scholarly journals Severe Outbreak of Leaf Spot and Blight Caused by Botrytis cinerea on Majesty Palm in Southern Italy

Plant Disease ◽  
2002 ◽  
Vol 86 (7) ◽  
pp. 815-815
Author(s):  
G. Polizzi
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Spot ◽  
Southern Italy ◽  
Gray Mold ◽  
Limiting Factor ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Leaf Spots ◽  
Important Region ◽  
Leaf Tissues

Sicily is the most important region of Italy for ornamental palm cultivation. Majesty palm (Ravenea rivularis Jum. & H. Perrier) is one of the most stately palms for cultivation in the tropics and subtropics, and has been recently cultivated in containers for indoor and outdoor use in eastern Sicily. R. rivularis, which grows on river banks, is native to Madagascar, and appears to behave as a rheophyte in the seedling stage. This palm is not frost tolerant and will grow in full sun but tends to grow best in partly shaded areas or under greenhouses conditions. Between December and March in 1999, 2000, and 2001, a severe leaf spot and blight was observed on young (6-month- to 3-year-old) plants of majesty palm growing in plastic-covered houses and in open fields in nurseries in Sicily. Affected plants had brown necrotic spots and gray mold on the necrotic leaf tissues. No symptoms were detected in mature (4- to 5-year-old) plants grown in the same nurseries. To isolate the casual agent of the disease, 160 small pieces of tissue cut from leaf spots collected in four nurseries were surface sterilized (20 s in HgCl2 at 1 g/liter), washed with sterile water, and plated on potato dextrose agar (PDA). In addition, conidia and conidiophores were scraped from the leaf surface, suspended in sterile water, and streaked on the agar surface. After 2 days, single hyphal tips were transferred to PDA. Botrytis cinerea Pers.:Fr. was consistently isolated from affected leaf tissues. Colonies of B. cinerea on PDA were at first colorless and became gray to brown with the development of conidia, which ranged from 5.5 to 10 × 7 to 12 μm (average 7.5 × 9). Sclerotia were black, irregular in size and shape, and from 1.4 to 4.5 × 1.5 to 2.7 mm. Inoculating 8-month-old seedlings of R. rivularis tested pathogenicity of six isolates obtained from different nurseries. Wounded (with a needle) and nonwounded leaves of 10 plants (9 wounds per plant) were sprayed with 20 ml of a conidial suspension (105 conidia/ml) of each isolate. An equal number of noninoculated plants were used as controls. All plants where incubated in a greenhouse at ambient temperature (21 ± 2°C) and 72 h of continuous leaf wetness. Five days after inoculation, leaf spots appeared on most of the wounded (approximately 80%) and the nonwounded (about 10%) leaves. No symptoms were observed on control plants. Koch's postulates were satisfied by reisolation of the fungus on PDA. On the basis of 3 years of observations in eastern Sicily, majesty palms were more readily infected by B. cinerea after rainfall, and freezing temperatures injured young plants. Leaf blight caused by B. cinerea was previously reported in Liguria (northern Italy) on Phoenix canariensis (1). The fungus does not appear to be a major disease problem in cultivated ornamental palms other than R. rivularis in Sicily or southern Italy. However, B. cinerea could be a limiting factor in the cultivation of majesty palm in eastern Sicily, and protective fungicides, especially in winter, are necessary for limiting losses. To my knowledge, this is the first report of B. cinerea leaf spot and blight on R. rivularis. Reference: (1) A. Garibaldi et al. Malattie delle piante ornamentali. Calderini Edagricole, Bologna, 2000.

scholarly journals Dasylirion serratifolium as a New Host of Botrytis cinerea, the Causal Agent of Leaf Spots and Blight in Italy

Plant Disease ◽  
2006 ◽  
Vol 90 (1) ◽  
pp. 114-114 ◽  
Author(s):  
G. Polizzi ◽  
A. Vitale
Keyword(s):  
Botrytis Cinerea ◽  
Gray Mold ◽  
Potato Dextrose Agar ◽  
Limiting Factor ◽  
Sterile Water ◽  
New Host ◽  
Leaf Spots ◽  
Brown Stripe ◽  
Young Leaves ◽  
International Mycological Institute

Sandpaper sotol (Dasylirion serratifolium Zucc.), native to Mexico, has green leaves with margins highlighted by whitish yellow prickles like a fine sandpaper. During the spring of 2004 and 2005, necrotic lesions were observed in the middle of leaf blades and near prickles on 2- to 5-year-old, container-grown sandpaper sotol plants from two nurseries in eastern Sicily (Italy). Symptoms were detected on 20 to 30% of plants and consisted of reddish lesions that developed a reddish brown stripe surrounded by a yellow halo. As lesions enlarged, the center turned yellow and expanded rapidly causing blight of young leaves. Occasionally, symptomatic tissues had masses of gray fungal conidia and/or sclerotia. Botrytis cinerea was isolated consistently from infected tissues disinfected for 1 min in 1% NaOCl and rinsed in sterile distilled water and grown on potato dextrose agar (PDA). Hyaline, ovoid conidia (average 6.4 × 9.7 μm) and conidiophores were similar to those described of B. cinerea, and 5- to 8-day-old cultures developed black sclerotia that were round or irregular in shape (average 1.55 × 1.02 mm) that is typical of gray mold (1). Koch's postulates were performed by spraying 6-week-old sandpaper sotol plants grown in 12-cm pots with a spore suspension (1 × 106 CFU per ml) obtained from 12-day-old cultures grown on PDA. Eight plants were naturally wounded by scratching leaf blades among themselves and were subsequently inoculated, while eight plants were inoculated without wounding. An equal number of noninoculated plants sprayed with sterile water served as controls. All plants were maintained in high humidity conditions (90 to 95% relative humidity) at 20 ± 2°C. Leaf spots similar to the ones observed in nurseries were evident on all naturally wounded and nonwounded plants within 2 to 3 weeks after inoculation. Noninoculated control plants were symptomless. B. cinerea was reisolated from affected tissues. The pathogen has reduced commercial value of sandpaper sotol plants and may represent a limiting factor for the cultivation of this plant in eastern Sicily. To our knowledge, this is the first report in the world of leaf spot and blight caused by B. cinerea on D. serratifolium. Reference: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB International Mycological Institute, Kew, Surrey, England, 1971.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Leaf Spot and Stem Blight Caused by Botrytis cinerea on Poinsettia in Argentina

Plant Disease ◽  
2005 ◽  
Vol 89 (12) ◽  
pp. 1359-1359
Author(s):  
H. E. Palmucci ◽  
P. E. Grijalba
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Spot ◽  
Buenos Aires ◽  
Pathogenic Fungi ◽  
Pathogenicity Test ◽  
Euphorbia Pulcherrima ◽  
Conidial Suspension ◽  
Stem Blight ◽  
Potted Plants ◽  
Leaf Spots

Poinsettia (Euphorbia pulcherrima Will. ex. Klotzsch) is a worldwide potted or landscape ornamental plant that belongs to the Euphorbiaceae family. During 2003 and 2004, several symptoms were observed on poinsettia potted plants in nurseries and crops near Buenos Aires. Symptoms included irregular, brown, water-soaked spots on adult plants and leaf spots that extended causing stem blight in seedlings. Small pieces of diseased tissues were surface disinfected for 2 min in 2% sodium hypochlorite, plated on 2% potato dextrose agar (PDA), and incubated at 22°C for 48 h. Dense, whitish mycelia developed on PDA and then turned gray when asexual structures were formed. The fungus conidia were ellipsoid, hyaline, nonseptate, and were formed on botryose heads. The pathogenicity test was carried out on 10 plants using a conidial suspension (2 × 106 spores per ml) that was sprayed on leaves with and without injuries. All plants were incubated in a moist chamber at 22 ± 2°C for 48 h and then maintained in a greenhouse. After 3 days, symptoms similar to the original were observed on the inoculated plants. Control plants sprayed with distilled water remained symptomless. Koch's postulates were confirmed by reisolating the same fungus from diseased plants. In accordance with conidial and cultural characteristics, the pathogen was identified as Botrytis cinerea Pers: Fr. (1). To our knowledge, this is the first report of B. cinerea causing leaf spot and stem rot on poinsettia in Buenos Aires, Argentina. Reference: (1) M. V. Ellis and J. M. Waller. No. 431 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1974.

scholarly journals First Report of Leaf Spot on Industrial Hemp (Cannabis sativa L.) Caused by Alternaria alternata in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Lili Tang ◽  
Xixia Song ◽  
Liguo Zhang ◽  
Jing Wang ◽  
Shuquan Zhang
Keyword(s):  
Leaf Spot ◽  
Cannabis Sativa ◽  
Leaf Spot Disease ◽  
Molecular Characteristics ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Sterile Water ◽  
First Report ◽  
Leaf Spots ◽  
Industrial Hemp

Industrial hemp is an economically important plant with traditional uses for textiles, paper, building materials, food and medicine (Li 1974; Russo et al. 2008; Zlas et al. 1993). In August 2020, an estimated 80% of the industrial hemp plants with leaf spots were observed in greenhouse in Minzhu town, Harbin City, Heilongjiang Province, China (45.8554°N, 126.8167°E), resulting in yield losses of 20%. Leaf symptoms began as small spots on the upper surface of leaves and gradually developed into brown spots with light yellow halos. These irregular spots expanded gradually and eventually covered the entire leaf; the center of the spots was easily perforated. To identify the pathogen, 20 diseased leaves were collected, and small sections of (3 to 5 mm) were taken from the margins of lesions of infected leaves. The pieces were sterilized with 75% alcohol for 30 s, a 0.1% mercuric chloride solution for 1 min, and then rinsed three times with sterile water. Samples were then cultured on potato dextrose agar at 28℃ in darkness for 4 days. A single-spore culture was obtained by monosporic isolation. Conidiophores were simple or branched, straight or flexuous, brown, and measured 22 to 61 μm long × 4 to 5 μm wide (n = 50). Conidia were solitary or in chains, brown or dark brown, obclavate, obpyriform or ellipsoid. Conidia ranged from 23 to 55 μm long × 10 to 15 μm wide (n = 50) with one to eight transverse and several longitudinal septa. For molecular identification (Jayawardena et al. 2019), genomic DNA of pathogenic isolate (MZ1287) was extracted by a cetyltrimethylammonium bromide protocol. Four gene regions including the rDNA internal transcribed spacer (ITS), glyceraldehyde-3-phosplate dehydrogenase (GAPDH), translation elongation factor 1-alpha (TEF1) and RNA polymerase II beta subunit (RPB2) were amplified with primers ITS1/ITS4, GDF1/GDR1, EF1-728F/EF1-986R and RPB2-5F/RPB2-7cR, respectively (White et al. 1990). Resulting sequences were deposited in GenBank with accession numbers of MW272539.1, MW303956.1, MW415414.1 and MW415413.1, respectively. A BLASTn analysis showed 100% homology with A. alternata (GenBank accession nos. MN615420.1, MH926018.1, MN615423.1 and KP124770.1), respectively. A neighbor-joining phylogenetic tree was constructed by combining all sequenced loci in MEGA7. The isolate MZ1287 clustered in the A. alternata clade with 100% bootstrap support. Thus, based on morphological (Simmons 2007) and molecular characteristics, the pathogen was identified as A. alternata. To test pathogenicity, leaves of ten healthy, 2-month-old potted industrial hemp plants were sprayed using a conidial suspension (1×106 spores/ml). Control plants were sprayed with sterile water. All plants were incubated in a greenhouse at 25℃ for a 16 h light and 8 h dark period at 90% relative humidity. The experiment was repeated three times. After two weeks, leaf spots of industrial hemp developed on the inoculated leaves while the control plants remained asymptomatic. The A. alternata pathogen was re-isolated from the diseased leaves on inoculated plants, fulfilling Koch's postulates. Based on morphology, sequencing, and pathogenicity test, the pathogen was identified as A. alternata. To our knowledge, this is the first report of A. alternata causing leaf spot disease of industrial hemp (Cannabis sativa L.) in China and is worthy of our attention for the harm it may cause to industrial hemp production.

scholarly journals First Report of Gray Mold in Tomato Caused by Botrytis cinerea in Baja California, Mexico

Plant Disease ◽  
2005 ◽  
Vol 89 (5) ◽  
pp. 528-528 ◽  
Author(s):  
R. J. Holguín-Peña ◽  
F. G. Arcos
Keyword(s):  
Botrytis Cinerea ◽  
Baja California ◽  
Polymerase Chain Reaction Amplification ◽  
Random Amplified Polymorphic Dna ◽  
Gray Mold ◽  
Malt Extract ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Tomato Production ◽  
First Report

San Quintin Valley, a 60-mile-long coastal plain (30°30′N, 116°W) in the Baja California Peninsula, is one of the major fresh tomato (Lycopersicon esculentum Mill.) production areas in Mexico with more than 8,000 ha. During the last 10 years, the valley's tomato production has declined because of gray mold and stem canker diseases. Flower rot, reddish brown margins on the leaves and stems, and fruit with a gray mold were observed on field-grown tomato plants (Roma type cv. Tequila) in the autumn of 2003. Severity ranging from 55 to 60% was observed at harvest. Infected tissues were sampled and disinfested by immersion in 1% NaOCl for 1 min, rinsed in sterile water, and placed on malt extract agar at 22°C. Fungal conidia were then transferred to 2% potato dextrose agar (PDA). The resulting fungal colonies were definitively identified as Botrytis cinerea Pers.:Fr. The colonies of B. cinerea were first hyaline and white and became dark gray after 96 h. Mycelia were septate with dark branched conidiophores. Conidia were unicellular, ellipsoid, and ranged from 5 to 8 × 8 to 14 μm. Profuse black sclerotia developed in 7-day-old cultures. Infection site analyses in diseased flowers at different stages during the bloom were done with scanning electron microscopy. Fungal hyphae were located predominantly on the receptacle areas, whereas conidia were located in the ovaries as described previously (3). The identity of B. cinerea was confirmed by a restriction digest with ApoI of the 413-kb polymerase chain reaction amplification product obtained with BA2f/BA1r primers (1) and random amplified polymorphic DNA banding patterns (2). Pathogenicity tests were done by spray inoculation of 1-ml aqueous conidial suspension (106 CFU/ml) on 20 healthy plants during the blossom stage. An equal number of plants sprayed with sterile water was used as the control. Plants were incubated at 20 ± 2°C for 5 days. The fungus was reisolated from diseased flowers and peduncles after surface disinfestation (2.5% NaOCl) and plating on PDA. No symptoms were observed in the noninoculated controls. To our knowledge, this is the first report of B. cinerea causing gray mold disease on tomato in Baja California. References: (1) K. Nielsen et al. Plant Dis. 86:682, 2002. (2) S. Rigotti et al. FEMS Microbiol. Lett. 209:169, 2002. (3) O. Viret et al. Phytopathology 94:850, 2004.

scholarly journals First Report of Leaf Spot and Blight Caused by Botrytis cinerea on Pygmy Date Palm in Italy

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1398-1398 ◽  
Author(s):  
G. Polizzi ◽  
A. Vitale
Keyword(s):  
Botrytis Cinerea ◽  
Leaf Spot ◽  
Canary Island ◽  
Date Palm ◽  
Southern Italy ◽  
Sterile Water ◽  
Koch’S Postulates ◽  
Date Palms ◽  
First Report ◽  
Koch's Postulates

Pygmy date palm (Phoenix roebelenii O'Brien), native to Laos and southeast Asia, is one of the most commonly cultivated date palms both indoors and out. In early April 2003, a new and widespread leaf disease was detected on 2- to 3-feet high, potted, pygmy date palms growing in open fields or shade-houses in four commercial nurseries of the eastern Sicily Region of southern Italy. Initial symptoms on infected plants were small, chlorotic spots on blades and edges of leaflets. As spots enlarged, yellow or reddish-brown margins and brown or gray, wrinkled, sunken centers developed. Sometimes, spots or lesions coalesced to cause blight of young expanding leaves or death of apical buds. Botrytis cinerea Pers.:Fr was recovered consistently from sections of infected tissues (disinfected for 1 min in 1% NaOCl and rinsed in sterile water) plated on malt extract agar. On potato dextrose agar (PDA), colonies of B. cinerea were first hyaline, then turned white, and later turned dark gray when spores differentiated. Six- to eight-day-old-cultures developed white sclerotia that turned black after three more days. Conidia in 1-month-old-cultures were hyaline or gray, ovoid, and ranged from 5.2 to 8.8 × 8 to 14 μm (average 6.6 × 9.9 μm). Black microsclerotia were round or irregular in shape and ranged from 0.6 to 2.8 × 0.3 to 2.5 mm (average 1.66 × 0.98 mm) (1). Koch's postulates were performed by spraying potted, 9-month-old pygmy date palms (2 feet high) with a spore suspension (1 × 106 CFU per ml from 15-day-old cultures grown on PDA). Six plants were wounded and inoculated, while six plants were inoculated without wounding. An equal number of noninoculated plants sprayed with sterile water served as controls. All plants were maintained in a humid environment at 20°C. Sunken-leaf and rachis lesions were observed on all wounded and most nonwounded plants within 10 to 14 days after inoculation. Symptoms did not develop on the control plants. Koch's postulates were fulfilled by reisolation of the fungus from affected tissues. A field survey revealed the occasional presence of similar leaf spots on canary island date palms (Phoenix canariensis Hort. ex Chabaud), from which B. cinerea was consistently recovered. The unusually cool and humid weather conditions recorded in Sicily during this disease outbreak were very conducive for occurrence of the B. cinerea infections. Although the disease only occasionally caused death of plants, evidence indicated that B. cinerea reduced commercial value of infected pygmy date palms. B. cinerea was previously recorded in northern Italy on canary island date palm (2) and was recently detected in southern Italy on majesty palm (3). To our knowledge, this is the first report of leaf spot and rachis blight caused by B. cinerea on pygmy date palm. References: (1) M. B. Ellis. Dematiaceous Hyphomycetes. CAB, Kew, Surrey, England, 1971. (2) A. Garibaldi and S. Rapetti. No. 9 Suppl. Flortecnica, 1987. (3) G. Polizzi. Plant Dis. 86:815, 2002.

scholarly journals First Report of Leaf Spot Caused by Corynespora cassiicola on Rose of Sharon in Korea

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 847-847 ◽  
Author(s):  
S. T. Seo ◽  
J. H. Park ◽  
S. E. Cho ◽  
H. D. Shin
Keyword(s):  
Leaf Spot ◽  
Brown Spot ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Corynespora Cassiicola ◽  
Sterile Water ◽  
Single Spore ◽  
First Report ◽  
Leaf Spots ◽  
Leaf Yellowing

Rose of Sharon, Hibiscus syriacus L., is a flowering shrub in the family Malvaceae planted as the national flower of South Korea. In September 2012, previously unknown leaf spots with premature defoliation were observed on dozens of Rose of Sharon plants growing in the shaded area in a park of Dongducheon, Korea. The same symptoms were found on Rose of Sharon in several localities of Korea in 2012. The symptoms usually started as small, dark brown to grayish leaf spots, eventually causing leaf yellowing with significant premature defoliation. The diseased leaves retained for a while green color at the margin of the spots. Representative samples (n = 5) were deposited in the Korea University Herbarium (KUS). Conidiophores of the fungus observed microscopically on the leaf spots were erect, brown to dark brown, single or in clusters, amphigenous but mostly hypophyllous, and measured 80 to 400 × 5 to 10 μm. Conidia were borne singly or in short chains, ranging from cylindrical to broadest at the base and tapering apically, straight to slightly curved, pale olivaceous brown, 2 to 16 pseudoseptate, 50 to 260 × 9 to 20 μm, each with a conspicuous thickened hilum. On potato dextrose agar, single-spore cultures of two isolates were identified as Corynespora cassiicola (Berk. & M.A. Curtis) C.T. Wei on the basis of morphological and cultural characteristics (1,2). Two monoconidial isolates were preserved at the Korean Agricultural Culture Collection (KACC46956 and KACC46957). Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequences of 520 bp were deposited in GenBank (Accession Nos. KC193256, KC193257). A BLAST search in GenBank revealed that the sequences showed 100% identity with those of numerous C. cassiicola isolates from diverse substrates. To conduct a pathogenicity test, a conidial suspension (ca. 2 × 104 conidia/ml) was prepared in sterile water by harvesting conidia from 2-week-old cultures of KACC46956, and the suspension was sprayed onto the leaves of three healthy 2-year-old plants. Inoculated plants were kept in humid chambers for the first 48 h and thereafter placed in the glasshouse. After 10 days, typical leaf spot symptoms developed on the leaves of all three inoculated plants. C. cassiicola was reisolated from the lesions, confirming Koch's postulates. Control plants treated with sterile water remained symptomless. C. cassiicola is cosmopolitan with a very wide host range (1,2). Though Corynespora hibisci Goto was recorded to be associated with brown spot disease of H. syriacus in Japan (4), there is no previous record of C. cassiicola on H. syriacus (3). To our knowledge, this is the first report of Corynespora leaf spot on Rose of Sharon in Korea. According to our field observations in Korea, this disease was found in August and September, following a prolonged period of moist weather. Severe infection resulted in leaf yellowing and premature defoliation, reducing tree vigor and detracting the beauty of green leaves. References: (1) L. J. Dixon et al. Phytopathology 99:1015, 2009. (2) M. B. Ellis. Dematiaceous Hyphomycetes. Commonw. Mycol. Inst., Kew, UK, 1971. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication, ARS, USDA, Retrieved November 22, 2012. (4) K. Goto. Ann. Phytopathol. Soc. Japan 12:14, 1942.

scholarly journals First Report of a Leaf Spot Disease of Bells-of-Ireland (Moluccella laevis) Caused by Cercospora apii in California

Plant Disease ◽  
2003 ◽  
Vol 87 (2) ◽  
pp. 203-203
Author(s):  
S. T. Koike ◽  
S. A. Tjosvold ◽  
J. Z. Groenewald ◽  
P. W. Crous
Keyword(s):  
Leaf Spot ◽  
Sequence Data ◽  
Disease Incidence ◽  
Leaf Spot Disease ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Spot Disease ◽  
Leaf Spots ◽  
Initial Symptoms

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.

scholarly journals First Report of Leaf Spot Caused by Botrytis cinerea on Cardamine hupingshanensis in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jun Guo ◽  
Jin Chen ◽  
Zhao Hu ◽  
Jie Zhong ◽  
Jun Zi Zhu
Keyword(s):  
Botrytis Cinerea ◽  
Morphological Characteristics ◽  
Gray Mold ◽  
Hunan Province ◽  
Conidial Suspension ◽  
Heat Shock Protein 60 ◽  
Basal Cells ◽  
Single Spore ◽  
Internal Transcribed Spacer Region ◽  
First Report

Cardamine hupingshanensis is a selenium (Se) and cadmium (Cd) hyperaccumulator plant distributed in wetlands along the Wuling Mountains of China (Zhou et al. 2018). In March of 2020, a disease with symptoms similar to gray mold was observed on leaves of C. hupingshanensis in a nursery located in Changsha, Hunan Province, China. Almost 40% of the C. hupingshanensis (200 plants) were infected. Initially, small spots were scattered across the leaf surface or margin. As disease progressed, small spots enlarged to dark brown lesions, with green-gray, conidia containing mold layer under humid conditions. Small leaf pieces were cut from the lesion margins and were sterilized with 70% ethanol for 10 s, 2% NaOCl for 2 min, rinsed with sterilized distilled water for three times, and then placed on potato dextrose agar (PDA) medium at 22°C in the dark. Seven similar colonies were consistently isolated from seven samples and further purified by single-spore isolation. Strains cultured on PDA were initially white, forming gray-white aerial mycelia, then turned gray and produced sclerotia after incubation for 2 weeks, which were brown to blackish, irregular, 0.8 to 3.0 × 1.2 to 3.5 mm (n=50). Conidia were unicellular, globose or oval, colourless, 7.5 to 12.0 × 5.5 to 8.3 μm (n=50). Conidiophores arose singly or in group, straight or flexuous, septate, brownish to light brown, with enlarged basal cells, 12.5 to 22.1 × 120.7 to 310.3 μm. Based on their morphological characteristics in culture, the isolates were putatively identified as Botrytis cinerea (Ellis 1971). Genomic DNA of four representative isolates, HNSMJ-1 to HNSMJ-4, were extracted by CTAB method. The internal transcribed spacer region (ITS), glyceraldehyde-3-phosphate dehydrogenase gene (G3PDH), heat-shock protein 60 gene (HSP60), ATP-dependent RNA helicaseDBP7 gene (MS547) and DNA-dependent RNA polymerase subunit II gene (RPB2) were amplified and sequenced using the primers described previously (Aktaruzzaman et al. 2018) (MW820311, MW831620, MW831628, MW831623 and MW831629 for HNSMJ-1; MW314722, MW316616, MW316617, MW316618 and MW316619 for HNSMJ-2; MW820519, MW831621, MW831627, MW831624 and MW831631 for HNSMJ-3; MW820601, MW831622, MW831626, MW831625 and MW831630 for HNSMJ-4). BLAST searches showed 99.43 to 99.90% identity to the corresponding sequences of B. cinerea strains, such as HJ-5 (MF426032.1, MN448500.1, MK791187.1, MH727700.1 and KX867998.1). A combined phylogenetic tree using the ITS, G3PDH, HSP60 and RPB2 sequences was constructed by neighbor-joining method in MEGA 6. It revealed that HNSMJ-1 to HNSMJ-4 clustered in the B. cinerea clade. Pathogenicity tests were performed on healthy pot-grown C. hupingshanensis plants. Leaves were surface-sterilized and sprayed with conidial suspension (106 conidia/ mL), with sterile water served as controls. All plants were kept in growth chamber with 85% humidity at 25℃ following a 16 h day-8 h night cycle. The experiment was repeated twice, with each three replications. After 4 to 7 days, symptoms similar to those observed in the field developed on the inoculated leaves, whereas controls remained healthy. The pathogen was reisolated from symptomatic tissues and identified using molecular methods, confirming Koch’s postulates. B. cinerea has already been reported from China on C. lyrate (Zhang 2006), a different species of C. hupingshanensis. To the best of our knowledge, this is the first report of B. cinerea causing gray mold on C. hupingshanensis in China and worldwide. Based on the widespread damage in the nursery, appropriate control strategies should be adopted. This study provides a basis for studying the epidemic and management of the disease.

scholarly journals First Report of Nigrospora osmanthi Causing Leaf Spot on Tartary Buckwheat in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Quan Shen ◽  
Xixu Peng ◽  
Feng He ◽  
Shaoqing Li ◽  
Zuyin Xiao ◽  
...  
Keyword(s):  
Relative Humidity ◽  
Leaf Spot ◽  
Plant Pathogens ◽  
Hunan Province ◽  
Tartary Buckwheat ◽  
Tween 20 ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Sterile Water ◽  
First Report

Buckwheat (Fagopyrum tataricum) is a traditional short-season pseudocereal crop originating in southwest China and is cultivated around the world. Antioxidative substances in buckwheat have been shown to provide many potential cardiovascular health benefits. Between August and November in 2019, a leaf spot was found in several Tartary buckwheat cv. Pinku1 fields in Xiangxiang County, Hunan Province, China. The disease occurred throughout the growth cycle of buckwheat after leaves emerged, and disease incidence was approximately 50 to 60%. Initially infected leaves developed a few round lesions, light yellow to light brown spots. Several days later, lesions began to enlarge with reddish brown borders, and eventually withered and fell off. Thirty lesions (2×2 mm) collected from three locations with ten leaves in each location were sterilized in 70% ethanol for 10 sec, in 2% sodium hypochlorite for 30 sec, rinsed in sterile water for three times, dried on sterilized filter paper, and placed on a potato dextrose PDA with lactic acid (3 ml/L), and incubated at 28°C in the dark for 3 to 5 days. Fungal colonies were initially white and later turned black with the onset ofsporulation. Conidia were single-celled, black, smooth, spherical to subspherical, and measured 9.2 to 15.6 µm long, and 7.1 to 11.6 µm wide (n=30). Each conidium was terminal and borne on a hyaline vesicle at the tip of conidiophores. Morphologically, the fungus was identified as Nigrospora osmanthi (Wang et al. 2017). Identification was confirmed by amplifying and sequencing the ITS region, and translation elongation factor 1-alpha (TEF1-α) and partial beta-tublin (TUB2) genes using primers ITS1/ITS4 (Mills et al. 1992), EF1-728F/EF-2 (Carbone and Kohn 1999; O’Donnell et al. 1998) and Bt-2a/Bt-2b (Glass et al. 1995), respectively. BLAST searches in GenBank indicated the ITS (MT860338), TUB2 (MT882054) and TEF1-α (MT882055) sequences had 99.80%, 99% and 100% similarity to sequences KX986010.1, KY019461.1 and KY019421.1 of Nigrospora osmanthi ex-type strain CGMCC 3.18126, respectively. A neighbor-joining phylogenetic tree constructed using MEGA7.0 with 1,000 bootstraps based on the concatenated nucleotide sequences of the three genes indicated that our isolate was closely related to N. osmanthi. Pathogenicity test was performed using leaves of healthy F. tataricum plants. The conidial suspension (1 × 106 conidia/ml) collected from PDA cultures with 0.05% Tween 20 buffer was used for inoculation by spraying leaves of potted 20-day-old Tartary buckwheat cv. Pinku1. Five leaves of each plant were inoculated with spore suspensions (1 ml per leaf). An equal number of control leaves were sprayed with sterile water to serve as a control. The treated plants were kept in a greenhouse at 28°C and 80% relative humidity for 24 h, and then transferred to natural conditions with temperature ranging from 22 to 30°C and relative humidity ranging from 50 to 60%. Five days later, all N. osmanthi-inoculated leaves developed leaf spot symptoms similar to those observed in the field, whereas control leaves remained healthy. N. osmanthi was re-isolated from twelve infected leaves with frequency of 100%, fulfilling Koch’s postulates. The genus Nigrospora has been regarded by many scholars as plant pathogens (Fukushima et al. 1998) and N. osmanthi is a known leaf blight pathogen for Stenotaphrum secundatum (Mei et al. 2019) and Ficus pandurata (Liu et al. 2019) but has not been reported on F. tataricum. Nigrospora sphaerica was also detected in vegetative buds of healthy Fagopyrum esculentum Moench (Jain et al. 2012). To our knowledge, this is the first report of N. osmanthi causing leaf spot on F. tataricum in China and worldwide. Appropriate strategies should be developed to manage this disease.

Sign in / Sign up

Export Citation Format

Share Document