First Record of Hop stunt viroid in Canada

“Tissue-printing” hybridization (3) for Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) was used to assess the sanitary status of stone fruit accessions in the Canadian Clonal Genebank (CCG) located in Harrow (Ontario). The Prunus spp. accessions in the CCG are primarily of Canadian origin; other countries of origin include the United States, the United Kingdom, Hungary, the Czech Republic, the Former Soviet Union, Spain, New Zealand, and Italy. All Prunus spp. accessions were donated to the Genebank from Canadian or American sources. Leaves were harvested in November 2003 from 336 trees (116 peach and nectarine, 84 sweet and sour cherries, 54 plum, 44 apricot, and 38 of other cherries) representing 267 accessions. No visible symptoms were observed during the collection of the accessions to be evaluated. The petioles were excised at the base and imprinted on a nylon membrane in triplicate for each sample. The membranes were air dried and submitted by mail to the laboratory. The digoxigenin-labeled riboprobes used for hybridization were obtained by T7 RNA polymerase transcription of the linearized plasmids pHSVd (1) and pPLMVd (2). Thirty stone fruit samples were infected by viroids. PLMVd occurred in 28 peach and nectarine samples, representing the following cultivars and selections: Harblaze Hardired, Harko, Earlyvee, Harbelle, Harken, Harland, Harrow Beauty, Harrow Rubirose, HW264, Redhaven, Silver Gold, Suncling, V68101, Vanity, Veeglo, Velvet, Vesper, Villa Doria, and Vulcan. PLMVd-infected samples represented 24.1% of the tested peaches and nectarines. PLMVd finding confirms previous reports of the viroid in Canada from British Columbia and Ontario. Two CCG apricot accessions, ‘Bulida’ and ‘Velkopavlovicka’, were found to be infected with only HSVd, representing 4.5% of tested apricot samples. These samples, determined to be positive by tissue-printing hybridization, were also positive by reverse transcription-polymerase chain reaction (RT-PCR) (1). In addition, nucleotide sequences of the PCR products were obtained. The ‘Bulida’ isolate showed 100% homology to a Spanish isolate, apr9, while the ‘Velkopavlovicka’ isolate showed 99% homology to an Italian isolate. Since HSVd has not been previously reported in Canada (4), to our knowledge, this report documents its first detection in the country. This report may prompt the inclusion of regular testing for HSVd in existing Prunus spp. virus testing programs in Canada. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. Badenes et al. Acta Hortic. 472:565, 2001. (3) V. Pallás et al. Page 135 in: Virus and Virus-Like Diseases of Stone Fruits, with Particular Reference to the Mediterranean Region. A. Myrta et al., eds. CIHEAM-IAMB, 2003. (4) R. Singh et al. Page 255 in: Viroids. A. Hadidi et al., eds. CSIRO Publishing, Australia, 2003.

Download Full-text

First record of a Hop stunt viroid variant on Nagpur mandarin and Mosambi sweet orange trees on rough lemon and Rangpur lime rootstocks

Plant Pathology ◽

10.1111/j.1365-3059.2005.01194.x ◽

2005 ◽

Vol 54 (4) ◽

pp. 571-571 ◽

Cited By ~ 3

Author(s):

P. Ramachandran ◽

J. Agarwal ◽

A. Roy ◽

D. K. Ghosh ◽

D. R. Das ◽

...

Keyword(s):

Sweet Orange ◽

First Record ◽

Rangpur Lime ◽

Stunt Viroid ◽

Rough Lemon ◽

Hop Stunt Viroid ◽

Orange Trees

Download Full-text

TRACKING HOP STUNT VIROID INFECTION IN APRICOT TREES DURING A WHOLE YEAR BY NON-ISOTOPIC TISSUE PRINTING HYBRIDISATION

Acta Horticulturae ◽

10.17660/actahortic.2001.550.45 ◽

2001 ◽

pp. 315-320 ◽

Cited By ~ 8

Author(s):

K. Amari ◽

M.C. Cañizares ◽

V. Pallás ◽

A. Myrta ◽

S. Sabanadzovic ◽

...

Keyword(s):

Stunt Viroid ◽

Tissue Printing ◽

Hop Stunt Viroid ◽

Viroid Infection

Download Full-text

First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽

10.1094/pdis.2004.88.10.1164a ◽

2004 ◽

Vol 88 (10) ◽

pp. 1164-1164 ◽

Cited By ~ 7

Author(s):

I. Fekih Hassen ◽

J. Kummert ◽

S. Marbot ◽

H. Fakhfakh ◽

M. Marrakchi ◽

...

Keyword(s):

Plant Pathogens ◽

Prunus Persica ◽

Fruit Trees ◽

Pcr Analysis ◽

Economic Damage ◽

Rt Pcr ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Italian Isolate ◽

Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

Download Full-text

First Report of Hop stunt viroid Infecting Japanese Plum, Cherry Plum, and Peach in Greece

Plant Disease ◽

10.1094/pdis-03-13-0235-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1662-1662 ◽

Cited By ~ 3

Author(s):

M. S. Kaponi ◽

P. E. Kyriakopoulou

Keyword(s):

Stone Fruit ◽

Economic Losses ◽

Prunus Domestica ◽

Rt Pcr ◽

Japanese Plum ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Fruit Skin ◽

Viroid Infection ◽

Field Samples

Dapple plum and peach fruit is a widely distributed disorder of plum and peach resulting in significant economic losses (4). During a survey for the presence of Hop stunt viroid (HSVd) on stone fruit trees in Greece, samples from 30 European plums (Prunus domestica L., cvs. President, Tuleu Grass), 45 Japanese plums (Prunus salicina Lindl., cvs. Angeleno, Diamond, Santa Rosa), 12 cherry plums (Prunus domestica L. var. insititia (L.) Fiori & Paoletti of unknown cultivar), and 107 peaches (Prunus persica (L.) Batsch, cvs. Red Haven, Elberta, June Gold, Spring Crest, Lemonato) were collected in several orchards around Greece. Their fruit skin symptomatology indicated viroid infection (reddish dappling blotches and cracks in European and Japanese plum, green dappling in cherry plum, and light colored blotches and lines in peach). Samples were screened with tissue-print hybridization (TPH) for HSVd using a full length DIG-labelled riboprobe deriving from in vitro transcription of the positive control, a citrus isolate of HSVd (G. Vidalakis, CCPP, University of California, Riverside). In total, 44 out of the 194 trees surveyed were HSVd-positive with TPH. For a small number (40) of TPH-positive field samples, TNA phenol extraction from fruit skin, leaves, and bark and one-tube two-step reverse transcription (RT)-PCR assays followed, using a standardized protocol (3) with two different primer pairs, one new primer pair (this study) and a previously reported primer pair (2). RT-PCR analysis showed the presence of HSVd in peach and Japanese plum in prefectures Pella (Central Macedonia), Achaia, and Korinthia (Peloponnesus) and in cherry plum in Achaia (Peloponnesus). Six of 11 Japanese plums (cvs. Angeleno, Santa Rosa), 2 of 12 cherry plums, and 8 of 12 peaches (cvs. Spring Crest, Red Haven) examined were found HSVd-infected, but none of the five European plums were. Nucleotide sequence analyses of purified and cloned amplicons from peaches and Japanese and cherry plums revealed sizes of 297 to 308 nt and similarity to sequence variants of other HSVd isolates previously characterized: 95 to 97% identity with the Moroccan isolates apr.9, apr.10, apr.11, and apr.12 and the Spanish isolate apr.4 from apricot (1) (GenBank Accession Nos. AJ297825 to AJ297828 and Y09346, respectively). For confirmation of HSVd presence in field trees, 10 Japanese plums cv. Angeleno, 10 peaches cv. June Gold, and 10 peaches cv. Spring Crest, HSVd-negative (TPH), were bud- or chip-grafted from two of the aforementioned Japanese plums cv. Angeleno and two of the aforementioned peaches cv. Red Haven. Two years later, five Japanese plum trees (cv. Angeleno) and five peach trees (three cv. Spring Crest and two cv. June Gold) were found HSVd-positive with TPH; no fruits were observed to produce fruit symptoms as the grafted trees were kept in an insect-proof greenhouse (no bees for cross-pollination). To our knowledge, our investigation reports for the first time the occurrence of HSVd infecting Japanese plum, cherry plum, and peach in Greece, emphasizing the need for a certification program for the prevention of spreading stone fruit tree viroids in this country. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (3). F. Faggioli et al. Acta. Hort. 550:59, 2001. (4) T. Sano et al. J. Gen. Virol. 70:1311, 1989.

Download Full-text

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽

10.1094/pdis.2003.87.12.1537b ◽

2003 ◽

Vol 87 (12) ◽

pp. 1537-1537 ◽

Cited By ~ 1

Author(s):

M. Hassan ◽

P. Rysanek ◽

F. Di Serio

Keyword(s):

Czech Republic ◽

Stone Fruit ◽

Reference Sequence ◽

Mixed Infections ◽

Rt Pcr ◽

The Czech Republic ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Download Full-text

First Report of Peach latent mosaic viroid in Peach Trees in Montenegro

Plant Disease ◽

10.1094/pdis-06-11-0487 ◽

2012 ◽

Vol 96 (1) ◽

pp. 150-150 ◽

Cited By ~ 2

Author(s):

I. Mavric Pleško ◽

M. Viršcek Marn ◽

Z. Miladinovic ◽

J. Zindovic

Keyword(s):

Prunus Persica ◽

Stone Fruit ◽

Plum Pox Virus ◽

Rt Pcr ◽

First Report ◽

Fruit Species ◽

Hop Stunt Viroid ◽

Viroid Infection ◽

Fruit Samples ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to infect stone fruit species worldwide. The viroid infection can be latent or induce a variety of disease symptoms. Stone fruit samples were collected in Montenegro for a Plum pox virus (PPV) survey in 2007. Thirteen samples infected with PPV, taken from 12-year-old peach trees (Prunus persica (L.) Batsch, cv. Elegant Lady) in the area of Cemovsko field, were tested for the presence of PLMVd and HSVd by reverse transcription (RT)-PCR. Mild or severe mosaic, chlorotic rings, and fruit deformations were observed on some trees. Total RNA was extracted from all samples with a RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and RT-PCR was performed. Samples were tested for HSVd and PLMVd infection using primer pairs RF-43/RF-44 for PLMVd (1) and VP-19/VP-20 for HSVd (2). Amplification products of approximately 348 bp were obtained from nine samples with PLMVd primers. Amplification products from seven samples were successfully cloned into pGEM-T Easy Vector (Promega, Madison, WI) and used for transformation of Escherichia coli. At least four clones of each sample were sequenced. Obtained sequences were 337 and 338 nucleotides long and shared 90.3 to 100% identity. Consensus sequences of each sample were deposited in GenBank under Accession Nos. JF927892–JF927898. They showed 92.6 to 97.9% identity among each other, 94 to 98% identity with the PLMVd isolate G sequence (Accession No. EF591868) and 91.8 to 94.4% identity with PLMVd sequence M83545. HSVd was not detected in analyzed samples. PLMVd infections were found on peach trees in an area where approximately 40% of the peach production is located. Therefore, PLMVd infections can pose a threat to peach production in Montenegro. To our knowledge this is the first report of PLMVd infection of peach in Montenegro. References: (1) S. Ambrós et al. J. Virol. 72:7397, 1998. (2) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997.

Download Full-text

First Report of Grapevine yellow speckle viroid 1 and Hop stunt viroid in Grapevine (Vitis vinifera) in New Zealand

Plant Disease ◽

10.1094/pdis-12-10-0927 ◽

2011 ◽

Vol 95 (5) ◽

pp. 617-617 ◽

Cited By ~ 14

Author(s):

L. I. Ward ◽

G. M. Burnip ◽

L. W. Liefting ◽

S. J. Harper ◽

G. R. G. Clover

Keyword(s):

United States ◽

New Zealand ◽

Vitis Vinifera ◽

Complete Genome ◽

Consensus Sequence ◽

The United States ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Blastn Analysis

In February 2009, grapevines (Vitis vinifera) in a commercial vineyard in Auckland were showing shortened, spindly canes with tiny leaves. Approximately 10% of the vines were affected. An RNeasy Plant Mini Kit (Qiagen, Valencia, CA) was used to isolate total RNA from leaves collected from six symptomatic (cvs. BAC0022A and Syrah) and eight symptomless vines (cvs. BAC0022A, Syrah, and Chardonnay). RNA was tested by reverse transcription-PCR for the presence of Australian grapevine viroid, Citrus exocortis viroid, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2, and Hop stunt viroid (HSVd). Four of the six symptomatic and all the symptomless vines tested positive for GYSVd-1 using primers 5′-TGTGGTTCCTGTGGTTTCAC-3′ and 5′-ACCACAAGCAAGAAGATCCG-3′, which amplify the complete genome (368 bp), and published primers PBCVd100C/194H (3), which amplify a 220-bp region of the genome. Amplicons from each PCR were transformed into a pCR 4-TOPO vector (Invitrogen, Carlsbad, CA), cloned, and sequenced. Sequence from both PCRs aligned identically to generate a consensus sequence (GenBank Accession No. HQ447056), which showed 99% nt identity to GYSVd-1 (GenBank No. X87906) by BLASTN analysis. All symptomatic and symptomless vines also tested positive for HSVd using primers C/H-HSVd (4) and HSVd-C60/H79 (1), which amplify the complete genome (298 bp). Amplicons from each isolate were cloned and sequenced. Sequence from both PCRs were aligned. Clones from all isolates, with the exception of one, aligned identically to create a consensus sequence (GenBank No. HQ447057) that showed 99% nt identity to Chinese HSVd isolates from grapevine (GenBank Nos. DQ371436–59) by BLASTN analysis. Sequence from the remaining isolate (GenBank No. HQ447056) was identical to a German Riesling grape isolate of HSVd (GenBank No. X06873). The presence of each viroid was further confirmed in PCR-positive plants by dot-blot hybridization with digoxigenin-labeled synthetic ssRNA probes specific to the full-length genomes of GYSVd-1 and HSVd (S. Harper and L. Ward, unpublished data). To our knowledge, this is the first report of GYSVd-1 and HSVd in V. vinifera in New Zealand. Since both viroids were detected in symptomatic and symptomless plants, the symptoms observed in the vineyard cannot be attributed to viroid infection. Symptoms described for GYSVd-1 include leaf spots and flecks, but no disease symptoms have been reported in grapes as a result of HSVd (2). Viruses found in the vines include Grapevine leaf roll virus-3, Grapevine viruses A and B, and Rupestris stem pitting associated virus, but these are not thought to be the cause of the symptoms. Two sequence types of HSVd were found, suggesting at least two separate introductions of HSVd into the vineyard. The vineyard is more than 40 years old so both viroids may have been present for some years. Export of wine from New Zealand was worth 1 billion dollars in 2009, so there is potential for these viroids to have an economic impact if symptoms are expressed. HSVd has been reported from China, Europe, Japan, Middle East, Pakistan, and the United States. GYSVd-1 has been reported from Australia, China, East Mediterranean, Europe, Japan, and the United States. References: (1) A. Hadidi et al. Acta Hortic. 309:339, 1992. (2) A. Hadidi et al., eds. Viroids. CSIRO Publishing, Collingwood, Australia, 2003. (3) R. Nakaune and M. Nakano. J. Virol. Methods 134:244, 2006. (4) A. M. Shamoul et al. J. Virol. Methods 105:115, 2002.

Download Full-text

First Report of Apricot latent virus and Plum bark necrosis stem pitting-associated virus in Apricot from Spain

Plant Disease ◽

10.1094/pdis-94-2-0275a ◽

2010 ◽

Vol 94 (2) ◽

pp. 275-275 ◽

Cited By ~ 8

Author(s):

A. García-Ibarra ◽

P. Martínez-Gómez ◽

M. Rubio ◽

F. Dicenta ◽

A. Soler ◽

...

Keyword(s):

The United States ◽

Full Length ◽

Latent Virus ◽

Stone Fruit ◽

Pcr Analysis ◽

Rt Pcr ◽

First Report ◽

Cp Gene ◽

Fruit Samples ◽

Stem Pitting

Representing 2% of world production, 20,000 ha of apricot (Prunus armeniaca L.), are cultivated in Spain, primarily in the southeast. A survey was conducted during the spring of 2008 in orchards in the region of Murcia to assess the incidence of several stone fruit viruses. Leaf and fruit samples from 160 trees from 40 orchards were collected randomly for reverse transcription (RT)-PCR analysis. Total RNA extracted (3) from leaves and fruits was tested by a multiplex one-step RT-PCR protocol with a mix of primers that detect eight distinct viruses (4). Amplicons of 250 bp expected for Plum bark necrosis stem pitting-associated virus (PBNSPaV), corresponding to part of the heat shock 70 protein gene, were obtained from four trees and amplicons of 700 bp expected for Apricot latent virus (ApLV), corresponding to part of the coat protein (CP) gene, were obtained from two trees. In all cases, amplicons were obtained using RNA extracted from leaf and fruit tissues. RT-PCR results were confirmed by uniplex RT-PCR with primers specific for each virus and dot-blot hybridization with virus-specific digoxygenin-labeled RNA probes (2). To further characterize the new viruses, we designed primers to amplify specifically the CP gene of ApLV (5′-CCCGACCATGGCTACAAGC-3′ and 5′-TTGCCGTCCCGATTAGGTTG-3′) and the minor CP gene of PBNSPaV (5′-GAACAAACTACAGCAGCACC-3′ and 5′-CAAGGGTAGGACGGGTAACGC-3′). Amplicons of 1,500 and 950 bp corresponding to the ApLV and PBNSPaV CP genes, respectively, were purified from agarose gels and cloned in the pTZ57R plasmid (Fermentas, Burlington, Ontario, Canada). Blastp analysis of the full-length ApLV CP sequence from one infected tree (GenBank Accession No. GQ919051) revealed 86% amino acid (aa) similarity to the single full-length ApLV CP sequence available (No. AAC16234) and 79 and 66.9% similarity to Peach sooty ringspot virus (No. AAG48314) and Apple stem pitting virus (No. NP604468), respectively. Identity/similarity analysis of the full-length PBNSPaV minor CP genes using the Matrix Global Alignment Tool software, version 2.02 (1), revealed 98.8 to 99.6% aa similarity between the Spanish PBNSPaV isolates (Nos. GQ919047, GQ919048, GQ919049, and GQ919050) and 97.1 to 97.4% with the PBNSPaV isolate from the United States (No. EF546442). None of the six infected trees were associated with any particular field symptoms. Five infected trees were cv. Búlida and one was native cv. Murciana, which was infected with ApLV. All infected trees were located in geographically separated orchards. The incidence of ApLV and PBNSPaV was 1.25 and 2.5%, respectively. The low incidence of both viruses together with the scattered geographic distribution could be due to the recent introduction of virus-contaminated plants, although we cannot exclude that it is a consequence of a low dissemination rate. Even though no symptoms were observed, we cannot discard that the infection could affect fruit production or flowering or even cause a synergistic effect in mixed infection with other stone fruit viruses, a risk especially relevant considering the total area of cultivated apricot. To our knowledge, this is the first report of ApLV and PBNSPaV in Spain. References: (1) J. J. Campanella et al. BMC Bioinformatics 4:29, 2003. (2) M. C. Herranz et al. J. Virol. Methods 124:49, 2005. (3) D. J. Mackenzie et al. Plant Dis. 81:222, 1997. (4) J. A. Sánchez-Navarro et al. Eur. J. Plant Pathol. 111:77, 2005.

Download Full-text