First Report of Bacterial Leaf Spot Caused by Pseudomonas syringae pv. aptata on Swiss Chard, Beta vulgaris subsp. vulgaris, in Arizona

Arizona is an important region of the USA for winter production of baby leaf crops such as spinach (Spinacia oleracea), table beet (Beta vulgaris subsp. vulgaris Condivita Group), and Swiss chard (B. vulgaris subsp. vulgaris Cicla Group). In the winter of 2019, severe leaf spots were observed at 80% incidence and 40% severity per plant in a 1-ha baby leaf Swiss chard crop of an (unknown cultivar) in Arizona. The lesions were circular to irregular, necrotic, water-soaked, and 1 to 5 mm in diameter. Symptomatic leaf sections (1-cm2) were surface-sterilized with 0.6% NaOCl, rinsed, and macerated in sterilized, deionized water. An aliquot of each macerate was streaked onto King’s B (KB) agar medium. Cream-colored, non-fluorescent colonies typical of Pseudomonas were isolated consistently, and all were non-fluorescent. A dozen isolates selected randomly were all negative for potato soft rot, oxidase, and arginine dihydrolase, and positive for levan production and tobacco hypersensitivity, which is typical of fluorescent P. syringae isolates, but can also include non-fluorescent strains (Lelliot et al. 1966). Three isolates were tested for pathogenicity on the table beet cv. Red Ace and Swiss chard cv. Silverado. Strain Pap009 of P. syringae pv. aptata (Psa), demonstrated previously to be pathogenic on Swiss chard and table beet, served as a positive control strain (Derie et al. 2016; Safni et al. 2016). Each isolate was grown inoculated into medium 523 broth and incubated on a shaker at 175 rpm overnight at 25°C. Each bacterial suspension was adjusted to an optical density (OD) of 0.3 at 600 nm (108 CFU/ml), and diluted in 0.0125M phosphate buffer to 107 CFU/ml. Thirty-day-old seedlings grown in Redi-Earth Plug and Seedling Mix in a greenhouse at 22 to 26°C were inoculated by rubbing the abaxial and adaxial leaf surfaces of each plant with a cotton swab dipped in inoculum to which Carborundum had been added (0.06 g/10 ml). The negative control plants were treated similarly with phosphate buffer with Carborundum. The experiment was set up as a randomized complete block design with 4 replications per treatment and 6 seedlings per experimental unit. In both trials, leaf spots resembling those on the original plants developed on all table beet and Swiss chard plants inoculated with the Arizona isolates and Pap009, but not on negative control plants. Disease severity was greater on Swiss chard (average 39% leaf area with spots) than on table beet (14%). Re-isolates obtained from inoculated seedlings using the same method as the original isolations resembled Psa. Multilocus sequence analysis (MLSA) was carried out for the original three Arizona isolates and the re-isolates using DNA amplified from the housekeeping genes gyrB, rpoD, gapA, and gltA (Hwang et al. 2005; Sarkar and Guttman 2004). Sequence identities of these genes of the Arizona isolates (GenBank accession numbers MW291615 to MW291618 for strain Pap089; MW291619 to MW291622 for Pap095; and MW291623 to MW291626 for Pap096 for gltA, gyrB, rpoD, and gapA, respectively) and the re-isolates ranged from 98 to 100% with those of Psa pathotype strain CFBP 1617 in the PAMDB database (Almeida et al. 2010; Altschul et al. 1997). Based on Koch’s postulates, colony characteristics, and MLSA, Psa was the causal agent of leaf spots in the Arizona Swiss chard crop. To our knowledge, this is the first report of bacterial leaf spot on chard in Arizona. The pathogen could have been introduced on infected seed as Psa is readily seedborne and seed transmitted.

Download Full-text

First Report of Bacterial Leaf Spot of Spinach Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽

10.1094/pdis.2002.86.8.921a ◽

2002 ◽

Vol 86 (8) ◽

pp. 921-921 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

H. R. Azad ◽

D. C. Cooksey

Keyword(s):

Brassica Oleracea ◽

Beta Vulgaris ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

The United States ◽

Nutrient Broth ◽

Bacterial Leaf Spot ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

In 2000 and 2001, a new disease was observed on commercial spinach (Spinacia oleracea) in the Salinas Valley, Monterey County, CA. Initial symptoms were water-soaked, irregularly shaped leaf spots (2 to 3 mm diameter). As the disease developed, spots enlarged to as much as 1 to 2 cm, were vein-delimited, and turned dark brown. Faint chlorotic halos sometimes surrounded the spots. Death of large areas of the leaf occurred if spots coalesced. Spots were visible from the adaxial and abaxial sides of leaves, and no fungal structures were observed. The disease occurred on newly expanded and mature foliage. No fungi were isolated from the spots. However, cream-colored bacterial colonies were consistently isolated on sucrose peptone agar, and these strains were nonfluorescent on King's medium B. Strains were positive for levan and negative for oxidase, arginine dihydrolase, and nitrate reductase. Strains did not grow at 36°C, did not rot potato slices, but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Turk). These results suggested the bacterium was similar to Pseudomonas syringae. Fatty acid methyl ester (FAME) analysis (MIS-TSBA 4.10, MIDI Inc., Newark, DE) indicated the strains were highly similar (80.1 to 89.3%) to P. syringae pv. maculicola. However, in contrast to P. syringae pv. maculicola, the spinach strains did not utilize the carbon sources erythritol, L+tartrate, L lactate, and DL-homoserine. Pathogenicity of 10 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying 4-week-old plants of spinach cv. Bossanova. Control plants were sprayed with sterile nutrient broth. After 5 to 8 days in a greenhouse (24 to 26°C), leaf spots identical to those observed in the field developed on cotyledons and true leaves of inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. The 10 strains were also inoculated on beet (Beta vulgaris), Swiss chard (Beta vulgaris subsp. cicla), cilantro (Coriandrum sativum), and spinach. Spinach showed leaf spots after 8 days; however, none of the other plants developed symptoms. Two strains were inoculated onto spinach cvs. Califlay, Lion, Nordic IV, Polka, Resistoflay, Rushmore, RZ 11, Spinnaker, Springfield, Viroflay, and Whitney. Leaf spot developed on all cultivars, and the pathogen was reisolated. Because the FAME data indicated a similarity between the spinach pathogen and P. syringae pv. maculicola, we inoculated sets of spinach cv. Bolero, cabbage (Brassica oleracea subsp. capitata cv. Grenedere), and cauliflower (Brassica oleracea subsp. botrytis cv. White Rock) with three P. syringae pv. maculicola and three spinach strains. Cabbage and cauliflower developed leaf spots only when inoculated with P. syringae pv. maculicola; spinach had leaf spots only when inoculated with the spinach strains. All inoculation experiments were done twice, and the results of the two tests were the same. To our knowledge, this is the first report of bacterial leaf spot of spinach in California caused by a nonfluorescent P. syringae, and the first record of this disease in the United States. Biochemical characteristics and limited host range of the pathogen indicate the California strains are likely the same as the P. syringae pv. spinaciae pathogen that was reported in Italy (1) and Japan (2). References: (1) C. Bazzi et al. Phytopathol. Mediterr. 27:103, 1988. (2) K. Ozaki et al. Ann. Phytopathol. Soc. Jpn. 64:264, 1998.

Download Full-text

First Report of Bacterial Leaf Spot of Swiss Chard Caused by Pseudomonas syringae pv. aptata in California

Plant Disease ◽

10.1094/pdis.2003.87.11.1397b ◽

2003 ◽

Vol 87 (11) ◽

pp. 1397-1397 ◽

Cited By ~ 6

Author(s):

S. T. Koike ◽

D. M. Henderson ◽

C. T. Bull ◽

P. H. Goldman ◽

R. T. Lewellen

Keyword(s):

Fatty Acid ◽

Sugar Beet ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Nutrient Broth ◽

Pcr Analysis ◽

Bacterial Leaf Spot ◽

First Report ◽

Leaf Spots ◽

Swiss Chard

From 1999 through 2003, a previously unreported disease was found on commercial Swiss chard (Beta vulgaris subsp. cicla) in the Salinas Valley, (Monterey County) California. Each year the disease occurred sporadically throughout the long growing season from April through September. Initial symptoms were water-soaked leaf spots that measured 2 to 3 mm in diameter. As disease developed, spots became circular to ellipsoid, 3 to 8 mm in diameter, and tan with distinct brown-to-black borders. Spots were visible from the adaxial and abaxial sides. Cream-colored bacterial colonies were consistently isolated from spots. Strains were fluorescent on King's medium B, levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum cv. Turk). The isolates, therefore, belong in LOPAT group 1 (1). Fatty acid methyl esters (FAME) analysis (MIS-TSBA version 4.10, MIDI Inc., Newark, DE) gave variable results that included Pseudomonas syringae, P. cichorii, and P. viridiflava with similarity indices ranging from 0.91 to 0.95. BOX-polymerase chain reaction (PCR) analysis gave identical banding patterns for the chard isolates and for known P. syringae pv. aptata strains, including the pathotype strain CFBP1617 (2). The bacteria were identified as P. syringae. Pathogenicity of 11 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 10 × 6 CFU/ml, and spraying onto 5-week-old plants of Swiss chard cvs. Red, White, Silverado, and CXS2547. Untreated control plants were sprayed with sterile nutrient broth. After 7 to 10 days in a greenhouse (24 to 26°C), leaf spots similar to those observed in the field developed on all inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. To investigate the host range of this pathogen, the same procedures were used to inoculate three strains onto other Chenopodiaceae plants: five cultivars of sugar beet (B. vulgaris), and one cultivar each of spinach (Spinacia oleracea) and Swiss chard. In addition, five chard strains and strain CFBP1617 were inoculated onto two cultivars of sunflower (Helianthus annuus), and one cultivar each of cantaloupe (Cucumis melo), sugar beet, spinach, and Swiss chard. All Swiss chard, cantaloupe, sunflower, and sugar beet plants developed leaf spots after 7 days. The pathogen was reisolated from spots and confirmed to be the same bacterium using BOX-PCR analysis. Spinach and untreated controls failed to show symptoms. All inoculation experiments were done at least twice and the results were the same. The phenotypic data, fatty acid and genetic analyses, and pathogenicity tests indicated that these strains are P. syringae pv. aptata. To our knowledge this is the first report of bacterial leaf spot of commercially grown Swiss chard in California caused by P. syringae pv. aptata. The disease was particularly damaging when it developed in Swiss chard fields planted for “baby leaf” fresh market products. Such crops are placed on 2-m wide beds, planted with high seed densities, and are sprinkler irrigated. This disease has been reported from Asia, Australia, Europe, and other U.S. states. References: (1) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (2) J. L. W. Rademaker et al. Mol. Microbiol. Ecol. Man. 3.4.3:1–27, 1998.

Download Full-text

First Report of Pseudomonas syringae pv. aptata Causing Bacterial Leaf Spot on Sugar Beet in Serbia

Plant Disease ◽

10.1094/pdis-06-14-0628-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 281-281 ◽

Cited By ~ 2

Author(s):

V. Stojšin ◽

J. Balaž ◽

D. Budakov ◽

Slaviša Stanković ◽

I. Nikolić ◽

...

Keyword(s):

Sugar Beet ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Leaf Surface ◽

Negative Control ◽

Gyrb Gene ◽

Bacterial Suspension ◽

Bacterial Strains ◽

Gene Sequences ◽

Bacterial Leaf Spot

A severe bacterial leaf spot was observed during June and July 2013 on commercial cultivars of sugar beet (Beta vulgaris var. saccharifera) in the Vojvodina Province of Serbia. Serbia is a major sugar beet production area in southeastern Europe, with 62,895 ha and 3 million tons of sugar beet yield in 2013. A foliar leaf spot observed in 25 commercial sugar beet fields surveyed ranged from 0.1 to 40% severity. Symptoms were characterized as circular or irregular, 5- to 20-mm diameter, white to light brown necrotic spots, each with a dark margin. Diseased leaves were rinsed in sterilized, distilled water (SDW) and dried at room temperature, and leaf sections taken from the margin of necrotic tissue were macerated in SDW. Isolations from 48 symptomatic leaves onto nutrient agar with 5% (w/v) sucrose (NAS) produced bacterial colonies that were whitish, circular, dome-shaped, and Levan-positive. Representative isolates (n = 105) were Gram negative; aerobic; positive for catalase, fluorescence on King's medium B, and tobacco hypersensitivity; and negative for oxidase, potato rot, and arginine dehydrolase. These reactions corresponded to LOPAT group Ia, which includes Pseudomonas syringae pathovars (2). Repetitive extragenic palindromic sequence (rep)-PCR was used for genetic fingerprinting the isolates using the REP, ERIC, and BOX primers. Twenty-five different profiles were obtained among the strains. From each profile group, one representative strain was sequenced for the gyrB gene (1). Four heterogenic groups were observed, and representative gyrB gene sequences of each group were deposited in the NCBI GenBank (Accession Nos. KJ950024 to KJ950027). The sequences were compared with those of pathotype strain P. syringae pv. aptata CFBP 1617 deposited in the PAMDB database; one strain was 100% homologous, and the other three were 99% homologous. To fulfill identification of the Serbian sugar beet isolates, gltA and rpoD partial gene sequences were determined (1), and the sequences were deposited as Accession Nos. KM386838 to KM386841 for gltA and KM386830 to KM38683033 for rpoD. The sequences were 100% homologous with those of pathotype strain CFBP 1617. Pathogenicity of each of four representative bacterial strains was tested on 3-week-old plants of the sugar beet cultivars Marinela, Serenada, and Jasmina (KWS, Belgrade, Serbia) and Lara (NS Seme, Novi Sad, Serbia) by atomizing a bacterial suspension of ~106 CFU/ml of the appropriate isolate onto the abaxial leaf surface of three plants per cultivar until water-soaking of the leaf surface was observed. Three plants of each cultivar atomized similarly with P. syringae pv. aptata CFBP 2473 and SDW served as positive and negative control treatments, respectively. Inoculated plants were kept in a clear plastic box at 80 to 100% RH and 17 ± 1°C and examined for symptom development over 3 weeks. For all test isolates and the control strain, inoculated leaves first developed water-soaked lesions 7 days after inoculation (DAI). By 10 to 14 DAI, lesions were necrotic and infection had spread to the petioles. By 21 DAI, wilting was observed on more than 50% of inoculated plants. Negative control plants were symptomless. Bacteria re-isolated onto NAS from inoculated leaves had the same colony morphology, LOPAT results, and gyrB partial gene sequences as described for the test strains. No bacteria were re-isolated from negative control plants. Based on these tests, the pathogen causing leaf spot on sugar beet in Serbia was identified as P. syringae pv. aptata. References: (1) P. Ferrente and M. Scortichini. Plant Pathol. 59:954, 2010. (2) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966.

Download Full-text

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in China

Plant Disease ◽

10.1094/pdis-09-21-1901-pdn ◽

2021 ◽

Author(s):

Lei Li ◽

Yishuo Huang ◽

Yanxia Shi ◽

A LI CHAI ◽

Xuewen Xie ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Citrate Synthase ◽

Morphological Characteristics ◽

Likelihood Method ◽

Bacterial Suspension ◽

Leaf Spot Disease ◽

Distilled Water ◽

Bacterial Leaf Spot ◽

First Report

Coriander (Coriandrum sativum L.) or Chinese parsley is a culinary herb with multiple medicinal effects that are widely used in cooking and traditional medicine. From September to November 2019, symptoms were observed in 2-month-old coriander plants from coriander ﬁelds in Lanzhou and Wenzhou, China. The disease developed rapidly under cold and wet climatic conditions, and the infection rate was almost 80% in open coriander fields. Typical symptoms on leaves included small, water-soaked blotches and irregular brown spots surrounding haloes; as the disease progressed, the spots coalesced into necrotic areas. Symptomatic leaf tissue was surface sterilized, macerated in sterile distilled water, and cultured on nutrient agar plates at 28 °C for 48 h (Koike and Bull, 2006). After incubation, six bacterial colonies, which were individually isolated from collected samples from two different areas, were selected for further study. Colonies on NA plate were small, round, raised, white to cream-colored, and had smooth margins. All bacterial isolates were gram-negative, rod-shaped and nonfluorescent on King's B medium. The bacteria were positive for levan production, Tween 80 hydrolysis, and tobacco hypersensitivity but negative for oxidase, potato slice rot test, arginine dihydrolase, ice nucleation activity, indole production and H2S production. The suspension of representative isolate for inoculating of plants was obtained from single colony on King's B medium for 2-3 days at 28 °C. DNA was extracted from bacterial suspensions of YS2003200102 cultured in 20 ml of King’s B medium broth at 28 °C for 1 day. Extraction was performed with a TIANamp Bacterial DNA Kit (TIANGEN, China) according to the manufacturer’s recommendations. The pathogen was confirmed by amplification and sequencing of the glyceraldehyde-3-phosphate dehydrogenase A (gapA) gene, the citrate synthase (gltA) gene, the DNA gyrase B (gyrB) gene and the RNA polymerase sigma factor 70 (rpoD) gene using gapA-For/gapA-Rev, gltA-For/gltA-Rev, gyrB-For/gryB-Rev, rpoD-For/rpoD-Rev primers, respectively (Popović et al., 2019). The sequences of the PCR products were deposited in GenBank with accession numbers MZ681931 (gapA), MZ681932 (gltA), MZ681933 (gyrB), and MZ681934 (rpoD). Phylogenetic analysis of multiple genes (Xu and Miller, 2013) was conducted with the maximum likelihood method using MEGA7. The sequences of our isolates and ten published sequences of P. syringae pv. coriandricola were clustered into one clade with a 100% confidence level. To confirm the pathogenicity of isolate YS2003200102, 2-month-old healthy coriander plants were inoculated by spraying the leaves with a bacterial suspension (108 CFU ml−1) at 28 °C incubation temperature and 70% relative humidity condition, and sterile distilled water was applied as a negative control treatment (Cazorla et al. 2005). Three replicates were conducted for every isolate, and each replicate included 6 coriander plants. After twelve days, only the inoculated leaves with bacterial suspension showed bacterial leaf spot resembling those observed on naturally infected coriander leaves. Cultures re-isolated from symptomatic leaves showed the same morphological characteristics and molecular traits as those initially isolated from infected leaves in the field. This bacterium was previously reported causing leaf spot of coriander in India and Spain (Gupta et al. 2013; Cazorla et al. 2005). To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in China. Studies are needed on strategies to manage P. syringae pv. coriandricola in crops, because its prevalence may cause yield loss on coriander in China.

Download Full-text

First Report of Bacterial Leaf Spot of Italian Dandelion (Cichorium intybus) Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽

10.1094/pd-90-0245a ◽

2006 ◽

Vol 90 (2) ◽

pp. 245-245 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

C. T. Bull

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Late Summer ◽

Hypersensitive Reaction ◽

Cichorium Intybus ◽

Nutrient Broth ◽

Bacterial Strains ◽

Bacterial Leaf Spot ◽

First Report ◽

Leaf Spots

Italian dandelion (Cichorium intybus) is a leafy, nonhead forming chicory plant that is eaten as a fresh vegetable in salads. During the late summer (August through October) of 2002, in the Salinas Valley (Monterey County) in California, a previously unreported disease was found in commercial Italian dandelion fields. Early symptoms were angular, vein delimited, dark, water-soaked leaf spots that measured 2 to 7 mm in diameter. As disease developed, spots retained angular edges but exhibited various irregular shapes. Spots commonly formed along the edges of the leaves; in some cases these spots developed into lesions that measured between 10 and 30 mm long. Spots were visible from adaxial and abaxial sides and were dull black in color. A cream-colored pseudomonad was consistently isolated from leaf spots that were macerated and streaked onto sucrose peptone agar. Fungi were not recovered from any of the spots. Recovered strains were blue-green fluorescent when streaked onto King's medium B agar. Bacterial strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices but induced a hypersensitive reaction on tobacco (Nicotiana tabacum cv. Turk). These data indicated that the bacteria belonged to LOPAT group 1 of Pseudomonas syringae (1). Pathogenicity of six strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying onto 12 6-week-old plants of Italian dandelion cv. Catalogna Special. Untreated control plants were sprayed with sterile nutrient broth. After 10 to 12 days in a greenhouse (24 to 26°C), leaf spots similar to those observed in the field developed on all inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. These inoculation experiments were done twice and the results were the same. Amplification of repetitive bacterial sequences (repetitive sequence-based polymerase chain reaction [rep-PCR]) demonstrated that all Italian dandelion strains had the same rep-PCR fingerprint, which differed from fingerprints of P. syringae pv. tagetis and P. syringae pv. tabaci. Additionally, toxin specific primers did not amplify tagetitoxin or tabtoxin biosynthesis genes from Italian dandelion strains. To our knowledge, this is the first report of bacterial leaf spot of commercially grown Italian dandelion in California caused by a P. syringae pathovar. Because fields were irrigated with overhead sprinklers, the disease was severe in several fields and as much as 30% of those plantings were not harvested. Reference: (1) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966.

Download Full-text

First Report of Pseudomonas syringae pv. aptata Causing Bacterial Leaf Spot on Common Beet (Beta vulgaris) in Ohio

Plant Disease ◽

10.1094/pdis-08-19-1720-pdn ◽

2020 ◽

Vol 104 (2) ◽

pp. 561-561

Author(s):

F. Rotondo ◽

C. M. Vrisman ◽

R. Rani ◽

A. L. Testen ◽

L. Deblais ◽

...

Keyword(s):

Beta Vulgaris ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Bacterial Leaf Spot ◽

First Report

Download Full-text

First Report of Pseudomonas syringae pv. coriandricola Causing Bacterial Leaf Spot on Carrot, Parsley, and Parsnip in Serbia

Plant Disease ◽

10.1094/pdis-10-14-1041-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 416-416 ◽

Cited By ~ 6

Author(s):

T. Popović ◽

Ž. Ivanović ◽

M. Ignjatov ◽

D. Milošević

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Bacterial Suspension ◽

Pathogenicity Test ◽

Distilled Water ◽

Bacterial Leaf Spot ◽

Koch’S Postulates ◽

First Report ◽

Vegetable Farm ◽

Koch's Postulates

During the spring of 2014, a severe leaf spot disease was observed on carrot (Daucus carota), parsley (Petroselinum crispum), and parsnip (Pastinaca sativa) on a 0.5-ha vegetable farm in Vojvodina Province, Serbia. The disease appeared under wet and cool conditions with 5 to 25% of plants infected for each of the three crops. Symptoms were characterized as brown angular leaf spots, ~2 mm in diameter, often limited by veins. Collected symptomatic leaves were rinsed and dried at room temperature, and leaf sections taken from the margin of necrotic tissue were macerated in sterile phosphate buffer and streaked onto nutrient agar with 5% (w/v) sucrose (NAS). After isolation, whitish, circular, dome-shaped, Levan-positive colonies consistently formed. Five strains from each host (carrot, parsley, and parsnip) were used for further study. Strains were gram-negative, aerobic, and positive for catalase and tobacco hypersensitive reaction but negative for oxidase, rot of potato slices, and arginine dihydrolase. These reactions corresponded to LOPAT group Ia, which includes Pseudomonas syringae pathovars (3). Repetitive extragenic palindromic sequence (Rep)-PCR fingerprint profiles using the REP, ERIC, and BOX primers (4) were identical for all strains. Sequence typing of the housekeeping genes gyrB and rpoD (1) was performed for three representative strains (one from each host). Sequences were deposited in the NCBI GenBank database as accessions KM979434 to KM979436 (strains from carrot, parsnip, and parsley, respectively) for the gyrB gene and KM979437 to KM979439 (strains from parsnip, parsley and carrot, respectively) for the rpoD gene. Sequences were compared with pathotype strain Pseudomonas syringae pv. coriandricola ICMP12471 deposited in the Plant Associated and Environmental Microbes Database ( http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl ). BLAST analysis revealed 100% homology for gyrB and 99% homology for rpoD. Pathogenicity was tested with five representative strains from each host on four-week-old plants of carrot (cv. Nantes), parsley (cv. NS Molski), and parsnip (cv. Dugi beli glatki) using two methods: spraying the bacterial suspension (108 CFU ml−1) on the leaves until runoff (5) and injecting the bacterial suspension into leaves with a hypodermic syringe (2). Four plants were used per strain and method. Sterile distilled water was applied as a negative control treatment for each plant species. All plants were kept in a mist room with 100% humidity for 4 h, then transferred to a greenhouse at 25°C and 80% relative humidity and examined for symptom development over a period of three weeks. For all strains, inoculated leaves first developed water-soaked lesions on the leaves 5 to 7 days after inoculation (DAI); 14 DAI lesions became dark brown, often surrounded by haloes. No symptoms were observed on control plants inoculated with sterile distilled water. For fulfillment of Koch's postulates, re-isolations were done onto NAS. Re-isolated bacteria were obtained from each inoculated host and confirmed to be identical to the original isolates using the LOPAT tests and Rep-PCR fingerprinting profiles. Based on the pathogenicity test accompanied by completion of Koch's postulates, sequence analysis, and bacteriological tests, the strains were identified as P. s. pv. coriandricola. To our knowledge, this is the first report of bacterial leaf spot of carrot, parsley, and parsnip in Serbia. It may present a threat to production due to quality requirements for fresh market. References: (1) P. Ferrente and M. Scortichini. Plant Pathol. 59:954, 2010. (2) M. Gupta et al. Plant Dis. 97:418, 2013. (3) R. A. Lelliott et al. J. Appl. Bacteriol. 29:470, 1966. (4) F. J. Louws et al. Appl. Environ. Microb. 60:2286, 1994. (5) X. Xu and S. A. Miller. Plant Dis. 97:988, 2013.

Download Full-text

First Report of Bacterial Leaf Spot of Parsley Caused by Pseudomonas syringae pv. coriandricola in Ohio

Plant Disease ◽

10.1094/pdis-12-12-1181-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 988-988 ◽

Cited By ~ 1

Author(s):

X. Xu ◽

S. A. Miller

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Phosphate Buffer ◽

Bacterial Culture ◽

Potassium Phosphate ◽

Negative Control ◽

Pathogenicity Test ◽

Potassium Phosphate Buffer ◽

First Report ◽

Average Maximum

A severe leaf spot of parsley (Petroselinum crispum L. cvs. Dark Green Italian and Gigante) was observed on ∼1.5 ha in 2007 and 8 ha in 2012 on three vegetable farms in northern Ohio. Tiny, water-soaked spots that enlarged to necrotic lesions (∼5 mm wide) were first observed in June of each year. Lesions often coalesced and leaf marginal necrosis was common. Disease incidence initially ranged from 20 to 50%, and a 1.5-ha field was completely lost in 2012 as a result of the disease. Bacterial streaming was observed microscopically from leaf lesions. Diseased leaf tissue was dipped briefly in 70% ethanol, rinsed in sterile water, and blotted dry. Bacteria were isolated by plating 10-fold serial dilutions of diseased tissue extracts onto yeast dextrose carbonate and Pseudomonas F (PF) agar media. Whitish, opaque, circular colonies were isolated consistently from all samples. One isolate was purified from each of four fields. They were all gram-negative, non-fluorescent on PF medium, levan positive, oxidase negative, arginine dihydrolase negative, potato rot negative, and tobacco hypersensitive reaction positive. Repetitive extragenic palindromic sequence (Rep)-PCR fingerprint profiles using the BOXA1R primer (4) were identical for the four isolates. A pathogenicity test was conducted with strain SM69-07 isolated in 2007. A bacterial culture was suspended in sterile potassium phosphate buffer (0.01M, pH 7.4) and adjusted to 108 CFU/ml. Four 4-week-old plants each of parsley and cilantro (Ferry-Morse Seed Co.) were inoculated by spraying the bacterial suspension on the leaves until runoff. Potassium phosphate buffer was applied as a negative control treatment for each plant species. Plants were kept in a mist room with 100% humidity for 4 h, then transferred to a greenhouse with average maximum and minimum temperatures of 30 and 25°C. Leaf symptoms similar to those on the original plants were observed on the inoculated parsley and cilantro plants within 14 days of inoculation, whereas no symptoms developed on the negative control plants. One bacterial isolate obtained from each inoculated host using the isolation method described above was confirmed to be identical to the original isolates using the LOPAT tests and Rep-PCR DNA fingerprint profiles; no target bacteria were isolated from the negative control plants. Multilocus sequence typing (MLST) of the housekeeping genes gap1, gltA, gyrB, and rpoD was conducted for strain Sm69-07 (2,3). Sequence data were subjected to BLASTn searches in the Plant-Associated Microbes Database (PAMDB, http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl ) (1). The sequences aligned with those of Pseudomonas syringae pv. coriandricola with 100% identity to alleles 101 (gyrB), 123 (rpoD), 7 (gap1), and 64 (gltA). Strain information and sequence alignment results for SM69-07 were submitted to PAMDB and assigned as isolate ID 1138. Based on bacterial culture morphology, LOPAT profile, pathogenicity test results, and MLST, the pathogen was confirmed as P. syringae pv. coriandricola. To our knowledge, this is the first report of bacterial spot of parsley caused by P. syringae pv. coriandricola in Ohio. Due to stringent quality requirements for fresh market parsley, this disease may pose a threat to the economic sustainability of parsley production in Ohio. References: (1) N. F. Almeida et al. Phytopathology 100:208, 2010. (2) C. T. Bull et al. Phytopathology 101:847, 2011. (3) M. S. Hwang et al. Appl. Environ. Microbiol. 71:5182, 2002. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

Download Full-text

First Report of Bacterial Leaf Spot Disease Caused by Pseudomonas syringae pv. syringae on Panax notoginseng

Plant Disease ◽

10.1094/pdis-11-12-1047-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 685-685 ◽

Cited By ~ 2

Author(s):

L.-H. Zhou ◽

Y. Han ◽

G.-H. Ji ◽

Z.-S. Wang ◽

F. Liu

Keyword(s):

16S Rdna ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Panax Notoginseng ◽

Rdna Sequence ◽

Bacterial Leaf Spot ◽

16S Rdna Sequence ◽

First Report ◽

Leaf Spots ◽

Phosphate Buffered Saline

Panax notoginseng is a species that produces a rare type of Chinese herbal medicine and is cultivated primarily in Yunnan Province. P. notoginseng has a 3-year-long crop cycle before harvest. A new bacterial disease was observed on P. notoginseng plants in the Wenshan Mountain area of Yunnan in 2012. The disease affected primarily leaves. Symptoms were circular or irregular brown leaf spots, surrounded by a yellow halo, located on the edges of the leaves. Eight creamy white pigmented, rounded strains were isolated consistently from leaf spots on Luria-Bertani agar (LB) medium, incubated at 28°C. Three strains (SQYB-1, SQYB-2, SQYB-3) of eight isolates were prepared for further study. Three isolates were purified and characterized: all were gram-negative, rod-shaped, motile, aerobic, non-spore forming, and negative for oxidase, potato soft rot, arginine dehydrolase, presence of tyrosinase and urease, nitrate, and fluorescent pigment production. Moreover, they were positive for levan production, presence of catalase, and for tobacco hypersensitivity. All three strains isolated were identified as Pseudomonas syringae pv. syringae (Pss) based on morphology, metabolic profile (Biolog Microbial ID System), and 16S rDNA sequence analysis (1). The metabolic similarity index between experiment strain SQYB-1 and a type of strain Pss was 0.619. The primers of 16S rDNA sequence amplification were 27F/1492R. Before sequencing, we cloned the PCR products. There was 99% homology in 16S rDNA sequences between one isolate, SQYB-1 (NCBI Accession No. JX876901) and Pss (HQ840766), supporting the identification of the P. notoginseng strains as Pss (3). For Koch's postulates, 10 surface-disinfected young leaves on three plants were inoculated with SQYB-1 isolates by spraying a phosphate-buffered saline cell suspension (3.0 × 108 CFU/ml) onto the leaves (4). Controls were inoculated similarly with sterile phosphate-buffered saline. Plants were covered with polyethylene bags for 24 h at 25°C and then transferred to a greenhouse. Circular or irregular brown spots were observed on all bacteria-inoculated leaves within 9 to 14 days after inoculation. No symptoms were observed on controls. Bacteria reisolated from inoculated leaves were identical to the original isolates as determined by the methods described above. The present study indicated that isolate SQYB-1 could independently infect P. notoginseng leaves, which was different from the finding of Luo et al. concerning involvement of Pss in root rot (2). To our knowledge, this is the first report of Pseudomonas syringae pv. syringae causing bacterial leaf spot on P. notoginseng in China. References: (1) M. R. Gillings et al. PNAS 12:102, 2005. (2) W. F. Luo et al. J. Yunnan Agric. Univ. 14:123, 1999 (in Chinese). (3) C. L. Oliver et al. Plant Dis. 4:96, 2012. (4) H. Ornek et al. New Dis. Rep. 13:40, 2006.

Download Full-text

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽

10.1094/pdis-03-12-0257-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 418-418 ◽

Cited By ~ 5

Author(s):

M. Gupta ◽

N. Bharat ◽

A. Chauhan ◽

A. Vikram

Keyword(s):

Host Range ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Molecular Techniques ◽

Bacterial Suspension ◽

Leaf Spot Disease ◽

Rrna Gene ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Download Full-text