scholarly journals First Report of Acidovorax avenae subsp. citrulli as a Pathogen of Gramma in Australia

Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1406-1406 ◽  
Author(s):  
H. L. Martin ◽  
C. M. Horlock
Keyword(s):  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Bacterial Cells ◽  
Carbon Source Utilization ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Plastic Bags ◽  
Symptomatic Tissue ◽  
Polymerase Chain ◽  
Slow Growing

In March 2001, a foliar bacterial disease was observed on gramma seedlings (Cucurbita moschata L.) cv. Ken Special Hybrid 864 in a commercial nursery in Bowen, north Queensland, Australia. Symptoms included chlorosis of cotyledons and angular, water-soaked lesions from the tips of the cotyledons to the petioles. Brown, angular, water-soaked lesions that were delimited by the leaf veins were also present on newly emerged true leaves. Streaming of bacterial cells from the edges of cut lesions was seen in a droplet of water with ×100 magnification. Isolations attempted on King's medium B consistently yielded a slow-growing, cream to white, gram-negative bacterium. Bacterium was identified as Acidovorax avenae subsp. citrulli based on carbon source utilization profiles (Biolog, Hayward CA) and polymerase chain reaction (PCR) using a primer pair based on the 16S-23S internal transcribed spacer region. When tested in rep-PCR with the BoxA1R primer (2), the isolate produced a banding pattern similar to other Australian A. avenae subsp. citrulli isolates previously shown to be pathogenic to rockmelon (1). Koch's postulates were completed with 20 2-week-old glasshouse-grown gramma (cv. Ken Special Hybrid 864) seedlings. Seedlings were misted until runoff with a 3 × 108 CFU/ml bacterial suspension and enclosed in plastic bags for 48 h at 23°C. Water-soaked lesions developed on cotyledons of all seedlings 6 days after inoculation, and bacterium was reisolated from symptomatic tissue. To our knowledge, this is the first report of A. avenae subsp. citrulli as a pathogen of C. moschata References: (1) R. G. O'Brien and H. L. Martin. Aust. J. Exp. Agric. 39:479, 1999 (2) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

scholarly journals First Report of Acidovorax avenae subsp. citrulli as a Pathogen of Cucumber

Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 965-965 ◽  
Author(s):  
H. L. Martin ◽  
R. G. O'Brien ◽  
D. V. Abbott
Keyword(s):  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Cucumis Sativus L ◽  
First Report ◽  
Plastic Bags ◽  
Initial Symptoms ◽  
Leaf Surfaces ◽  
Commercial Crop ◽  
Slow Growing ◽  
Dead Tissue

In March 1999, a foliar bacterial disease was observed in a commercial crop of cucumber (Cucumis sativus L.) cv. Jetset in Gumlu in northern Queensland, Australia. Initial symptoms consisted of angular, chlorotic, water-soaked lesions that later dried to necrotic areas of light brown, dead tissue. White bacterial ooze was commonly found on the undersides of young water-soaked lesions. Lesions were delimited by veins and distributed uniformly over leaf surfaces, and more than 20% of the crop was affected. No symptoms were observed on plant stems or fruits. Bacterial streaming from the edges of freshly cut young lesions was clearly visible in a droplet of water under ×100 magnification in the laboratory. Isolations were made from young lesions on King's medium B (1). A slow-growing, white, gram-negative, nonfluorescent bacterium was consistently isolated. Three isolates of the bacterium were identified, using the Biolog software program (Biolog, Hayward CA), and in each instance, the bacterium was confirmed as Acidovorax avenae subsp. citrulli, with a similarity of >0.80. Koch's postulates were completed with 8-day-old glasshouse-grown cucumber (cv. Jetset) seedlings. Seedlings were misted until runoff with a bacterial suspension of 3 × 108 CFU/ml and enclosed in plastic bags for ≈30 h at 22°C. Water-soaked lesions were observed on cucumber cotyledons 4 days after inoculation. This is the first report of A. avenae subsp. citrulli as a pathogen of cucumber. Reference: (1) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954.

scholarly journals First Report of Acidovorax avenae subsp. avenae Causing Bacterial Leaf Stripe of Strelitzia nicolai

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1474-1474 ◽  
Author(s):  
T. E. Seijo ◽  
N. A. Peres
Keyword(s):  
Pathogenic Bacteria ◽  
Fatty Acid Analysis ◽  
South Florida ◽  
Metabolic Phenotype ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
First Report ◽  
Plastic Bags ◽  
Young Leaves ◽  
Symptomatic Tissue

White bird of paradise (Strelitzia nicolai Regel & K. Koch) is a commonly grown ornamental in central and south Florida. Each summer of 2004 to 2007, a reoccurring disease was observed at a commercial nursery in central Florida. Diseased plants had brown, necrotic stripes between the lateral leaf veins, which usually appeared along the midvein and spread toward the leaf edge. Lesions developed on the youngest leaves as they emerged from the central whorl. During 2004 and 2005, 20 symptomatic leaves were sampled. A white, nonfluorescent bacterium was consistently isolated from symptomatic tissue. It induced a hypersensitive response (HR) on tomato, grew at 41°C, and was identified as a Acidovorax sp. based on fatty acid analysis and as Acidovorax avenae subsp. avenae by Biolog metabolic phenotype analysis (similarity 0.76 to 0.86). A partial 16S rRNA gene sequence (1,455 bp) (Accession No. EF418616) was identical to four sequences in the NCBI (National Center for Biotechnology Information) database: one from A. avenae subsp. avenae and three from A. avenae of undetermined subspecies. To confirm pathogenicity, a bacterial suspension (O.D590 = 0.1) was applied to fill the central whorl (~0.5 to 1 ml) of potted S. nicolai. Plants were incubated for 7 to 10 days inside plastic bags at ambient temperature. Plants were inoculated individually with five strains of A. avenae subsp. avenae, four from S. nicolai, and one from corn (ATCC19860). Two to nine plants per strain were inoculated in each experiment. All strains were tested at least twice and noninoculated control plants were included. Symptoms were reproduced on the emerging leaf of 50 to 100% of inoculated plants with all five A. avenae subsp. avenae strains. No symptoms were observed on the controls. The bacteria recovered from symptomatic tissue were confirmed to be A. avenae subsp. avenae. Corn seedlings were inoculated as described above, except that entire seedlings were sprayed. Water-soaked lesions along the length of older leaf blades developed in 4 to 7 days. Only the corn strain was pathogenic (>80% of seedlings symptomatic), indicating host specificity. To our knowledge, this is the first report of A. avenae subsp. avenae infecting S. nicolai. In 1971, Wehlburg (2) described the same symptoms on orange bird of paradise (S. reginae) as being caused by a nonfluorescent Pseudomonas sp. This report likely describes the same disease since the published description is consistent with symptoms caused by A. avenae subsp. avenae. The pathogen reported by Wehlburg (2) had one polar flagellum, reduced nitrate, produced oxidase and a HR, and utilized arabinose, but not sucrose or arginine, characteristics consistent with those of A. avenae subsp. avenae (1). The only difference was A. avenae subsp. avenae has a delayed positive starch hydrolysis (1), whereas Welhburg's strain was negative. This disease occurs mainly on young leaves when plants receive daily overhead irrigation. Incidence can be as high as 40%, occasionally causing mortality, but even mild symptoms affect appearance and reduce marketability as an ornamental. References: (1) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001. (2) C. Wehlburg. Plant Dis. Rep. 55:447, 1971.

scholarly journals First Report of Foliar Infection of Maianthemum racemosum by Phytophthora ramorum

Plant Disease ◽  
2005 ◽  
Vol 89 (2) ◽  
pp. 204-204 ◽  
Author(s):  
D. Hüberli ◽  
K. L. Ivors ◽  
A. Smith ◽  
J. G. Tse ◽  
M. Garbelotto
Keyword(s):  
Mixed Forest ◽  
Personal Communication ◽  
Culture Collection ◽  
Phytophthora Ramorum ◽  
Internal Transcribed Spacer Region ◽  
Coast Redwood ◽  
First Report ◽  
Plastic Bags ◽  
Artificial Inoculations ◽  
Water Plants

In May 2003, Phytophthora ramorum S. Werres & A.W.A.M. de Cock was isolated from the leaf tips of a single plant of false Solomon's seal (Maianthemum racemosum (L.) Link, formely known as Smilacina racemosa (L.) Desf.), a native, herbaceous perennial of the Liliaceae family, at the Jack London State Park in Sonoma County, California. Affected leaves had cream-to-brown lesions on the tips that were delimited by a yellow chlorotic zone. Lesions on the stems were not observed. The isolate (American Type Culture Collection [ATCC], Manassas, VA, MYA-3280; Centraal Bureau voor Schimmelcultures, Baarn, the Netherlands, CBS 114391) was typical of P. ramorum with large chlamydospores and caduceus, semipapillate sporangia, and the sequence (GenBank Accession No. AY526570) of the internal transcribed spacer region of the rDNA matched those published previously (4). The site, from which wood rose (Rosa gymnocarpa) was recently identified as a host, is a mixed forest containing confirmed P. ramorum-infected coast redwood (Sequoia sempervirens), California bay laurel (Umbellularia californica), and tanoak (Lithocarpus densiflora) trees (2,3). Two leaves per asymptomatic, pesticide free, potted plant of false Solomon's seal were inoculated with zoospores of the P. ramorum isolate obtained from infected false Solomon's seal (1). Five plants were inoculated in trial 1, and the following day, three plants were inoculated in trial 2. A control leaf of each plant was dipped in sterile deionized water. Plants were enclosed in plastic bags, misted regularly with sterile distilled water, and maintained at 16 to 21°C in the greenhouse. In both trials, plants did not have lesions on the leaves after 16 days and were reinoculated on separate days for each trial with higher concentrations of zoospores (1 × 105 [trial 1] and 2 × 105 [trial 2] zoospores/ml). Cream-colored lesions, similar to those observed in the field, were evident 1 week after the second inoculation and stopped progressing in both trials by 17 days. Lesions starting from the leaf tips averaged 13 mm (range 8 to 24 mm) long, and P. ramorum was reisolated on Phytophthora-selective agar medium modified with 25 mg of pentachloronitrobenzene from 44% (trial 1) and 83% (trial 2) of all lesions (4). Control leaves had no lesions, and P. ramorum was not reisolated. Sporangia were not observed on any leaves when examined with the dissecting microscope. The fact that lesions developed only after a second inoculation with higher concentrations of zoospores, and these lesions stopped progressing after 17 days, suggests that false Solomon's seal is much less susceptible than other hosts such as western starflower (Trientalis latifolia) (1) and wood rose (2). To our knowledge, this is the first report of a plant from the Liliaceae as a natural host for P. ramorum, although Smilax aspersa was identified as being susceptible in artificial inoculations of detached leaves (E. Moralejo and L. Hernández, personal communication). False Solomon's seal is popular in the horticultural industry. References: (1) D. Hüberli et al. Plant Dis. 87:599, 2003. (2) D. Hüberli et al. Plant Dis. 88:430, 2004. (3) P. E. Maloney et al. Plant Dis. 86:1274, 2002. (4) D. M. Rizzo et al. Plant Dis. 86:205, 2002.

scholarly journals First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 421-421 ◽  
Author(s):  
N. W. Gauthier ◽  
J. Polashock ◽  
T. T. Veetil ◽  
R. R. Martin ◽  
J. Beale
Keyword(s):  
Nucleic Acid ◽  
Mosaic Disease ◽  
Rt Pcr ◽  
First Report ◽  
Ctab Method ◽  
Symptomatic Tissue ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Negative Controls ◽  
Dtcs Quick Start

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5′-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

scholarly journals First Report of Bacterial Bark Canker of Walnut Caused by Brenneria nigrifluens in Hungary

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 988-988 ◽  
Author(s):  
A. Végh ◽  
A. Tóth ◽  
Á. Zámbó ◽  
G. Borsos ◽  
L. Palkovics
Keyword(s):  
16S Rdna ◽  
Juglans Regia ◽  
Negative Control ◽  
Bacterial Suspension ◽  
Lake Balaton ◽  
Biochemical Tests ◽  
First Report ◽  
Potted Plants ◽  
Sequence Identity ◽  
Plastic Bags

During August 2012, vertical oozing cankers were sporadically observed on trunks and branches of walnut trees (Juglans regia) in the city of Zánka, near Lake Balaton and other parts of Hungary including Budapest, Győr, and Tatabánya cities. Cankers were observed on trunks and branches where brownish-black exudates staining the bark appeared mainly in the summer. Isolations were performed primarily from exudates but also from infected tissues using King's medium B (KB) (3) and EMB medium (2). Colonies similar in appearance to Brenneria nigrifluens (syn.: Erwinia nigrifluens) (1,5) were isolated. The bacterium, first reported in California, was also recorded in Iran, Spain, France, and several Italian locations, on walnut trees. The bacterial strain was gram negative and did not induce a hypersensitive response on tobacco (Nicotiana tabacum L. ‘White Burley’) leaves. The bacterium grew at 26°C. Colonies on KB were white and non-fluorescent, but on EMB medium were a typical dark purple with metallic green sheen. The results of substrate utilization profiling using the API 20E kit (Biomérieux, Marcy l'Etoile, France) showed that the bacterium belonged to the Enterobacteriaceae. The strain was positive for citrate utilization, H2S, and acetoin production and urease, glucose, inositol, saccharose, and arabinose reactions. Pathogenicity was tested by injecting five young healthy walnut branches on two separate 2-year-old grafted potted plants with a bacterial suspension containing 107 CFU/ml. Negative controls were walnut branches injected with sterile distilled water. Branches were enclosed in plastic bags and incubated in a greenhouse under 80% shade at 26°C day and 17°C night temperatures. Three months after inoculation, necrotic lesions were observed in the inner bark and dark lines were observed in internal wood, but no external cankers were observed on inoculated branches. The negative control appeared normal. B. nigrifluens was re-isolated from lesions on inoculated branches and identified as described above; thus, Koch's postulates were fulfilled. For molecular identification of the pathogen, 16S rDNA amplification was performed using genomic DNA from strain Bn-WalnutZa-Hun1 with a universal bacterial primer set (63f and 1389r) (4). The PCR products were cloned into a pGEM T-Easy vector (Promega, Madison, WI) and transformed into Escherichia coli DH5α cells. A recombinant plasmid (2A2.5) was sequenced using M13 forward and reverse primers. The sequence was deposited in NCBI GenBank (Accession No. HF936707) and showed 99% sequence identity with a number of B. nigrifluens strains, including type strains Z96095.1, AJ233415.1, JX484740.1, JX484739.1, JX484738.1, and FJ611884.1. On the basis of the symptoms, colony morphology, biochemical tests, and 16S rDNA sequence identity, the pathogen was identified as Brenneria nigrifluens. To our knowledge, this is the first report of a natural outbreak of bacterial bark canker on walnut in Hungary and the presence of the pathogen may seriously influence in local orchards and garden production in the future. References: (1) L. Hauben et al. Appl Microbiol 21:384, 1998. (2) J. E. Holt-Harris and O. Teague. J. Infect. Dis. 18:596, 1916. (3) E. O. King et al. J. Lab. Clin. Med. 44:301, 1954. (4) A. M. Osborn et al. Environ. Microbiol. 2:39, 2000. (5) E. E. Wilson et al. Phytopathology 47:669, 1957.

scholarly journals First report of Southern blight, caused by Athelia rolfsii (syn. Sclerotium rolfsii Sacc.), on Hellebores in North America

Plant Disease ◽  
2021 ◽  
Author(s):  
Richard Jones ◽  
Frances Perez
Keyword(s):  
North America ◽  
Fungal Pathogens ◽  
Large Subunit ◽  
Sclerotium Rolfsii ◽  
Australasian Plant ◽  
Bacterial Disease ◽  
First Report ◽  
Southern Blight ◽  
Plastic Bags ◽  
Athelia Rolfsii

Lenten rose (Hellebores hybridus) is an herbaceous perennial grown in landscapes and valued for early spring flowers and high levels of deer resistance. An additional benefit as a landscape plant comes from the high level of disease resistance, with only three fungal pathogens reported in North America. In August of 2021, a Lenten rose plant within a mature landscape in Silver Spring, MD, USA, (lat 39.116629 long 77.043198) was found with a collapsed canopy and brown stems near the soil line. Small clusters of brown sclerotia-like objects were seen along the stem. Samples of the sclerotia and diseased tissue were dipped in 70 percent ethanol for 15 sec, transferred to 5 percent NaClO for 30 sec, immersed in sterile water for one minute, then plated onto Potato Dextrose Agar. Sclerotia-like objects germinated and white mycelia covered the plates within five days of germination. Hyphae emerged from diseased tissue within two days and also grew rapidly. Cultures from sclerotia-like objects and diseased tissue produced white sclerotia which melanized to brown spherical sclerotia ranging in size from two to four mm. Culture samples (1 cm square) were excised from the culture plates and transferred to the base of three two-year old potted hellebore plants. Control plants had blocks of PDA placed at the base of the plants. Plants were placed in plastic bags for two days to maintain humidity, then maintained at room temperature without plastic bags. Petioles turned brown and collapsed within seven days of inoculation. White, fan-like hyphae were present along with maturing sclerotia. Samples from surface sterilized tissue and sclerotia produced the same culture morphology as the originally isolated cultures. Non-inoculated plants remained healthy, and the pathogen was not isolated from non-inoculated plants. Individual DNA samples were prepared from original cultures and the re-isolated cultures. Molecular identification was performed by amplification of the internal rRNA transcribed spacer region (ITS1/4, White et al. 1990 ), the large subunit rRNA (LSU), and the elongation factor-1A (EF1a). Amplification products were cloned into TOPO-TA pcr4 vector and sequenced (Macrogen USA). Sequences were submitted to GenBank for IT1/4 (OK172559) and LSU (OK172560). Homology to ITS1/4 was found with Athelia rolfsii (MN622806), to LSU with Athelia rolfsii (MT225781) and for EF1a with Athelia rolfsii (MW322687). This is the first report of Athelia rolfsii on Hellebores in North America (Farr, D.F & Rossman, A.Y. Fungal Databases, U.S. National Fungus Collections, ARS, USDA. Retrieved September 10, 2021). This report is unique in that few pathogens are known to infect Hellebores(Taylor et al. 2011) and southern blight is not commonly isolated in landscape plantings at Maryland latitudes. 1. White et al. PCR Protocols: A Guide to Methods and Amplifications. Academic Press, San Diego, 1990 2. Taylor, R.K., Romberg, M.K. & Alexander, B.J.R. A bacterial disease of hellebore caused by Pseudomonas viridiflava in New Zealand. Australasian Plant Dis. Notes 6, 28–29, 2011.

scholarly journals First Report of Bacterial Blight of Romanesco Cauliflower (Brassica oleracea var. botrytis) Caused by Pseudomonas syringae pv. alisalensis in California

Plant Disease ◽  
2006 ◽  
Vol 90 (12) ◽  
pp. 1551-1551 ◽  
Author(s):  
S. T. Koike ◽  
K. Kammeijer ◽  
C. T. Bull ◽  
D. O'Brien
Keyword(s):  
Brassica Oleracea ◽  
Pseudomonas Syringae ◽  
Bacterial Pathogen ◽  
Acid Methyl Ester ◽  
Hypersensitive Reaction ◽  
Bacterial Suspension ◽  
First Report ◽  
Plastic Bags ◽  
Initial Symptoms ◽  
Infested Field

In 2005, a new disease was detected on commercial, organically grown romanesco (green) cauliflower (Brassica oleracea var. botrytis) grown in San Benito County, California. Initial symptoms consisted of small (1 to 2 mm in diameter), angular, water-soaked flecks. These flecks developed into tan-to-gray, angular lesions measuring as much as 5 mm in diameter. Lesions were usually surrounded by chlorotic borders. Coalescing lesions caused the leaf to turn papery in texture and have a blighted appearance. A blue-green fluorescing pseudomonad was consistently isolated from lesions on King's medium B. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Samsun). These data indicated that the bacteria belonged to Lelliot's LOPAT group 1 (2). This was confirmed with data from fatty acid methyl ester analysis (MIS-TSBA version 4.10, MIDI, Inc., Newark, DE), which showed that the strains were highly similar (similarity = 0.921 or greater) to Pseudomonas syringae. Amplification of repetitive bacterial sequences (rep-PCR) using the BOXA1R primer and the polymerase chain reaction resulted in identical banding patterns for the romanesco strains and the P. syringae pv. alisalensis pathotype strain. Pathogenicity was demonstrated by growing inoculum of six strains in nutrient broth shake cultures for 48 h (24°C), adjusting the bacterial suspension to 106 CFU/ml, and spraying the resulting suspension onto green cauliflower (cv. Romanesco Precoce). Plants were enclosed in plastic bags for 24 h and then incubated in a greenhouse (24 to 26°C). Control plants were misted with sterile water and treated the same way. After 5 days, foliar symptoms identical to symptoms seen in the field developed on all inoculated plants, and reisolated strains were characterized and found to be identical to P. syringae pv. alisalensis by the tests described above. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. To our knowledge, this is the first report of commercially grown romanesco green cauliflower as a host of P. syringae pv. alisalensis. The infested field had approximately 30% of the plants affected, with perhaps 10% sustaining some crop loss. This bacterial pathogen has previously been reported on commercial plantings of arugula (Eruca sativa), broccoli (Brassica oleracea var. botrytis), and broccoli raab (Brassica rapa var. rapa) and under experimental (greenhouse) conditions causes disease on additional hosts, including members of the Poaceae (1). References: (1) N. A. Cintas et al. Plant Dis. 86:992, 2002. (2) R. A. Lelliott. J. Appl. Bacteriol. 29:470, 1966.

scholarly journals First Report of Goss's Bacterial Wilt and Leaf Blight on Corn Caused by Clavibacter michiganensis subsp. nebraskensis in Indiana

Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 841-841 ◽  
Author(s):  
G. Ruhl ◽  
K. Wise ◽  
T. Creswell ◽  
A. Leonberger ◽  
C. Speers
Keyword(s):  
Bacterial Wilt ◽  
Leaf Blight ◽  
Causal Agent ◽  
Hypodermic Needle ◽  
Bacterial Suspension ◽  
Clavibacter Michiganensis ◽  
Gram Positive ◽  
Bacterial Gene ◽  
First Report ◽  
Symptomatic Tissue

In August of 2008, leaves of hybrid corn (Zea mays L.) and popcorn from Pulaski and Jasper counties in northwest Indiana were submitted to the Purdue Plant and Pest Diagnostic Lab with symptoms characteristic of a bacterial disease. Symptomatic leaves had large, tan-to-gray necrotic lesions with dark freckling present within the lesions. Shiny bacterial exudate was present on the surface of many of the lesions. Microscopic observation revealed no fungal structures within the lesions, and bacterial streaming was observed from the cut edge of symptomatic tissue under ×100 magnification with phase contrast. A commercially available ELISA test (Agdia Inc., Elkhart, IN) determined that samples were negative for Pantoea stewartii, the causal agent of Stewart's bacterial leaf blight and wilt. A bacterial suspension was prepared from symptomatic tissue and streaked onto King's B medium and subcultured on semiselective CNS medium (1,2). Axenic, peach-colored colonies present on the CNS medium tested gram positive with a KOH test. Analysis of fatty acid methyl esters (MIDI Inc, Newark, DE) indicated that the strain was very similar (0.611) to Clavibacter michiganensis. Amplification of the 500-bp 16S rRNA region of the bacterial gene and subsequent BLAST alignments of the resulting sequence indicated a 99% match for C. michiganensis subsp. nebraskensis (GenBank Accession Nos. AM410697 and U09763; D16S2 gene bacterial library, version 2.10; MIDI Inc,). Koch's postulates were used to confirm pathogenicity of the isolated bacteria on corn inbred B73. Eighteen plants were mechanically inoculated at growth stage V1 to V2 with a bacterial suspension of approximately 1 × 108 CFU/ml prepared from cultures grown on CNS for 10 days at 28°C (2). Inoculum was rubbed onto leaves dusted with Carborundum and 0.1 ml of the bacterial suspension was injected into stems with a hypodermic needle. Nine control plants were inoculated with sterile water. Plants were kept at greenhouse conditions (24°C) with supplemental 400W high-pressure sodium light. Within 5 to 8 days, leaves and stems of all 18 inoculated plants developed water-soaked, necrotic lesions. No symptoms were observed in control plants. Bacteria were reisolated from symptomatic plants on CNS medium as described above, and gram-positive colonies were obtained. Reisolated strains were identical to C. michiganensis subsp. nebraskensis by D16S2 DNA sequence analysis, confirming the causal agent of the disease. Disease incidence in affected fields ranged from 20 to 60% and significant yield loss was reported. This confirmation is of regulatory importance because of potential export restrictions of Indiana-grown seed corn and popcorn to select countries. To our knowledge, this is the first report of Goss's bacterial wilt and leaf blight on corn in Indiana. References: (1) D. C. Gross and A. K. Vidaver. Phytopathology 69:82, 1979. (2) L. M. Shepherd. M.S. thesis. Iowa State University. Ames, 1999.

scholarly journals First Report of Bacterial Foot Rot of Rice Caused by a Dickeya zeae in China

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1818-1818 ◽  
Author(s):  
X. M. Pu ◽  
J. N. Zhou ◽  
B. R. Lin ◽  
H. F. Shen
Keyword(s):  
16S Rdna ◽  
Guangdong Province ◽  
Gyrb Gene ◽  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Sterile Water ◽  
Foot Rot ◽  
Rice Seedlings ◽  
First Report ◽  
Negative Controls

A bacterial disease of rice, bacterial foot rot, was found in Guangdong Province, China in September 2011, with an incidence about 10%. The typical symptom was a dark brown decay of the tillers. In the early stages of the disease, a brown sheath rot seemed to spread from the ligulae regions. The lesions quickly extended down to the nodes, culms, and finally to the crowns. Neighboring tillers of the same crown were invaded systemically, causing foot rot symptoms. A soft rot with an unpleasant odor developed in young tissues of infected tillers. In the advanced stage, many tillers decayed, so that entire diseased plants could easily be pulled from the soil. Six diseased samples were collected and bacteria were isolated from the edge of symptomatic tissues, after samples were sterilized in 0.3% NaOCl for 10 min, rinsed in sterile water three times, and placed on nutrient agar (beef extract 3 g, yeast extract 1 g, peptone 5 g, glucose 10 g, agar 16 g, distilled water 1 L, pH 6.8 to 7.0). For identification, a total of 12 representative isolates were selected. All strains were Gram negative, grew at 37°C, were positive for indole production, and utilized malonate, glucose, and sucrose, but not glucopyranoside, trehalose, or palatinose. Biolog identification (Version 4.20.05, Hayward, CA) identified isolate EC1 as Pectobacterium chrysanthemi (SIM 0.827), which has since been transferred to genus Dickeya. PCR was used to amplify the 16S rDNA gene with primers 27f and 1492r, the dnaX gene with primers dnaXf and dnaXr (2), and the gyrB gene with primers gyrBf1 (5′-ATGTCGAATTCTTATGACTCCTC-3′) and gyrB-r1 (5′-TCARATATCRATATTCGCYGCTTTC-3′), which were designed based on published gyrB gene sequences of genus Dickeya. A BLASTn search of all three loci [16S rDNA (JQ284040), dnaX (JQ284041), and gyrB (JQ284042)] revealed that EC1 had 100% sequence identify to Dickeya zeae [16S rDNA (AB713560), dnaX (AB713593), gyrB (AB713635)]. Pathogenicity tests were conducted by injecting 10 rice seedlings with 100 μl of the bacterial suspension (1 × 108 CFU/ml) in the stem base, and an additional 10 rice seedlings were injected with 100 μl of sterile water as negative controls. Inoculations were carried out in a greenhouse at 28 to 32°C and 90% relative humidity. Foot rot symptoms identical to those described above were observed after 7 days on inoculated plants, but not on the negative controls. The bacterium was reisolated from the lesions and had 100% sequence identity for all three loci to EC1. Previously, similar symptoms were reported on rice in Guangdong province of China, and the causal agent was identified as Erwinia chrysanthemi (1). To our knowledge, this is the first report of D. zeae causing foot rot disease on rice in China. References: (1) Q. G. Liu et al. J. South China Agric. Univ. 18:128, 1997. (2) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009.

scholarly journals First Report of Bacterial Soft Rot on Tagetes patula Caused by Dickeya dieffenbachiae in China

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 282-282 ◽  
Author(s):  
J. X. Zhang ◽  
B. R. Lin ◽  
H. F. Shen ◽  
X. M. Pu ◽  
Z. W. Wang ◽  
...  
Keyword(s):  
Black Spot ◽  
Housekeeping Genes ◽  
Soft Rot ◽  
Early Summer ◽  
Bacterial Suspension ◽  
Bacterial Disease ◽  
Tagetes Patula ◽  
First Report ◽  
Chain Reactions ◽  
Plant Pathol

French marigold (Tagetes patula L.), originally from Mexico, is an annual herb widely planted in China because of its beautiful color, long flowering, and strong adaptability, and has been used widely for ornamentation and decorating. French marigold is also rich in patuletin, quercetagetin, and patulitrin, and is therefore applied medicinally for treating colds and coughs. In early summer 2012, soft rot symptoms on French marigold were found at three flower nurseries in Guangzhou, Guangdong Province, P. R. China, and approximately 25% of the plants had the symptoms. The symptoms included tissue collapse of the stems at the soil line followed by wilting of the whole plants. Within 1 week, the infected stems showed vascular discoloration, turned brown and then inky black, and eventually the whole plant collapsed after the basal stem was infected. Bacteria were successfully isolated from eight symptomatic plants on nutrient agar media incubated at 30°C for 48 h. Ten isolates were selected randomly for further characterization. They were gram negative, degraded pectate, negative for oxidase and positive for indole production, and utilized malonate, glucose, and sucrose but not glucopyranoside, trehalose, or palatinose. Polymerase chain reactions (PCR) were performed using the 16S primers 27f and 1495r (4) for molecular identification. Subsequent DNA sequencing showed that the representative tested strain TP1 (GenBank Accession No. JX575747) was 99% identical to that of Dickeya dieffenbachiae (JF419463) using BLASTn. Further genetic analysis of strain TP1 was performed targeting several housekeeping genes, i.e., dnaX (GenBank Accession No. JX575748) with primers dnaxf and dnaxr (3), gyrB (JX575749) with primers of gyrbf1 and gyrbr1 (1), and gapA (JX575750) with primers of gapa326f and gapa845r (2). They were most homologous to the sequences of D. dieffenbachiae, since they had 97%, 96%, and 97% identity with GenBank accessions GQ904794, JF311653, and GQ891968, respectively. Pathogenicity was confirmed by injecting all 10 original bacterial isolates into each of 10 French marigold seedlings, with approximately 100 μl of a bacterial suspension at 1 × 108 CFU/ml. Ten plants inoculated with 100 μl of sterile water served as controls. Plants were placed in a greenhouse at 30 to 32°C and 90% relative humidity. Within 48 h, soft rot symptoms appeared on all inoculated seedlings, while the control plants appeared normal. D. dieffenbachiae was reisolated from the diseased tissues, and confirmed to be the same as the inoculated pathogen by conducting a 16S rDNA sequence comparison. Previously, black spot, botrytis blight, oedema, powdery mildew, southern bacterial wilt, and damping off have been found on T. patula. To our knowledge, it is the first report of a soft rot caused by D. dieffenbachiae on French marigold. Because of the popularity and high economic value of French marigold, identification of this progressing bacterial disease is important to maintain safe production and beautiful scenery. References: (1) B. R. Lin et al. Plant Dis. 96:452, 2012. (2) S. Nabhan et al. Plant Pathol. 61:498, 2012. (3) M. Sławiak et al. Eur. J. Plant Pathol. 125:245, 2009. (4) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

Sign in / Sign up

Export Citation Format

Share Document