scholarly journals Appearance of Tomato yellow leaf curl virus in North Carolina

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
J. E. Polston ◽  
T. R. Rosebrock ◽  
T. Sherwood ◽  
T. Creswell ◽  
P. J. Shoemaker
Keyword(s):  
North Carolina ◽  
Pcr Amplification ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
The Bahamas ◽  
Tomato Production ◽  
Wide Range ◽  
Primer Sets ◽  
Leaf Curl Virus ◽  
Leaf Curl

In the summers of 2000 and 2001, tomato plants (Lycopersicon esculentum) with symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in fruit number, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were seen in Henderson County, NC. In 2001, symptomatic plants appeared in a 40-A (18.2 ha) field in 12 foci of ≈12 plants each, at a total incidence of less than 1%. In August 2001, DNA was extracted from leaf samples from four symptomatic plants and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses. Two sets of primers were used to test for begomoviruses, AC1048 and PCRv181 (3,4), which amplify a 1,020-bp DNA product from a wide range of monopartite and bipartite (A component only) begomoviruses, and C473 and PTYC1v2406, which preferentially amplifies a 859-bp DNA product from the monopartite TYLCV (1,2). Fragments of the expected size were obtained from all four samples, and all PCR products were sequenced. The sequences of the 1,020-bp PCR product from each of the four samples were compared and found to be 100% identical. The same was found for the 859-bp products. These sequences were compared with equivalent regions of begomoviruses and were identical to sequences of TYLCV. Since the two primer sets amplify overlapping regions of the TYLCV genome, the 1,020 and 859-bp products generated by the two primer sets from one plant were combined to create a 1,464-bp sequence that represented approximately half of the TYLCV genome and encompasses the C4 ORF, the intergenic region, and most of the coat protein gene. This 1,464-bp sequence from North Carolina was 99.2 to 99.6% identical to TYLCV sequences reported from Cuba (GenBank Accession No. AJ223505), the Dominican Republic (GenBank Accession No. AF024715), and Florida, and 96.9 to 98.2% identical to TYLCV sequences reported from the Bahamas, Israel (GenBank Accession No. X15656), Jamaica (GenBank Accession No. U84146), Mexico (GenBank Accession No. AF168709), and Spain (GenBank Accession No. AF071228). Symptomatic plants appeared to be infected with an isolate of TYLCV that is most similar to TYLCV isolates reported from Florida and the northeastern Caribbean. To our knowledge, this is the first report of TYLCV in North Carolina. TYLCV may have been introduced on transplants since the infected plants showed symptoms at an early growth stage. The appearance of infected plants in clusters of limited size suggests no spread or very limited spread in the field. Reports of populations of the whitefly (Bemisia tabaci) vector in the field were not available since whiteflies are not normally a problem in this area due to the higher altitude and relatively cool temperatures characteristic of Henderson County. It is not clear at this time what threat TYLCV poses to tomato production in the county, though its appearance indicates that the geographic range of TYLCV is continuing to expand in the southeastern United States. References: (1) M. Ghanim et al. Virology 240:295, 1998. (2) M. K. Nakhla et al. Phytopathol. Mediterr. 32:163, 1993. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

scholarly journals Identification of Tomato yellow leaf curl virus-Is in The Bahamas

Plant Disease ◽  
2000 ◽  
Vol 84 (5) ◽  
pp. 592-592 ◽  
Author(s):  
X. Sinisterra ◽  
C. P. Patte ◽  
S. Siewnath ◽  
J. E. Polston
Keyword(s):  
Dominican Republic ◽  
Infectious Clone ◽  
Monopartite Begomoviruses ◽  
Tomato Yellow Leaf ◽  
Common Source ◽  
Yellow Leaf ◽  
The Bahamas ◽  
Wide Range ◽  
Leaf Curl Virus ◽  
Leaf Curl

In December 1996, symptoms of stunting, curling, and marginal chlorosis of leaves, reduced leaf size, and marked reduction in number of fruits were first seen in tomato (Lycopersicon esculentum) plants on the island of North Andros, The Bahamas. Similar symptoms were observed for the first time during fall 1997 in tomatoes on the island of Eleuthera. Incidences of symptomatic plants were as high as 100% in some fields. Leaves from one symptomatic plant from each island were collected during April 1998. DNA was extracted from the samples and tested by polymerase chain reaction (PCR) amplification for the presence of one or more geminiviruses (2). Three sets of primers were used to amplify the extracts: PAL1c496 and PAL1v1978, which amplify an ≈1,100- or ≈1,300-bp DNA product from the A component of a wide range of bipartite and monopartite begomoviruses, respectively; primers PCRc154 and PBL1v2042, which amplify an ≈600-bp DNA fragment from the B component of a wide range of bipartite geminiviruses; and primers PCRc154 and PTYC1v2180 (5′ACTACCATGGCCGC-GCAGCGGAATAC3′), which preferentially amplify Tomato yellow leaf curl virus (TYLCV-Is) (1,2). DNA products of ≈1,300 and ≈780 bp were amplified with PAR1c496 and PAL1v1978 and PCRc154 and PTYC1v2180, respectively, from one sample from each island. No product was obtained from primers PCRc154 and PBL1v2042. The symptoms and PCR results are consistent for the presence of TYLCV. PCR products generated by primers PAL1c496 and PAL1v1978 from each sample were cloned into a pGEM-T Easy Vector (Promega, Madison, WI), and one clone from each was sequenced with vector primers. The sequences of the two 1,300-nt Bahamian clones were identical. The Bahamian clones shared 98.9% sequence homology with equivalent sequences of a TYLCV-Is clone from Florida, 99.2 and 99.4% homology with two TYLCV-Is clones from the Dominican Republic (GenBank Accession no. AF024715, and a full-length infectious clone submitted to GenBank), 98.7% homology with a clone from Cuba (GenBank Accession no. AJ223505), and 98.0% homology with the type sequence from Israel (GenBank Accession no. X15656). A deletion (28 or 29 nt) in the intergenic region was shared by clones from The Bahamas and Florida but was not present in clones from Cuba (AJ223505), the Dominican Republic (AF024715), Egypt (GenBank Accession no. L12219), Israel (X15656), Jamaica (GenBank Accession no. U84146), Lebanon (GenBank Accession no. AF160875), Mexico (GenBank Accession no. AF168709), and Spain (GenBank Accession no. AJ223505). TYLCV-Is appeared in The Bahamas and Florida at almost the same time (1). Because clones from both locations share an unusual deletion, there may be a common source for both introductions. This is the first report of TYLCV-Is in The Bahamas. Reference: (1) J. E. Polston et al. Plant Dis. 83:984, 1999. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

scholarly journals Determination of the relationship between some morphological traits of the tomato lines and resistance tomato yellow leaf curl virus disease

2019 ◽  
Author(s):  
Sinan Zengin ◽  
Aylin Kabaş ◽  
Hülya İlbi
Keyword(s):  
Morphological Traits ◽  
Virus Disease ◽  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Solanum Lycopersicum L ◽  
Biological Tests ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Background: Tomato ( Solanum lycopersicum L.) is the most produced and exported vegetable in Turkey. There are many pathogens to limit tomato production by reducing yield and fruit quality. Among them, Tomato Yellow Leaf Curl Virus (TYLCV) causes important economic losses. The most efficient and environmental friendly method against TYLCV is the use of resistant varieties. In this trial, it was aimed to determine some morphological traits which were linked to Ty-1 and Ty-3a genes which confer to TYLCV. A commercial hybrid carrying Ty-1, Ty-3a genes as heterozygous was crossed to a susceptable inbred line from Bati Akdeniz Agricultural and Research Institute (BATEM). Marker assisted selection (MAS) was carried out in F 1 and F 2 generations and biological tests were done for TYLCV resistance in F 3 generation. MAS for Ty-3a and Ty-1 genes were compatible with biological tests.

scholarly journals Determination of the relationship between some morphological traits of the tomato lines and resistance tomato yellow leaf curl virus disease

2019 ◽  
Author(s):  
Sinan Zengin ◽  
Aylin Kabaş ◽  
Hülya İlbi
Keyword(s):  
Morphological Traits ◽  
Virus Disease ◽  
Fruit Weight ◽  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Biological Tests ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Background: Tomato (Solanum lycopersicum L.) is the most produced and exported vegetable in Turkey. There are many pathogens to limit tomato production by reducing yield and fruit quality. Among them, Tomato Yellow Leaf Curl Virus (TYLCV) causes important economic losses. The most efficient and environmental friendly method against TYLCV is the use of resistant varieties. In this trial, it was aimed to determine some morphological traits which were linked to Ty-1 and Ty-3a genes which confer to TYLCV. A commercial hybrid carrying Ty-1, Ty-3a genes as heterozygous was crossed to a susceptible inbred line from Bati Akdeniz Agricultural and Research Institute (BATEM). Marker assisted selection (MAS) was carried out in F1 and F2 generations and biological tests were done for TYLCV resistance in F3 generation. MAS for Ty-3a and Ty-1 genes were compatible with biological tests. Results: In total of 95 genotypes in F3 were developed with molecular marker selection. It was determined that 30 genotypes having the Ty-3a and Ty-1 genes as homozygous resistant. The nine genotypes carried these genes in heterozygous form. 56 genotypes were identified as susceptible. The 43 morphological traits were observed in identified individuals to correlate with resistant allele, Ty-3a. Conclusions: It was found that there was statistically important correlation between Ty-3a and length of internode, length of stem at first inflorescence, status of calix, leaf attitude, length of inflorescence and plant habitus. Also there was negative correlation between fruit weight, fruit length and resistance. Therefore, we identified some morphological markers linked to Ty-3a which can be used in selection for TLYCV resistant breeding programme.

scholarly journals Diverse Regulations of Viral and Host Genes in Tomato Germplasms Responding to Tomato Yellow Leaf Curl Virus Inoculation

2021 ◽  
Author(s):  
Wanyu Xiao ◽  
Xianyu Zhou ◽  
Hailong Ren ◽  
Yijia Sun ◽  
Jiwen Zou ◽  
...  
Keyword(s):  
Resistance Mechanisms ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Virus Inhibition ◽  
Resistant Lines ◽  
Sense Strand ◽  
Virion Sense ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Tomato yellow leaf curl virus (TYLCV) is the dominating pathogen of tomato yellow leaf curl disease that caused severe loss to tomato production in China. In this study, we found that a TYLCV-resistant tomato line drastically reduced the accumulation of viral complementary-sense strand mRNAs but just moderately inhibit that of viral DNA and virion-sense strand mRNAs. However, two other resistant lines did not have such virus inhibition pattern. Analysis of differential expressed genes showed that the potential host defense-relevant processes varied in different resistant tomatoes, as compared to the susceptible line, suggesting a diversity of tomato TYLCV-resistance mechanisms.

scholarly journals The recent association of a DNA betasatellite with Tomato yellow leaf curl virus in Israel – A new threat to tomato production

2020 ◽  
Vol 128 ◽  
pp. 104995 ◽  
Author(s):  
Dana Gelbart ◽  
Lea Chen ◽  
Tamar Alon ◽  
Svetlana Dobrinin ◽  
Ilan Levin ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab
Keyword(s):  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Single Infection ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals A Mixed Infection of Lettuce chlorosis virus, Papaya ringspot virus, and Tomato yellow leaf curl virus-IL Detected in a Texas Papaya Orchard Affected by a Virus-Like Disease Outbreak

Plant Disease ◽  
2017 ◽  
Vol 101 (7) ◽  
pp. 1094-1102 ◽  
Author(s):  
Olufemi J. Alabi ◽  
M. Al Rwahnih ◽  
J. L. Jifon ◽  
M. Sétamou ◽  
J. K. Brown ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Host Record ◽  
Tomato Yellow Leaf ◽  
Ringspot Virus ◽  
Yellow Leaf ◽  
Papaya Ringspot Virus ◽  
Perennial Crop ◽  
New Host ◽  
Leaf Curl Virus ◽  
Leaf Curl

Severe virus-like symptoms consisting of mosaic, distortion, yellowing, and brittleness were observed on papaya plants in a 20-ha orchard in South Texas during the 2014–15 growing season. Incidence of symptomatic plants increased from ∼40 to 100% within 6 months of the outbreak; the most severely affected plants were stunted, and fruit yield and quality were reduced compared with asymptomatic plants. The orchard papaya plant virome was explored using the Illumina NextSeq 500 platform and results were validated by Sanger DNA sequencing of complete viral genomes obtained by PCR amplification. The combined results revealed the presence of Papaya ringspot virus (PRSV; Potyvirus), Lettuce chlorosis virus (LCV; Crinivirus), and Tomato yellow leaf curl virus-IL (TYLCV-IL; Begomovirus). The RT-PCR analyses of leaves from 51 randomly sampled papaya plants indicated the presence of PRSV, LCV, and TYLCV-IL in 100, 39.2, and 15.7% of the samples, respectively. Plants infected with PRSV, in combination with LCV and/or TYLCV-IL, exhibited more severe symptoms compared with plants infected with PRSV alone. Furthermore, successful whitefly-mediated transmission of TYLCV-IL and LCV was accomplished by exposing virus-free papaya seedlings to viruliferous Bemisia tabaci (Genn.) under greenhouse conditions. The results of this study document a new host record for LCV and the first successful whitefly-mediated transmission of TYLCV-IL and LCV to papaya. As a perennial crop, infected papaya serving as an over-seasoning reservoir for TYLCV-IL and LCV, presents a new challenge to viral disease management in papaya orchards.

scholarly journals Spatial and Temporal Physiognomies of Whitefly and Tomato Yellow Leaf Curl Virus Epidemics in Southwestern Florida Tomato Fields

2020 ◽  
Vol 110 (1) ◽  
pp. 130-145 ◽  
Author(s):  
Daniel J. Anco ◽  
Lisa Rouse ◽  
Leon Lucas ◽  
Felicia Parks ◽  
H. Charles Mellinger ◽  
...  
Keyword(s):  
Regional Scale ◽  
Tomato Yellow Leaf ◽  
Moran’S I ◽  
Weather Data ◽  
Yellow Leaf ◽  
Moran's I ◽  
Tomato Production ◽  
Daily Weather Data ◽  
Leaf Curl Virus ◽  
Leaf Curl

Epidemics of tomato yellow leaf curl virus (TYLCV; species Tomato yellow leaf curl begomovirus) have been problematic to tomato production in the southeastern United States since the first detection of the virus in Florida in the late 1990s. Current strategies for management focus on farm-centric tactics that have had limited success for controlling either TYLCV or its whitefly vector. Areawide pest management (AWPM)—loosely defined as a coordinated effort to implement management strategies on a regional scale—may be a viable management alternative. A prerequisite for development of an AWPM program is an understanding of the spatial and temporal dynamics of the target pathogen and pest populations. The objective of this study was to characterize populations of whitefly and TYLCV in commercial tomato production fields in southwestern Florida and utilize this information to develop predictors of whitefly density and TYLCV disease incidence as a function of environmental and geographical factors. Scouting reports were submitted by cooperating growers located across approximately 20,000 acres in southwestern Florida from 2006 to 2012. Daily weather data were obtained from several local weather stations. Moran’s I was used to assess spatial relationships and polynomial distributed lag regression was used to determine the relationship between weather variables, whitefly, and TYLCV. Analyses showed that the incidence of TYLCV increased proportionally with mean whitefly density as the season progressed. Nearest-neighbor analyses showed a strong linear relationship between the logarithms of whitefly densities in neighboring fields. A similar relationship was found with TYLCV incidences. Correlograms based on Moran’s I showed that these relationships extended beyond neighboring fields and out to approximately 2.5 km for TYLCV and up to 5 km for whitefly, and that values of I were generally higher during the latter half of the production season for TYLCV. Weather was better at predicting whitefly density than at predicting TYLCV incidence. Whitefly density was best predicted by the number of days with an average temperature between 16 and 24°C (T16to24), relative humidity (RH) over the previous 31 days, and vapor pressure deficit over the last 8 days. TYLCV incidence was best predicted by T16to24, RH, and maximum wind speed over the previous 31 days. Results of this study helped to identify the extent to which populations of whitefly and TYLCV exist over the agricultural landscape of southwestern Florida, and the environmental conditions that favor epidemic growth. This information was used to propose an approach to AWPM for timing control measures for managing TYLCV epidemics.

Sign in / Sign up

Export Citation Format

Share Document