scholarly journals First Report of Tomato yellow leaf curl virus in Tomato in Guadeloupe

Plant Disease ◽  
2003 ◽  
Vol 87 (11) ◽  
pp. 1397-1397 ◽  
Author(s):  
C. Urbino ◽  
K. Tassius
Keyword(s):  
Puerto Rico ◽  
Pcr Primers ◽  
Tomato Yellow Leaf ◽  
Yellow Mosaic Virus ◽  
Yellow Leaf ◽  
Tomato Production ◽  
First Report ◽  
Embl Accession ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 2001, symptoms of stunting and chlorotic curled leaves of reduced size were observed on tomato plants in Guadeloupe. These symptoms were different from those described for Potato yellow mosaic virus, which has been present since 1993, but similar to those described for Tomato yellow leaf curl virus (TYLCV). Samples from symptomatic plants were collected and analyzed by polymerase chain reaction (PCR). Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were designed to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV-IL species (2). Primer pair MP16/MP82 (3) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from all symptomatic samples but not from uninfected samples. A 950-bp and a 550-bp PCR product were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced with plasmid specific primers (SP6 and T7). Sequences were compared with those available in the NCBI database using BlastN. Fifteen of the sequences that gave the highest score with BlastN were aligned with the Guadeloupe sequences using Clustal W. The nucleotide sequence of the 950-bp fragment (GenBank Accession No. AY319645) shared at least 97% sequence identity with that of TYLCV from Israel (EMBL Accession No. X15656), Puerto Rico (GenBank Accession No. AY134494), Cuba (EMBL Accession No. AJ223505), and the Dominican Republic (GenBank Accession No. AF024715). Similar percentages of identity were obtained with the 550-bp sequence (GenBank Accession No. AY319646). These results confirm that a begomovirus belonging to the species TYLCV-Israel is infecting tomato in Guadeloupe. To our knowledge, this is the first report of TYLCV in this region of the Caribbean. Puerto Rico is the closest location from which TYLCV was previously reported (1). In May 2002, typical TYLCV symptoms were observed in all tomato production areas at an incidence of 80 to 100%. References: (1) J. Bird et al. Plant Dis. 85:1028, 2001. (2) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (3) P. Umaharan et al. Phytopathology 88:1262, 1998.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus in Mississippi

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1287-1287 ◽  
Author(s):  
D. M. Ingram ◽  
A. Henn
Keyword(s):  
Leaf Size ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Production Operation ◽  
Yellow Leaf ◽  
Pcr Assay ◽  
Tomato Production ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (family Geminiviridae) that causes severe chlorosis, stunting, and cupping of leaves in tomato (Lycopersicon esculentum) throughout the world. The disease was first reported in the United States in Florida in 1997 (2). In 2000, TYLCV was confirmed as the cause of severe chlorosis, stunting, and cupping of leaves in tomato in Louisiana (3). In January of 2001, mild symptoms consistent with TYLCV were observed in a greenhouse-tomato production operation in east-central Mississippi. Whiteflies (Bremisia tabaci) were present in the greenhouse during the previous month, but in relatively low numbers. Symptom severity slightly increased over time with chlorosis in the terminal, reduction in terminal leaf size, and upward cupping of leaves observed. Approximately 4% of plants in the greenhouse developed symptoms. Yield reductions are thought to be negligible since the tomato plants harbored most fruit for that growing season. Terminal growth was halted, and no additional flower production was observed. No symptoms were observed on mature fruit; however, fruit set after leaf symptoms developed remained stunted. A representative sample of symptomatic tissue was submitted to an independent lab (Agdia, Inc., Elkhart, IN), screened for whitefly-transmitted geminiviruses, and the results were positive. Additional symptomatic tomato tissue was submitted to the University Diagnostics Lab, University of Florida, Gainesville, and was observed for viral inclusion bodies. This test was positive for TYLCV based on morphology of virus particles located in the nucleus of tomato cells (1). Total DNA was extracted from the symptomatic plants for polymerase chain reaction (PCR) assay (2). Results from the PCR assay indicated the presence of TYLCV in symptomatic tomato tissue. The strain of the virus was not determined. To our knowledge, this is the first report of TYLCV in Mississippi. References: (1) B. Pico et al. Sci. Hortic. 67:151, 1996. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) R. A. Valderde et al. Plant Dis. 85:230, 2001.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean (Phaseolus vulgaris) in Greece

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 465-465 ◽  
Author(s):  
L. C. Papayiannis ◽  
A. Paraskevopoulos ◽  
N. I. Katis
Keyword(s):  
Phaseolus Vulgaris ◽  
Tomato Yellow Leaf ◽  
Cultivated Plants ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Embl Accession ◽  
Bean Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl is one of the most devastating virus diseases of tomato (Lycopersicon esculentum Mill) crops worldwide. Several whitefly-transmitted viruses are associated with the disease and all are assigned to the genus Begomovirus, family Geminiviridae. In Greece, Tomato yellow leaf curl virus (TYLCV) was first reported to infect greenhouse and open-field tomatoes in 2000 (2). During 2006, a survey was conducted in the southwestern part of Peloponnese (mainland) within the areas of Kyparissia and Filiatra (Perfecture of Messinia) to identify the prevalence and natural hosts of the disease. During this survey, yellow mosaic, severe leaf curling, and leaf crumple symptoms were observed in greenhouse bean plants (Phaseolus vulgaris) that were cultivated together with tomatoes showing typical TYLCV symptoms. In all affected greenhouses, the incidence of the disease ranged from 1 to 5% in beans and 90 to 100% in tomato plants. Both bean and tomato plants were highly infested with Bemisia tabaci (Gennadius) populations and produced unmarketable fruits. Twenty-four symptomatic bean plants were collected from four greenhouses that tested positive by triple-antibody sandwich-ELISA using TYLCV-specific antibodies purchased from NEOGEN, EUROPE, Ltd. DNA was extracted from all infected bean plants, and a 580-bp fragment of the coat protein gene was amplified by PCR using the TY(+)/TY(-) primer pair (1). Amplified fragments were then analyzed by restriction fragment length polymorphism with Ava II cutter enzyme. Two DNA fragments of 277 and 302 bp in agarose gels were produced from all isolates and the restriction pattern corresponded to TYLCV. The amplified DNA from four infected bean plants was cloned and sequenced. All four sequences were 100% identical (EMBL Accession No. AM418398) and showed 99% nucleotide identity to a TYLCV isolate from Italy (EMBL Accession No. DQ144621). To our knowledge, this is the first report of TYLCV infection of P. vulgaris, which is an important commercial crop in Messinia, Greece. Within the last decade, TYLCV has emerged as an important pathogen for several cultivated plants in many regions and different TYLCV variants have been reported to infect P. vulgaris (3). Bean is often used as an intercrop between tomato crops, and thus, infected plants may serve as a potential reservoir for virus survival and spread (4). References: (1) G. P. Accotto et al. Eur. J. Plant Pathol. 106:179, 2000. (2) A. D. Avgelis et al. Plant Dis. 85:678, 2001. (3) J. Morris et al. EPPO Bull. 32:41, 2002. (4) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First report of natural infection of tomato yellow leaf curl virus on cucumber in China

2020 ◽  
Vol 102 (4) ◽  
pp. 1371-1371
Author(s):  
Feng Zhu ◽  
Qin-Qin Zhang ◽  
Peng-Xiang Zhu ◽  
Qi-Ping Zhang ◽  
Meng-Yao Cao ◽  
...  
Keyword(s):  
Natural Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
First Report ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

scholarly journals Occurrence of Tomato yellow leaf curl virus in Tomato in Martinique, Lesser Antilles

Plant Disease ◽  
2007 ◽  
Vol 91 (8) ◽  
pp. 1058-1058 ◽  
Author(s):  
C. Urbino ◽  
A. Dalmon
Keyword(s):  
Pcr Primers ◽  
Tomato Yellow Leaf ◽  
Lesser Antilles ◽  
Yellow Leaf ◽  
Rapid Spread ◽  
Pcr Products ◽  
Dnaman Software ◽  
Northwest Region ◽  
Leaf Curl Virus ◽  
Leaf Curl

During April of 2002, symptoms of stunting and chlorotic curled leaves of reduced size, similar to those caused by Tomato yellow leaf curl virus (TYLCV), were observed for the first time in commercial tomato (Solanum lycopersicum) in the northwest region of Martinique. Six months later, many tomato fields had more than 80% of plants expressing these symptoms and yield was drastically reduced. Samples from two symptomatic plants were collected and analyzed by PCR. Primers PC1 (5′-TGACTATGTCGAAGCGACCAGG-3′) and PC2 (5′-CGACATTACAGCCTCAGACTGG-3′) were used to amplify a 950-bp fragment within the coat protein gene (CP) of TYLCV species (1). Primer pair MP16-MP82 (2) amplified a 550-bp fragment from the conserved nonanucleotide sequence (TAATATTAC) to the 5′ end of the CP gene. Products of expected sizes were obtained with both pairs of primers from symptomatic samples but not from uninfected ones. The two overlapping PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. A BLAST analysis was conducted with begomovirus sequences available in the GenBank database at the NCBI, and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The 1275-bp sequence (GenBank Accession No. EF490995) shared 99% nucleotide identity with the partial sequences of TYLCV from Antigua and Barbuda (GenBank Accession No. EF028240), Saint Kitts and Nevis (GenBank Accession No. EF028239), and the two overlapping sequences from Guadeloupe (GenBank Accessions No. AY319645 and AY319646). It was at least 98% identical to TYLCV isolates from Florida (GenBank Accession No AY530931), Dominican Republic (GenBank Accession No. AF024715), and Cuba (GenBank Accession No. AJ223505). These results confirm the introduction of TYLCV into Martinique, possibly from a nearby Caribbean country, and reveal its southward spread in the Lesser Antilles. The nearness of the islands in the Lesser Antilles (20 to 100 km distant) probably permitted the rapid spread of TYLCV through the movement of plant material or wind transport of viruliferous whiteflies from one island to the next. Monitoring the spread of TYLCV in this Caribbean archipelago is important for regional virus management and in forecasting the spread of TYLCV to nearby countries in South America. References: (1) Y. Martinez et al. Rev. Prot. Veg. 18:168, 2003. (2) P. Umaharan et al. Phytopathology 88:1262, 1998.

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Sign in / Sign up

Export Citation Format

Share Document