First Report of Cabbage leaf curl virus (Family Geminiviridae) in Georgia

Cabbage and collard greens were inflicted with a previously undescribed virus-like disease during the fall 2000. Symptoms on leaves were yellow spots, vein clearing, mosaic, curling, and puckering. Symptomatic plants were widespread in Brooks, Colquitt, Grady, and Pierce counties in Georgia. Disease incidence ranged from 10 to 20% in the majority of the fields surveyed but some fields had 100% incidence. Fields were heavily infested by Bemisia argentifolii and the symptoms were suggestive of a whitefly-transmitted geminivirus infection. A polymerase chain reaction (PCR)-based diagnostic test for geminivirus was conducted. Total DNA was extracted from symptomatic cabbage and collard green plants collected from commercial fields. The two primers, 5'-GCCCACATYGTCTTYCCNGT-3' and 5'- GGCTTYCTRTACATRGG-3' (2,3), are “universal” for genus Begomovirus of family Geminiviridae. The primer pair could amplify a part of the replicase-associated protein and coat protein and the complete common region of DNA-A. The PCR gave a DNA band of expected size (1.1 kb) from both symptomatic cabbage and collard green samples, whereas no such product was obtained from healthy samples, suggesting that the causal agent could be a geminivirus. To establish the identity of the virus, the 1.1 kb PCR product was cloned into pGEM-T Easy (Promega) and sequenced. GenBank search showed that the geminivirus isolated in Georgia was most closely related (98% sequence identity) to Cabbage leaf curl virus (accession number U65529) reported from Florida (1). The virus was mechanically transmitted to healthy cabbage and collard green plants under experimental conditions. To our knowledge, this is the first report of Cabbage leaf curl virus from Georgia. References: (1) A. M. Abouzid et al. Phytopathology 82:1070, 1992. (2) S. S. Pappu et al. Plant Dis. 84:370, 2000. (3) M. R. Rojas et al. Plant Dis. 77:340–347, 1993.

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

Integrated Management of Tomato Yellow Leaf Curl Virus and its Whitefly Vector in Tomato

Journal of Economic Entomology ◽

10.1093/jee/toz051 ◽

2019 ◽

Vol 112 (4) ◽

pp. 1526-1540 ◽

Cited By ~ 6

Author(s):

David G Riley ◽

Rajagopalbabu Srinivasan

Keyword(s):

Symptom Severity ◽

Virus Disease ◽

Disease Incidence ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Virus Family ◽

Tomato Yield ◽

Tomato Cultivars ◽

Leaf Curl Virus ◽

Leaf Curl

AbstractWhitefly-transmitted Tomato yellow leaf curl virus (Family Geminiviridae; Genus Begomovirus) severely restricts tomato production in the Southeastern United States. Whitefly and tomato yellow leaf curl virus management studies typically investigate control tactics individually, but successful management of this pest complex more often relies on a combination of tactics. This study examined the individual and combined effects of tomato yellow leaf curl virus-resistant cultivars, insecticides, and metallic reflective mulch on whiteflies, tomato yellow leaf curl virus disease incidence, and marketable tomato yields using split-split plot trials over 3 yr. Reflective mulch significantly reduced whitefly adults and nymphs and tomato yellow leaf curl virus symptom severity in all 3 yr of the study. Reflective mulch treatments also provided greater marketable tomato yield in 2 out of 3 yr. Imidacloprid and cyantraniliprole treatments reduced whitefly adults and nymphs’ establishment and marginally increased yields, but there was no significant insecticide effect on tomato yellow leaf curl virus incidence/symptom severity compared with the non-treated check. Virus-resistant tomato cultivars did not influence whitefly populations, but provided consistent reduction in virus disease incidence. Interactions between host plant resistance and insecticide treatments ranged from strongly additive in the standard white plastic mulch treatment to only marginally additive in the reflective mulch treatments in terms of enhancing tomato yields. tomato yellow leaf curl virus-resistant tomato cultivars and reflective mulch provided the bulk of the protection against tomato yellow leaf curl virus disease incidence. However, it was the combination of all the best tactics (reflective mulch, cyantraniliprole, ‘Security’ hyb. tomato yellow leaf curl virus-resistant) that provided the maximum increase in marketable tomato yield (2.8-fold) over the least effective combination (white mulch, no whitefly insecticide, ‘FL47’ hyb. tomato yellow leaf curl virus-susceptible).

Download Full-text

First Report of Squash leaf curl virus in Squash (Cucurbita pepo), Melon (Cucumis melo), and Cucumber (Cucumis sativa) in the Northern West Bank of the Palestinian Authority

Plant Disease ◽

10.1094/pdis-94-5-0640b ◽

2010 ◽

Vol 94 (5) ◽

pp. 640-640 ◽

Cited By ~ 10

Author(s):

M. S. Ali-Shtayeh ◽

R. M. Jamous ◽

E. Y. Husein ◽

M. Y. Alkhader

Keyword(s):

Cucumis Melo ◽

Cucurbita Pepo ◽

West Bank ◽

Disease Incidence ◽

Palestinian Authority ◽

The West ◽

First Report ◽

Squash Leaf Curl Virus ◽

Leaf Curl Virus ◽

Leaf Curl

In the summers and falls of 2008 and 2009, cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; and melon, Cucumis melo L.) from 23 of 33 cucurbit fields surveyed at three districts (Jenin, Nablus, and Tulkarm) in the West Bank of the Palestinian Authority exhibited curled, blistered, yellowed, and mottled leaves and small deformed fruits. Disease incidence ranged from 24 to 100% and was associated with whitefly (Bemesia tabaci) infestation. In symptomatic leaves of 94 plants (89 squash, 3 cucumber, and 2 melon) of 208 plants examined, geminiviral DNA was detected by PCR and rolling circle amplification (1). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerate primers PAL1v1978/pPAR1c496, for DNA-A component and PBL1v2040l/PCRc1 for DNA- B component (4). A fragment from DNA-A was amplified using specific primers for DNA-A: SLCVSTCF1F (ATAATCTAGACCATGGGGTGTCCTCTCAACTTTCTCA) and SLCVSTCF3R (ATATGGATCCATTTAAATTCTTCACAAAGCGTTCCTG) and the generated PCR product was sequenced. A DNA-A fragment (922 bp) from a conserved region of the coat protein (AV1) gene showed 98, 98, 97, and 96% nucleotide identity with sequences of Squash leaf curl virus (SLCV) isolates from Jordan (GenBank Accession No. EF532620), Egypt (DQ285019), California (DQ285016), and Arizona (AF256203), respectively. Nonviruliferous whiteflies were allowed to feed on symptomatic cucurbit plants for 48 h. The whiteflies were then transferred to 30 healthy squash seedlings at the first-leaf stage and given a 48-h inoculation access period. Typical SLCV symptoms developed in these plants 9 to 10 days postinoculation (1). Until recently, SLCV was restricted to North America; however, in 2003, the first record on its occurrence in the Middle East was in Israel where it caused severe epidemics and disease incidence reached 100% (2). In 2006, the virus was reported to cause the severe symptoms observed in squash fields in Egypt (3). More recently, in 2008, it was detected in all surveyed areas in Jordan and disease incidence reached 95% in squash samples collected from the Dir Alla area (1). The new emergent disease in the Palestinian Authority was detected in all surveyed squash fields located in the Jenin District, in an area (Al-Fara') about 25 km to the west of Dir Alla in Jordan. Only a few sporadic cases were found in cucumber fields (three isolates) in Tulkarm and in melon fields (two isolates) in Nablus. This indicates that the virus might have spread from Jordan via viruliferous whiteflies or seedlings. The virus endangers the production of squash in the affected areas to the point of becoming the limiting factor of growing squash in open fields. To our knowledge, this is the first report of a whitefly-transmitted geminivirus infecting cucurbits in the Palestinian Authority. References: (1) A. Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Y. Antignus et al. Phytoparasitica 31:415, 2003. (3) A. M. Idris et al. Plant Dis. 90:1262, 2006. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

First Report of Cabbage Leaf Curl Virus Infecting Common Bean, Cowpea, Pigeon Pea, and Mucuna pruriens in Ecuador

Plant Disease ◽

10.1094/pdis-05-18-0817-pdn ◽

2018 ◽

Vol 102 (12) ◽

pp. 2667 ◽

Cited By ~ 2

Author(s):

E. Fiallo-Olivé ◽

D. T. Chirinos ◽

R. Castro ◽

J. Navas-Castillo

Keyword(s):

Common Bean ◽

Pigeon Pea ◽

Mucuna Pruriens ◽

First Report ◽

Cabbage Leaf Curl Virus ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽

10.1094/pdis-09-18-1558-pdn ◽

2019 ◽

Vol 103 (6) ◽

pp. 1437-1437 ◽

Cited By ~ 2

Author(s):

M. Granier ◽

L. Tomassoli ◽

A. Manglli ◽

M. Nannini ◽

M. Peterschmitt ◽

...

Keyword(s):

Resistance Gene ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Virus Recombinant ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

Effects of Tomato Leaf Curl Virus on Growth and Yield Parameters of Tomato Crop

Arab Journal Of Plant Protection ◽

10.22268/ajpp-039.1.079083 ◽

2021 ◽

Vol 39 (1) ◽

pp. 79-83

Author(s):

Yasir Iftikhar ◽

◽

Mustansar Mubeen ◽

Ashara Sajid ◽

Mohamed Ahmad Zeshan ◽

...

Keyword(s):

Disease Severity ◽

Disease Incidence ◽

Tomato Leaf ◽

Growth And Yield ◽

Tomato Crop ◽

Tomato Leaf Curl Virus ◽

Yield Parameters ◽

Tomato Leaf Curl ◽

Leaf Curl Virus ◽

Leaf Curl

Iftikhar, Y., M. Mubeen, A. Sajid, M.A. Zeshan, Q. Shakeel, A. Abbas, S. Bashir, M. Kamran and H. Anwaar. 2021. Effects of Tomato Leaf Curl Virus on Growth and Yield Parameters of Tomato Crop. Arab Journal of Plant Protection, 39(1): 79-83. Tomato is an important vegetable crop, belongs to the family Solanaceae and is the second most consumed vegetable following potatoes. The tomato crop is grown all over the world in both summer and winter seasons, and plant viruses are a major threat to tomato production. Among these viruses, tomato leaf curl virus (TLCV) causes considerable yield loss to tomato crop. This virus is transmitted by a whitefly (Bemisia tabaci) vector. In this study, the effect of TLCV infection, on the following tomato growth and yield parameters, was evaluated: plant leaf number and area, plant biomass, plant height, root length, and plant stem diameter and yield. Tomato plants were transplanted in wellprepared plots with 4 replications. The control group was covered with polyethene bag to avoid whitefly infestation. Plants were scored on the 15th and 30th day after inoculation and TLCV disease severity was recorded. Analysis of variance (ANOVA) showed the significant differences between the healthy and infected tomato plants. Moreover, growth and yield parameters were reduced with the increase in disease incidence, disease severity and whitefly infestation. Disease severity was increased with the increase in temperature during the growing season. It can be concluded from this study that TLCV significantly affects growth and yield of the tomato crop. Keywords: Tomato, Tomato leaf curl virus, TLCV, disease incidence, disease severity.

Download Full-text