

Respective Species

The effect of long-wave UV/dark period on mycelial growth of 46 isolates of Monilinia sp. collected in Spain and 16 isolates collected from other parts of the world was investigated. Typical isolates of M. laxa, M. fructigena, and M. fructicola were grown in the dark and identified by morphological characteristics. Long-wave UV/dark conditions reduced the growth rates of M. laxa, M. fructigena, and M. fructicola on potato dextrose agar. All isolates of M. fructigena grew more slowly than those of M. fructicola. Typical and atypical isolates of M. fructigena and M. fructicola were placed in their respective species based on long-wave UV/dark growth rate data. M. laxa isolates were readily distinguished by the short distance from their conidium to the first germ tube branch. The involvement of different photoreceptors in photoresponses by M. fructicola and M. fructigena is discussed. Differences in mycelial growth under long-wave UV may be a useful tool to identify Monilinia spp.

Download Full-text