An Outbreak of Bacterial Speck Caused by Pseudomonas syringae pv. tomato on Tomato Transplants Grown in Commercial Seedling Companies Located in the Western Mediterranean Region of Turkey

A serious outbreak of a leaf spot disease was observed on tomato transplants grown in commercial seedling companies in southwestern Turkey (Antalya) during the springs of 2002 and 2003. Disease incidence was more severe in the western Mediterranean Region of Turkey. Occurrence of the outbreak resulted in approximately 20 and 25% seedling losses in the springs of 2002 and 2003, respectively. The initial symptoms consisted of pronounced water-soaked, dark brown-to-black spots on young expanding leaves that were 1 to 2 mm in diameter. Later, a number of leaf spots on older leaves enlarged and coalesced, causing leaf desiccation and finally, seedling death. In addition, in 2003 the disease incidence was approximately 5% in 142 commercial greenhouses. Tomato production was unaffected since significant outbreaks did not occur on greenhouse plants. No fruit symptoms were observed. Twenty-six strains were isolated from diseased tomato seedlings and plants from different greenhouses located in different places and all were gram negative and fluorescent on King's B medium. All strains were levan and gelatin liquefaction positive and oxidase and arginine dihydrolase negative. None of the 26 strains utilized erythritol and l-lactate as the sole carbon source (1,2). Fatty acid analysis identified the strains as Pseudomonas syringae pv. tomato with similarity indices ranging from 0.876 to 0.932%. Pathogenicity of the isolates was confirmed on 4-week-old tomato seedlings (cv. Biotek Selin) sprayed with the bacterial suspensions containing 108 CFU/ml of sterile water. Later, a number of leaf spots on the leaves enlarged and coalesced, causing leaf desiccation. Inoculated and control tomato seedlings were covered with polyethylene bags and placed in a growth chamber at 25°C for 48 h and then the bags were removed. Small (1 to 2 mm), water-soaked, dark brown-to-black spots similar to those observed in the greenhouses of commercial seedling companies and commercial greenhouses that produce tomato developed on the young expanding leaves of inoculated plants within 7 to 10 days. No symptoms developed on control plants. The bacterium was reisolated from inoculated plants and identified as a strain of Pseudomonas syringae pv. tomato. Koch's postulates were fulfilled. To our knowledge, this is the first report for the occurrence and outbreak of the bacterial speck disease on tomato transplants in greenhouses of commercial tomato seedling production companies in Turkey. References: (1) D. C. Hildebrand et al. Pages 60–80 in: Laboratory Guide for Identification of Plant Pathogenic Bacteria. N. D. Schaad, ed. The American Phytopathological Society, 1988. (2) J. B. Jones et al. Plant Dis. 70:151, 1986.

Download Full-text

First Report of Bacterial Speck of Tomato Caused by Pseudomonas syringae pv. tomato in Tanzania

Plant Disease ◽

10.1094/pdis-91-4-0462c ◽

2007 ◽

Vol 91 (4) ◽

pp. 462-462 ◽

Cited By ~ 13

Author(s):

K. C. Shenge ◽

R. B. Mabagala ◽

C. N. Mortensen ◽

D. Stephan ◽

K. Wydra

Keyword(s):

Pseudomonas Syringae ◽

Uv Light ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Polymorphism Analysis ◽

Tomato Fruits ◽

First Report ◽

Bacterial Speck ◽

Small Water ◽

Tomato Seedlings

In April 2004, there was a serious outbreak of a tomato (Lypersicon esculentum Mill.) leaf spot disease in Mgeta, Mvomero District of Tanzania. The disease was characterized by lesions on green tomato fruits that were small, sunken, and black and were surrounded by darker green haloes. Lesions on ripe tomato fruits were dark brown to black, superficial, and measured approximately 1 to 2 mm in diameter. On the leaves, lesions were small, black, and surrounded by chlorotic (yellow) haloes. In some cases, the specks coalesced to form large lesions on older leaves. Black lesions were also observed on stems and petioles. A disease survey of selected tomato-producing areas in Arusha, Dodoma, Iringa, and Morogoro regions of Tanzania during 2004 and 2005 revealed that the disease was widespread in farmers' fields in all areas surveyed. Disease incidence was approximately 80%, while severity, rated on the scale of Chambers and Merriman (1), ranged from moderate (11 to 40 lesions per plant) to severe (>40 lesions per plant). A bacterium that produced a greenish, diffusible pigment on King's medium B was consistently isolated from lesions on tomato fruits collected from the fields in all the surveyed areas. All 56 isolates obtained were gram negative, oxidase negative, and fluoresced on King's medium B under UV light. None utilized phenylethylamine as the sole carbon source, while three isolates utilized i-erythritol and lactulose. Biolog analysis of the isolates, along with two reference strains of P. syringae pv. tomato (Pst CEP-3 from Sokoine University of Agriculture, Tanzania and Pst BB6 [Race 1] from Göttinger Sammlung Phytopathogener Bakterien, Göttingen, Germany) identified them as P. syringae pv. tomato, with similarity indices of 0.518 to 0.933. They also were positively identified as P. syringae pv. tomato by repetitive sequence-based-PCR (2,3) and fragment length polymorphism analysis. Pathogenicity of the strains was confirmed by spraying 35-day-old tomato seedlings (cv. Tanya) with suspensions of the isolates at a concentration of 108 CFU ml-1 of sterile water. After approximately 72 h, small, water-soaked, dark brown lesions similar to those observed on the field plants were observed on leaves of all the inoculated tomato seedlings. There were no symptoms on control plants. The bacterium was reisolated from the infected plants and identified as P. syringae pv. tomato, in accordance with Koch's postulates. To our knowledge, this is the first report of the occurrence of tomato bacterial speck in Tanzania. References: (1). S. C. Chambers and P. R. Merriman. Aust. J. Agric. Res. 26:657, 1975. (2). F. J. Louws et al. Appl. Environ. Microbiol. 60:2286, 1994. (3). M. Zaccardelli et al. Eur. J. Plant Pathol. 111:85, 2005.

Download Full-text

First Report of a Leaf Spot Disease of Bells-of-Ireland (Moluccella laevis) Caused by Cercospora apii in California

Plant Disease ◽

10.1094/pdis.2003.87.2.203a ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203

Author(s):

S. T. Koike ◽

S. A. Tjosvold ◽

J. Z. Groenewald ◽

P. W. Crous

Keyword(s):

Leaf Spot ◽

Sequence Data ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Spot Disease ◽

Leaf Spots ◽

Initial Symptoms

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.

Download Full-text

First Report of Alternaria Leaf Blight on Bupleurum chinense Caused by Alternaria alternata in China

Plant Disease ◽

10.1094/pdis-94-7-0918a ◽

2010 ◽

Vol 94 (7) ◽

pp. 918-918

Author(s):

Z. Zhang ◽

J. H. Wei ◽

C. M. Yang ◽

H. Q. Chen ◽

C. Sui ◽

...

Keyword(s):

Disease Incidence ◽

Conidial Suspension ◽

First Report ◽

High Soil Moisture ◽

Leaf Spots ◽

Black Spots ◽

Initial Symptoms ◽

Leaf Tissues ◽

Pathogenicity Tests ◽

Symptomatic Leaf

Bupleurum chinense DC. (family Umbelliferae) is an important medicinal herb in traditional Chinese medicine and is cultivated as an economically important plant in China (2). From 2006 to 2009, severe foliar disease was observed on B. chinense in Haidian, Changping, and Shunyi districts, Beijing, China. Approximately 75 to 85% of fields were affected with disease incidence ranging from 65 to 90%. Distribution of the disease in affected B. chinense fields was generally associated with high soil moisture, often corresponding to poor drainage. Initial symptoms first appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the affected leaflet blade. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. Isolations performed on potato dextrose agar (PDA) initially resulted in white colonies. After 7 days of incubation at 25°C, the colonies turned gray or brown. Conidia varied in size from 10 × 6 to 40 × 12 μm, appeared brown to dark brown or olive-brown, were short beaked and borne in long chains, oval and bean-shaped with one to six transverse septa and zero to three longitudinal septa. Sequences of the rDNA from the internal transcribed spacer regions 1 and 2 and the 5.8S gene were amplified using primers ITS1 and ITS4, were obtained from three isolates, and comparisons with GenBank showed 100% similarity with A. alternata (Genbank Accession No. AB470912.1). For pathogenicity tests, three isolates were grown on PDA for 14 days. Inoculations were performed on detached, surface-sterilized, and healthy B. chinense leaflets following the method of Belisario (1). A 5-μl drop of conidial suspension containing 1 × 105 CFU/ml was placed on each leaflet and 12 leaves per isolate were used. Leaves were incubated in a growth chamber (80 to 90% relative humidity; 50 to 60 klx/m2 light intensity with a 12-h photoperiod). After 5 days, leaf spots similar to the original symptoms developed on all inoculated leaves and A. alternata was consistently reisolated from symptomatic leaf tissues on PDA. Control leaflets inoculated with sterile water remained asymptomatic. The experiment was performed three times. To our knowledge, this is the first report of A. alternata on B. chinense from China. References: (1) A. Belisario et al. Plant Dis. 83:696, 1999. (2) C. Sui et al. Plant Dis. 93:844, 2009.

Download Full-text

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽

10.1094/pdis-03-12-0257-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 418-418 ◽

Cited By ~ 5

Author(s):

M. Gupta ◽

N. Bharat ◽

A. Chauhan ◽

A. Vikram

Keyword(s):

Host Range ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Molecular Techniques ◽

Bacterial Suspension ◽

Leaf Spot Disease ◽

Rrna Gene ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Download Full-text

A New Bacterial Disease on Bluberry (Vaccinium Corymbosum) Caused by Pseudomonas Spp.

Journal of Plant Protection Research ◽

10.2478/jppr-2013-0004 ◽

2013 ◽

Vol 53 (1) ◽

pp. 32-36 ◽

Cited By ~ 2

Author(s):

Monika Kałużna ◽

Joanna Puławska ◽

Beata Meszka

Keyword(s):

Hypersensitivity Reaction ◽

Pseudomonas Syringae ◽

Vaccinium Corymbosum ◽

Leaf Spot Disease ◽

Bacterial Disease ◽

Pseudomonas Spp ◽

Leaf Spots ◽

Pectolytic Activity ◽

Young Leaves ◽

First Time

Abstract In 2011, leaf spot disease was observed on the blueberry (Vaccinium corymbosum) cv. Nelson growing on a commercial field located in Central Poland. The disease symptoms could be seen as russet brown, irregular spots. The diameter of the spots was 0.3-0.5 cm, and the spots often coalesced. From these leaf spots, a fluorescent bacterium was repeatedly isolated in almost pure culture. Polymerase chain reaction (PCR) using primers Ps-for and Ps-rev, specific for Pseudomonas spp. confirmed that they belong to this genus. Based on LOPAT tests [levan production from sucrose (L), presence of oxidase (O), pectolytic activity on potato (P), the presence of arginine dihydrolase (A), hypersensitivity reaction on tobacco (T)], 6 isolates were classified to the LOPAT group Ib - group of Pseudomonas syringae subsp. savastanoi and Pseudomonas delphini, and one isolate to group Ia - P. syringae. All isolates caused a hypersensitivity reaction on tobacco plants, and symptoms similar to those under natural conditions, when young leaves of blueberry cv. Nelson were inoculated. Sequence analysis of 16S rRNA and rpoB genes showed the highest similarity of 6 studied strains to the species P. avellanae. Further taxonomic study is necessary to enable definitive classification of these isolates. It is the first time that a bacterial disease caused by the Pseudomonas spp. was observed in Poland.

Download Full-text

First Report of a Leaf Spot on Snow Lotus Caused by Alternaria carthami in China

Plant Disease ◽

10.1094/pdis-92-2-0318b ◽

2008 ◽

Vol 92 (2) ◽

pp. 318-318

Author(s):

S. Zhao ◽

G. Xie ◽

H. Zhao ◽

H. Li ◽

C. Li

Keyword(s):

Leaf Spot ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Tianshan Mountain ◽

Causal Organism ◽

Saussurea Involucrata ◽

First Report ◽

Spot Disease ◽

Initial Symptoms ◽

Snow Lotus

Snow lotus (Saussurea involucrata Karel. & Kir. ex Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. In June of 2005, a leaf spot disease on commercially grown plants was found in the QiTai Region, south of the Tianshan Mountain area of Xinjiang, China at 2,100 m above sea level. Disease incidence was approximately 60 to 70% of the plants during the 2006 and 2007 growing seasons. Initial symptoms appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the leaflet blade by July. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. A fungus was consistently isolated from the margins of these lesions on potato dextrose agar. Fifty-eight isolates were obtained that produced abundant conidia in the dark. Conidia were usually solitary, rarely in chains of two, ellipsoid to obclavate, with 6 to 11 transverse and one longitudinal or oblique septum. Conidia measured 60 to 80 × 20 to 30 μm, including a filamentous beak (13 to 47 × 3.5 to 6 μm). According to the morphology, and when compared with the standard reference strains, the causal organism of leaf spot of snow lotus was identified as Alternaria carthami (1,4). Pathogenicity of the strains was tested on snow lotus seedlings at the six-leaf stage. The lower leaves of 20 plants were sprayed until runoff with conidial suspensions of 1 × 104 spores mL–1, and five plants sprayed with sterile distilled water served as controls. All plants were covered with a polyethylene bag, incubated at 25°C for 2 days, and subsequently transferred to a growth chamber at 25°C with a 16-h photoperiod. Light brown lesions developed within 10 days on leaflet margins in all inoculated plants. The pathogen was reisolated from inoculated leaves, and isolates were deposited at the Key Oasis Eco-agriculture Laboratory of Xinjiang Production and Construction Group, Xinjiang and the Institute of Biotechnology, Zhejiang University. No reports of a spot disease caused by A. carthami on snow lotus leaves have been found, although this pathogen has been reported on safflower in western Canada (3), Australia (2), India (1), and China (4). To our knowledge, this is the first report of a leaf spot caused by A. carthami on snow lotus in China. References: (1) S. Chowdhury. J. Indian Bot. Soc. 23:59, 1944. (2) J. A. G. Irwin. Aust. J. Exp. Agric. Anim. Husb. 16:921, 1976. (3) G. A. Petrie. Can. Plant Dis. Surv. 54:155, 1974. (4) T. Y. Zhang. J. Yunnan Agric. Univ.17:320, 2002.

Download Full-text

First Report of Bacterial Leaf Spot of Spinach Caused by a Pseudomonas syringae Pathovar in California

Plant Disease ◽

10.1094/pdis.2002.86.8.921a ◽

2002 ◽

Vol 86 (8) ◽

pp. 921-921 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

H. R. Azad ◽

D. C. Cooksey

Keyword(s):

Brassica Oleracea ◽

Beta Vulgaris ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

The United States ◽

Nutrient Broth ◽

Bacterial Leaf Spot ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

In 2000 and 2001, a new disease was observed on commercial spinach (Spinacia oleracea) in the Salinas Valley, Monterey County, CA. Initial symptoms were water-soaked, irregularly shaped leaf spots (2 to 3 mm diameter). As the disease developed, spots enlarged to as much as 1 to 2 cm, were vein-delimited, and turned dark brown. Faint chlorotic halos sometimes surrounded the spots. Death of large areas of the leaf occurred if spots coalesced. Spots were visible from the adaxial and abaxial sides of leaves, and no fungal structures were observed. The disease occurred on newly expanded and mature foliage. No fungi were isolated from the spots. However, cream-colored bacterial colonies were consistently isolated on sucrose peptone agar, and these strains were nonfluorescent on King's medium B. Strains were positive for levan and negative for oxidase, arginine dihydrolase, and nitrate reductase. Strains did not grow at 36°C, did not rot potato slices, but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Turk). These results suggested the bacterium was similar to Pseudomonas syringae. Fatty acid methyl ester (FAME) analysis (MIS-TSBA 4.10, MIDI Inc., Newark, DE) indicated the strains were highly similar (80.1 to 89.3%) to P. syringae pv. maculicola. However, in contrast to P. syringae pv. maculicola, the spinach strains did not utilize the carbon sources erythritol, L+tartrate, L lactate, and DL-homoserine. Pathogenicity of 10 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying 4-week-old plants of spinach cv. Bossanova. Control plants were sprayed with sterile nutrient broth. After 5 to 8 days in a greenhouse (24 to 26°C), leaf spots identical to those observed in the field developed on cotyledons and true leaves of inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. The 10 strains were also inoculated on beet (Beta vulgaris), Swiss chard (Beta vulgaris subsp. cicla), cilantro (Coriandrum sativum), and spinach. Spinach showed leaf spots after 8 days; however, none of the other plants developed symptoms. Two strains were inoculated onto spinach cvs. Califlay, Lion, Nordic IV, Polka, Resistoflay, Rushmore, RZ 11, Spinnaker, Springfield, Viroflay, and Whitney. Leaf spot developed on all cultivars, and the pathogen was reisolated. Because the FAME data indicated a similarity between the spinach pathogen and P. syringae pv. maculicola, we inoculated sets of spinach cv. Bolero, cabbage (Brassica oleracea subsp. capitata cv. Grenedere), and cauliflower (Brassica oleracea subsp. botrytis cv. White Rock) with three P. syringae pv. maculicola and three spinach strains. Cabbage and cauliflower developed leaf spots only when inoculated with P. syringae pv. maculicola; spinach had leaf spots only when inoculated with the spinach strains. All inoculation experiments were done twice, and the results of the two tests were the same. To our knowledge, this is the first report of bacterial leaf spot of spinach in California caused by a nonfluorescent P. syringae, and the first record of this disease in the United States. Biochemical characteristics and limited host range of the pathogen indicate the California strains are likely the same as the P. syringae pv. spinaciae pathogen that was reported in Italy (1) and Japan (2). References: (1) C. Bazzi et al. Phytopathol. Mediterr. 27:103, 1988. (2) K. Ozaki et al. Ann. Phytopathol. Soc. Jpn. 64:264, 1998.

Download Full-text

First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China

Plant Disease ◽

10.1094/pdis-10-21-2158-pdn ◽

2021 ◽

Author(s):

Dayu Lan ◽

Fangling Shu ◽

Yanhui Lu ◽

Anfa Shou ◽

Wei Lin ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Pseudomonas Cichorii ◽

Koch’S Postulates ◽

First Report ◽

Initial Symptoms ◽

Wide Range ◽

Koch's Postulates

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

Download Full-text

A New Bacterial Leaf Spot Disease of Broccolini, Caused by Pseudomonas syringae pathovar maculicola, in California

Plant Disease ◽

10.1094/pdis.2001.85.11.1207a ◽

2001 ◽

Vol 85 (11) ◽

pp. 1207-1207 ◽

Cited By ~ 6

Author(s):

N. A. Cintas ◽

C. T. Bull ◽

S. T. Koike ◽

H. Bouzar

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Similarity Index ◽

Acid Methyl Ester ◽

Hypersensitive Reaction ◽

Nutrient Broth ◽

Leaf Spot Disease ◽

Fluorescent Pseudomonad ◽

Bacterial Leaf Spot ◽

Initial Symptoms

In 1998, a new disease was detected on 3-week-old commercial broccolini (Brassica oleracea L. var. botrytis × B. alboglabra) transplants in a Salinas Valley, Monterey County, CA greenhouse. Initial symptoms were small (2 to 4 mm diameter) circular to angular, water-soaked spots. As the disease progressed, spots remained relatively small, but turned tan to brown. When diseased tissues were macerated and streaked on King's medium B, a blue-green fluorescent pseudomonad was consistently isolated. Strains were levan positive, oxidase negative, and arginine dihydrolase negative. Strains did not rot potato slices, but induced a hypersensitive reaction on tobacco (Nicotiana tabacum L. ‘Turk’). Fatty acid methyl ester analysis (MIS-TSBA, version 4.10, MIDI Inc., Newark, DE) indicated that strains had a high similarity index (0.82 or higher) to Pseudomonas syringae, and GN (version 3.50, Biolog, Inc., Hayward, CA) profiles also identified strains as P. syringae. The bacterium associated with the disease, therefore, was identified as P. syringae van Hall. Pathogenicity was demonstrated by growing inoculum in nutrient broth shake cultures for 48 h, misting the broth cultures (1×106 CFU/ml) onto broccolini (cv. Aspabrock), and subjecting the plants to 48 h of high humidity. Control plants were misted with sterile nutrient broth. After 4 to 5 days in a greenhouse, leaf spot symptoms developed on all inoculated broccolini plants, and reisolated strains were characterized and found to be P. syringae. Control plants remained symptomless. The results of two sets of pathogenicity tests were the same. Repetitive sequence-based polymerase chain reaction using the BOXA1R primer resulted in identical banding patterns for the broccolini pathogen and for known isolates of P. syringae pv. maculicola from crucifers. In host range testing, P. syringae pv. maculicolawas pathogenic to broccolini plants. The broccolini isolates and P. syringae pv. maculicola isolates had the same pathogenicity results when crucifers and tomatoes were tested as hosts; broccoli and cauliflower (B. oleracea var. botrytis) were infected, and tomato results were variable. These tests suggest that the broccolini pathogen is the bacterial leaf spot pathogen, Pseudomonas syringae pv. maculicola, that occurs on broccoli and cauliflower transplants (1). To our knowledge, this is the first report of this pathogen causing a disease on commercially grown broccolini. Reference: (1) S. T. Koike et al. Plant Dis. 82:727, 1998.

Download Full-text

Alternaria alternata as a Seed-Transmitted Pathogen of Sida hermaphrodita (Malvaceae) and Its Suppression by Aureobasidium pullulans

Agriculture ◽

10.3390/agriculture11121264 ◽

2021 ◽

Vol 11 (12) ◽

pp. 1264

Author(s):

Urszula Wachowska ◽

Edyta Kwiatkowska ◽

Wioletta Pluskota

Keyword(s):

Alternaria Alternata ◽

Aureobasidium Pullulans ◽

Pathogen Transmission ◽

Greenhouse Experiment ◽

Energy Crop ◽

Leaf Spot Disease ◽

Black Spots ◽

Initial Symptoms ◽

Detached Leaves ◽

Negative Effect

Background: Sida hermaphrodita (Virginia fanpetals) was introduced to Poland nearly 70 years ago as a potential fodder plant, and it is gaining importance as an energy crop. Alternaria alternata transmitted by seeds may exert a negative effect on the health of Virginia fanpetals plants. Methods: The virulence of the A. alternata pathogen, isolated from Virginia fanpetals seeds, was tested on detached leaves of Virginia fanpetals plants. The isolates were identified as A. alternata based on partial sequence analysis of Alta1, TEF1a and gdp genes and the ITS 1–5.8SrDNA–ITS 2 region. Pathogen transmission from seeds to seedlings and the influence of seed dressing with a suspension of Aureobasidium pullulans on seedling health were analyzed in a greenhouse experiment. Results: Three of the nine analyzed A. alternata isolates were highly pathogenic for S. hermaphrodita. The initial symptoms of leaf infection were small, round dark brown or black spots which grew into larger dark brown spots surrounded by a chlorotic halo. Alternaria alternata was re-isolated from inoculated plants and was identified as the causal agent of Alternaria leaf spot disease. In the greenhouse experiment, S. hermaphrodita seeds dressed with a suspension of A. pullulans and inoculated with A. alternata produced a higher number of seedlings with a higher health status than non-dressed seeds. Conclusions: The study demonstrated that A. alternata is transmitted from infected S. hermaphrodita seeds to developing plants and biological control limits this phenomenon.

Download Full-text