scholarly journals First Report of Squash leaf curl virus in Squash (Cucurbita pepo), Melon (Cucumis melo), and Cucumber (Cucumis sativa) in the Northern West Bank of the Palestinian Authority

Plant Disease ◽  
2010 ◽  
Vol 94 (5) ◽  
pp. 640-640 ◽  
Author(s):  
M. S. Ali-Shtayeh ◽  
R. M. Jamous ◽  
E. Y. Husein ◽  
M. Y. Alkhader
Keyword(s):  
Cucumis Melo ◽  
Cucurbita Pepo ◽  
West Bank ◽  
Disease Incidence ◽  
Palestinian Authority ◽  
The West ◽  
First Report ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

In the summers and falls of 2008 and 2009, cucurbit plants (squash, Cucurbita pepo L.; cucumber, Cucumis sativus L.; and melon, Cucumis melo L.) from 23 of 33 cucurbit fields surveyed at three districts (Jenin, Nablus, and Tulkarm) in the West Bank of the Palestinian Authority exhibited curled, blistered, yellowed, and mottled leaves and small deformed fruits. Disease incidence ranged from 24 to 100% and was associated with whitefly (Bemesia tabaci) infestation. In symptomatic leaves of 94 plants (89 squash, 3 cucumber, and 2 melon) of 208 plants examined, geminiviral DNA was detected by PCR and rolling circle amplification (1). Geminivirus DNA-A and DNA-B component fragments were amplified by PCR using degenerate primers PAL1v1978/pPAR1c496, for DNA-A component and PBL1v2040l/PCRc1 for DNA- B component (4). A fragment from DNA-A was amplified using specific primers for DNA-A: SLCVSTCF1F (ATAATCTAGACCATGGGGTGTCCTCTCAACTTTCTCA) and SLCVSTCF3R (ATATGGATCCATTTAAATTCTTCACAAAGCGTTCCTG) and the generated PCR product was sequenced. A DNA-A fragment (922 bp) from a conserved region of the coat protein (AV1) gene showed 98, 98, 97, and 96% nucleotide identity with sequences of Squash leaf curl virus (SLCV) isolates from Jordan (GenBank Accession No. EF532620), Egypt (DQ285019), California (DQ285016), and Arizona (AF256203), respectively. Nonviruliferous whiteflies were allowed to feed on symptomatic cucurbit plants for 48 h. The whiteflies were then transferred to 30 healthy squash seedlings at the first-leaf stage and given a 48-h inoculation access period. Typical SLCV symptoms developed in these plants 9 to 10 days postinoculation (1). Until recently, SLCV was restricted to North America; however, in 2003, the first record on its occurrence in the Middle East was in Israel where it caused severe epidemics and disease incidence reached 100% (2). In 2006, the virus was reported to cause the severe symptoms observed in squash fields in Egypt (3). More recently, in 2008, it was detected in all surveyed areas in Jordan and disease incidence reached 95% in squash samples collected from the Dir Alla area (1). The new emergent disease in the Palestinian Authority was detected in all surveyed squash fields located in the Jenin District, in an area (Al-Fara') about 25 km to the west of Dir Alla in Jordan. Only a few sporadic cases were found in cucumber fields (three isolates) in Tulkarm and in melon fields (two isolates) in Nablus. This indicates that the virus might have spread from Jordan via viruliferous whiteflies or seedlings. The virus endangers the production of squash in the affected areas to the point of becoming the limiting factor of growing squash in open fields. To our knowledge, this is the first report of a whitefly-transmitted geminivirus infecting cucurbits in the Palestinian Authority. References: (1) A. Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Y. Antignus et al. Phytoparasitica 31:415, 2003. (3) A. M. Idris et al. Plant Dis. 90:1262, 2006. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 428-428 ◽  
Author(s):  
F. Haj Ahmad ◽  
W. Odeh ◽  
G. Anfoka
Keyword(s):  
Tomato Yellow Leaf ◽  
Virus Species ◽  
Yellow Leaf ◽  
First Report ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Symptomatic Plant ◽  
Mexican Isolate ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

scholarly journals First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽  
2001 ◽  
Vol 85 (6) ◽  
pp. 678-678 ◽  
Author(s):  
A. D. Avgelis ◽  
N. Roditakis ◽  
C. I. Dovas ◽  
N. I. Katis ◽  
C. Varveri ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Rflp Analysis ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Comparisons ◽  
Tomato Plants ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Squash leaf curl virus. [Distribution map].

2014 ◽  
Author(s):  
Keyword(s):  
Saudi Arabia ◽  
Central America ◽  
Cucumis Melo ◽  
Citrullus Lanatus ◽  
Distribution Map ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Virus Distribution ◽  
New Distribution ◽  
Leaf Curl

Abstract A new distribution map is provided for Squash leaf curl virus. Geminiviridae: Begomovirus. Hosts: Cucurbita spp., melon (Cucumis melo), watermelon (Citrullus lanatus), cucumber (Cucumis sativus). Information is given on the geographical distribution in Asia (Israel, Jordan, Lebanon, Saudi Arabia), Africa (Egypt), North America (Mexico, USA, Arizona, California, Texas), Central America & Caribbean (Guatemala).

scholarly journals First Report of Cabbage leaf curl virus (Family Geminiviridae) in Georgia

Plant Disease ◽  
2001 ◽  
Vol 85 (5) ◽  
pp. 561-561 ◽  
Author(s):  
B. Mandal ◽  
D. B. Langston ◽  
H. R. Pappu ◽  
G. H. Beard ◽  
T. A. Kucharek ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Experimental Conditions ◽  
Virus Family ◽  
Green Plants ◽  
First Report ◽  
Cabbage Leaf Curl Virus ◽  
Pcr Product ◽  
Leaf Curl Virus ◽  
Collard Green ◽  
Leaf Curl

Cabbage and collard greens were inflicted with a previously undescribed virus-like disease during the fall 2000. Symptoms on leaves were yellow spots, vein clearing, mosaic, curling, and puckering. Symptomatic plants were widespread in Brooks, Colquitt, Grady, and Pierce counties in Georgia. Disease incidence ranged from 10 to 20% in the majority of the fields surveyed but some fields had 100% incidence. Fields were heavily infested by Bemisia argentifolii and the symptoms were suggestive of a whitefly-transmitted geminivirus infection. A polymerase chain reaction (PCR)-based diagnostic test for geminivirus was conducted. Total DNA was extracted from symptomatic cabbage and collard green plants collected from commercial fields. The two primers, 5'-GCCCACATYGTCTTYCCNGT-3' and 5'- GGCTTYCTRTACATRGG-3' (2,3), are “universal” for genus Begomovirus of family Geminiviridae. The primer pair could amplify a part of the replicase-associated protein and coat protein and the complete common region of DNA-A. The PCR gave a DNA band of expected size (1.1 kb) from both symptomatic cabbage and collard green samples, whereas no such product was obtained from healthy samples, suggesting that the causal agent could be a geminivirus. To establish the identity of the virus, the 1.1 kb PCR product was cloned into pGEM-T Easy (Promega) and sequenced. GenBank search showed that the geminivirus isolated in Georgia was most closely related (98% sequence identity) to Cabbage leaf curl virus (accession number U65529) reported from Florida (1). The virus was mechanically transmitted to healthy cabbage and collard green plants under experimental conditions. To our knowledge, this is the first report of Cabbage leaf curl virus from Georgia. References: (1) A. M. Abouzid et al. Phytopathology 82:1070, 1992. (2) S. S. Pappu et al. Plant Dis. 84:370, 2000. (3) M. R. Rojas et al. Plant Dis. 77:340–347, 1993.

scholarly journals Resistanceto Cucurbit Leaf Crumple Virus in Melon

HortScience ◽  
2005 ◽  
Vol 40 (4) ◽  
pp. 1108E-1109 ◽  
Author(s):  
James D. McCreight ◽  
Hsing-Yeh Liu ◽  
Thomas A. Turini
Keyword(s):  
Sweet Potato ◽  
Cucumis Melo ◽  
Field Data ◽  
Field Tests ◽  
Squash Leaf Curl Virus ◽  
Biotype B ◽  
Leaf Curl Virus ◽  
Cucurbit Leaf Crumple Virus ◽  
Greenhouse Tests ◽  
Leaf Curl

Cucurbit leaf crumple geminivirus (CuLCrV) is transmitted by sweet-potato whitefly (Bemisia tabaci) biotype B (SPWF-B) and occurs on cucurbits in Arizona, California, Texas, and Mexico. This virus is identical to Cucurbit leaf curl virus, and their symptoms are similar to Squash leaf curl virus on squash (Cucurbita sp.) and Melonleaf curl virus on melon (Cucumis melo L.). Melon has been reported to be either susceptible to CuLCrV, or to have the ability to recover from infection. Twenty-three melon cultigens were inoculated with CuLCrV in greenhouse tests using SPWF-B. Eighteen of the cultigens tested were highly susceptible to CuLCrV (≥60% infected plants) and generally exhibited pronounced CuLCrV symptoms: `Amarillo', `Edisto 47', `Esteem', `Fuyu 3', `Impac', `Moscatel Grande', `Negro', `Perlita', PI 234607, PI 236355, PI 414723, `PMR 5', `Seminole', `Sol Dorado', `Sol Real', `Top Mark', `Vedrantais', and WMR 29. Five cultigens were resistant to CuLCrV (<40% infected plants that exhibited restricted, mild symptoms): MR-1, PI 124111, PI 124112, PI 179901, and PI 313970. Symptoms abated with time in both groups although infected plants remained positive for the virus. Ten of the cultigens (`Edisto 47', `Fuyu 3', `Impac', MR-1, PI 124112, PI 313970, PI 414723, `PMR 5', `Top Mark', and WMR 29) were included in field tests in 2003 and 2004 that were naturally infected with CuLCrV. With the exception of PI 414723, the greenhouse and field data were consistent for reaction to CuLCrV.

scholarly journals Characterization of a Synergistic Interaction Between Two Cucurbit-Infecting Begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus

2011 ◽  
Vol 101 (2) ◽  
pp. 281-289 ◽  
Author(s):  
Tali Sufrin-Ringwald ◽  
Moshe Lapidot
Keyword(s):  
Eastern Mediterranean ◽  
Dual Infection ◽  
Synergistic Interaction ◽  
Bipartite Begomoviruses ◽  
Disease Symptoms ◽  
Squash Leaf Curl Virus ◽  
Effect On Yield ◽  
Leaf Curl Virus ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Squash leaf curl virus (SLCV) and Watermelon chlorotic stunt virus (WmCSV) are cucurbit-infecting bipartite begomoviruses. Both viruses are found in the eastern Mediterranean basin but the effects of dual infection of both viruses on melon (Cucumis melo L.) have not been described. ‘Arava’ melon plants were inoculated in the greenhouse, using whiteflies, with either SLCV, WmCSV, or both. Control plants were exposed to nonviruliferous whiteflies or not exposed at all. Following inoculation, plants were transplanted to a 50-mesh insect-proof nethouse and grown until fruit maturity. The experiment was performed in two melon-growing seasons: spring, transplant in May and harvest in July; and summer, transplant in August and harvest in October. Following inoculation, SLCV-infected melon plants showed mild symptoms that disappeared with time, and there was no effect on plant height. WmCSV-infected plants developed disease symptoms that became more obvious with time, and plants were somewhat shorter than control plants in the spring but not in the summer. SLCV had no effect on yield, regardless of season. WmCSV had no statistically significant effect on yield in the spring but, in the summer, reduced yield by 22%, on average. Dual-inoculated plants showed a synergistic interaction between the two viruses. They developed disease symptoms that were more pronounced than WmCSV alone, with plants being shorter than control plants by 20 to 25% regardless of season. Moreover, the yield of dual-inoculated plants was reduced on average by 21% in the spring and 54% in the summer, and fruit appearance was adversely affected. Dual inoculation did not affect WmCSV DNA level but SLCV DNA level was increased several-fold by the presence of WmCSV.

West Bank Areas A, B and C – How Did They Come into Being?

2021 ◽  
pp. 1-11
Author(s):  
Joel Singer
Keyword(s):  
West Bank ◽  
Palestinian Authority ◽  
The West ◽  
Oslo Accords

Abstract This article tells the story of how and why, when negotiating the Israeli-Palestinian Oslo Accords in 1993–95, the author developed the concept of dividing the West Bank into three areas with differing formulas for allocating responsibilities between Israel and the Palestinian Authority in each. The origin of how these areas were named is also discussed. This negotiation demonstrates that parties are prepared to modify ideological positions when detailed and practical options are presented that constitute a hybrid to the parties’ former positions.

Sign in / Sign up

Export Citation Format

Share Document