scholarly journals First Report of Stem and Bulb Nematode Ditylenchus dipsaci on Garlic in New Mexico

2017 ◽  
Vol 18 (2) ◽  
pp. 91-92
Author(s):  
Jason M. French ◽  
Jacki Beacham ◽  
Amanda Garcia ◽  
Natalie P. Goldberg ◽  
Stephen H. Thomas ◽  
...  
Keyword(s):  
International Trade ◽  
New Mexico ◽  
Sequence Data ◽  
The State ◽  
Economic Losses ◽  
First Report ◽  
Important Pest ◽  
Ditylenchus Dipsaci ◽  
Production Areas ◽  
Stem And Bulb Nematode

Taken together, symptoms present, microscopic characterization, and ITS-1 sequence data indicate New Mexico garlic samples infested with Ditylenchus dipsaci, making this the first known report of this pest in the state. This discovery is significant because D. dipsaci can be a persistent pest and has the potential to cause significant economic losses on agronomically important hosts including onion, garlic, and alfalfa. Its longevity in the soil and international trade issues will be concerns for producers. Monitoring of production areas in the region will be performed to determine if this was an isolated and contained introduction or if this important pest has become established in New Mexico.

scholarly journals First Report of Little cherry virus 2 in Flowering and Sweet Cherry Trees in China

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1484-1484 ◽  
Author(s):  
W.-L. Rao ◽  
F. Li ◽  
R.-J. Zuo ◽  
R. Li
Keyword(s):  
Sweet Cherry ◽  
Sequence Data ◽  
Community Gardens ◽  
Economic Losses ◽  
Helicase Domain ◽  
Rt Pcr ◽  
Viral Origin ◽  
First Report ◽  
Flowering Cherry ◽  
Cherry Trees

Many viruses infect Prunus spp. and cause diseases on them. During a survey of stone fruit trees in 2008 and 2009, flowering cherry (Prunus serrulata) and sweet cherry (P. avium) trees with foliar chlorosis and reddening, stem deformity, and tree stunting were observed in private orchards in Anning and Fumin counties of Yunnan Province. Some sweet cherry trees with severe symptoms yielded small and few fruits and had to be removed. Leaf samples were collected from 68 flowering cherry and 30 sweet cherry trees, either symptomatic or asymptomatic, from private orchards and community gardens in Kunming and counties Anning, Chenggong, Fumin, Jinning, Ludian and Yiliang. Total nucleic acids were extracted with a CTAB extraction method and tested by reverse transcription (RT)-PCR assay using virus-specific primers. Little cherry virus 2 (LChV-2), Cherry virus A (CVA), Prunus necrotic ringspot virus (PNRSV), and Prune dwarf virus (PDV) were detected and infection rates were 68.4, 16.3, 9.2, and 7.1%, respectively. Infection of LChV-2 was common in all counties except Ludian where the orchards were healthy. Of 68 infected trees, 29 were found to be infected with LChV-2 and CVA, PDV or PNRSV. LChV-2 was detected in this study by RT-PCR using a pair of novel primers, LCV2-1 (5′-TTCAATATGAGCAGTGTTCCTAAC-3′) and LCV2-4 (5′-ACTCGTCTTGTGACATACCAGTC-3′), in 59 flowering cherry (87%) and 8 sweet cherry (27%) trees, respectively. The primer pair was designed according to alignment of three available LChV-2 sequences (GenBank Nos. NC_005065, AF416335, and AF333237) to amplify the partial RNA-dependent RNA polymerase gene (ORF1b) of 781 bp. The amplicons of selected samples (Anning26 and Yiliang60) were sequenced directly and sequences of 651 bp (GenBank No. HQ412772) were obtained from both samples. Pairwise comparisons and phylogenetic analysis of the sequences show that the two isolates are identical to one another and share 92 to 96% at the amino acid (aa) sequence level to those of other isolates available in the GenBank database. The sequence data confirm that these isolates are a strain of LChV-2 and genetic variation among different strains is relatively high (2). Biological and serological assays are not available for the LChV-2 detection; therefore, the LChV-2 infections of these trees were further confirmed by RT-PCR using primer pair LCV2-5 (5′-TGTTTGTGTCATGTTGTCGGAGAAG-3′) and LCV2-6 (5′-TGAATACCCGAGAACAAGGACTC-3′), which amplified the helicase domain (ORF1a) of ~451 bp. The amplicons from samples Anning26 and Yiliang60 were cloned and sequenced. The 408-bp sequences (excluding primer sequences) were 92 to 98% identical at the aa sequence level to those of other isolates, confirming again their viral origin. LChV-2 (genus Ampelovirus, family Closteroviridae) (4) has been associated with little cherry disease (LChD), a widespread viral disease of sweet and sour cherries (1,3). The virus is transferred between geographic areas mainly by propagated materials. Ornamental and sweet cherries are important crops in China and LChD has the potential to cause significant economic losses. Thus, certified clean stock should be used to establish new orchards. To our knowledge, this is the first report of LChV-2 in cherries in China. References: (1) N. B. Bajet et al. Plant Dis. 92:234, 2008. (2) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (3) B. Komorowska and M. Cieslińska, Plant Dis. 92:1366, 2008. (4) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005.

scholarly journals First Report of Anthracnose of Sunflower Sprouts Caused by Colletotrichum acutatum in New Mexico

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 838-838
Author(s):  
J. M. French ◽  
J. J. Randall ◽  
R. A. Stamler ◽  
A. C. Segura ◽  
N. P. Goldberg
Keyword(s):  
New Mexico ◽  
Sequence Analysis ◽  
The United States ◽  
Disease Diagnosis ◽  
Colletotrichum Acutatum ◽  
Economic Losses ◽  
Distilled Water ◽  
Koch’S Postulates ◽  
First Report ◽  
Koch's Postulates

In December 2011, edible sunflower sprouts (Helianthus annus) of two different commercially grown cultivars (Sungrown and Tiensvold) exhibiting stem and cotyledon lesions were submitted to the New Mexico State University Plant Clinic for disease diagnosis. The sample originated from an organic farm in Santa Fe County where the grower utilizes a small indoor growing facility. Stem lesions were elongate, reddish brown, and often constricted, resulting in stem girdling. Lesions on the cotyledons were dark brown with tan centers and round to irregular in shape. In some cases, the entire cotyledon was blighted. Fungal hyphae were observed on some lesions using a dissecting microscope. Colletotrichum acutatum was isolated from stem and cotyledon lesions when symptomatic tissue was plated on water agar. Conidia were fusiform ranging from 6.4 to 18.4 μm long and 2.1 to 5.1 μm wide and averaged 11.9 μm × 3.4 μm. Spores were measured from cream-colored colonies produced on acidified potato dextrose agar. PCR amplification and sequence analysis of 5.8S ribosomal DNA and internal transcribed spacers I and II was performed using primers ITS4 and ITS6 (2). An amplification product of approximately 600 base pairs in size was directly sequenced (GenBank Accession No. JX444690). A BLAST search of the NCBI total nucleotide collection revealed a 99% identity to multiple C. acutatum (syn: C. simmondsii) isolates. Four isolates were identified as C. acutatum based on morphological characteristics and DNA analysis. Koch's postulates were performed using four isolates of the pathogen and the two commercial sunflower cultivars (Sungrown and Tiensvold) originally submitted for disease analysis. Sunflower seeds were imbibed in distilled water for 24 h then sewn into peat plugs. Prior to seed germination, 5 ml of a C. acutatum spore solution (1 × 106/ml) from each isolate was applied to five peat plugs using an atomizer. Control plants were inoculated with distilled water and otherwise treated identically. Both sunflower cultivars were inoculated with each isolate of the pathogen and the test was replicated twice. The sewn peat plugs were incubated for 5 days at 21°C and 50% relative humidity. Symptoms similar to the original samples were present on 100% of the sprouts after 5 days. PCR and sequence analysis performed on cultures obtained from lesions showed a 100% match to the original New Mexico isolates fulfilling Koch's postulates. In an indoor organic facility, such as the one in NM, this disease has the potential to be very difficult to manage and the potential to infect a high percentage of the crop resulting in significant economic losses. To our knowledge, this is the second report of C. acutatum on sunflower sprouts in the United States (1) and the first report in New Mexico. References: (1) S. T. Koike et al. Plant Dis. 93:1351, 2009. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.

scholarly journals First Report of Colletotrichum higginsianum Causing Anthracnose of Arugula (Eruca sativa) in Florida

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1269-1269 ◽  
Author(s):  
J. S. Patel ◽  
M. I. Costa de Novaes ◽  
S. Zhang
Keyword(s):  
Sequence Data ◽  
Morphological Characteristics ◽  
Its Region ◽  
The United States ◽  
Economic Losses ◽  
Infected Leaf ◽  
Eruca Sativa ◽  
First Report ◽  
Small Water ◽  
Colletotrichum Higginsianum

Arugula (Eruca sativa) is grown in Florida and is an important component in packaged salad products. During spring 2013, leaf lesions on arugula caused significant economic losses in Miami-Dade County, Florida. Symptoms initially appeared as small water-soaked lesions that later became circular, sunken, and white in the center with a dark brown to black halo, up to 4 mm in diameter. Acervuli were found under a dissecting microscope on infected leaf lesions with black spines or setae. Occasionally, small, circular, often longitudinal dark brown spots appeared on leaf branches. Leaf tissues (5 × 5 mm) from lesion margins were surface sterilized in 0.9% sodium hypochlorite for 10 min, rinsed with sterile distilled water, and plated on potato dextrose agar (PDA). PDA plates were incubated at 21°C under 24-h fluorescent lights for 4 to 6 days. The fungus initially produced gray mycelium followed by orange conidial mass. Hyphae of the fungus were septate and hyaline. After 5 to 7 days, the fungus produced acervuli with dark brown to black setae (75 to 130 μm long) (n = 20). Conidia were found in the colonies, which were single celled, oblong, hyaline, and 12 to 25 × 4 to 6 μm (n = 20). The cultural and morphological characteristics of the conidia were similar to those for Colletotrichum higginsianum Sacc (1). To further confirm the species of the isolates, the sequence of the ITS region of rDNA, chitin synthase 1 (CHS1), and actin (ACT) was amplified from isolates 05131 and 05132 using primer pairs ITS 1 and ITS 4 (4), CHS-79F and CHS-354R, and ACT-512F and ACT-783R (3), respectively. The sequenced data of each locus were deposited in GenBank with accessions KF550281.1, KF550282.1, KJ159904, KJ159905, KJ159906, and KJ159907. The resulting sequence of ITS showed 100% identity with sequences of C. higginsianum in JQ005760.1, and sequence of ACT gene showed 100% identity with C. higginsianum in JQ005823.1. The sequence of ACT gene and ITS region had ≤99% identity with other closely related Colletotrichum spp. CHS1 gene had 100% identity with JQ005781.1 belonging to C. higginsianum, and one accession JQ005783.1 belonging to C. fuscum. However, ACT gene and ITS region does not share 100% identity with C. fuscum and therefore, sequence data from three loci proves that isolated pathogen is C. higginsianum. All the above mentioned accessions that shared 100% identity with sequences of isolates used in our study have been previously used to represent the species in the C. destructivum clade in a systematics study (2). To confirm its pathogenicity, a suspension of isolate 05132 at 5 × 105 conidia/ml was sprayed on leaves of five arugula plants until runoff. The other five arugula plants sprayed with water served as non-inoculated controls. Both inoculated and non-inoculated plants were separately covered with a plastic bag to maintain high humidity for 24 h at 27 ± 5°C under natural day/night conditions in the greenhouse. Symptoms first appeared 3 to 4 days after inoculation as small water-soaked lesions, which became sunken with dark brown to black margins. Small circular and longitudinal dark brown spots were also seen on leaf branches as seen initially on naturally infected arugula. No symptoms developed on non-inoculated control plants. C. higginsianum was re-isolated from the lesions with the same morphological characteristics as described above, fulfilling Koch's postulates. To our knowledge, this is the first report of C. higginsianum causing anthracnose of arugula in Florida. This pathogen may potentially affect the salad industry in the United States. References: (1) A. J. Caesar et al. Plant Dis. 94:1166, 2010. (2) P. F. Cannon et al. Stud. Mycol. 73:181, 2012. (3) I. Carbone and L. M. Kohn. Mycologia 91:553, 1999. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

scholarly journals First Report of Potato mop top virus Causing Potato Tuber Necrosis in Colorado and New Mexico

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 164-164 ◽  
Author(s):  
I. Mallik ◽  
N. C. Gudmestad
Keyword(s):  
New Mexico ◽  
North Dakota ◽  
Consensus Sequence ◽  
The United States ◽  
Economic Losses ◽  
Acid Extraction ◽  
Rt Pcr ◽  
First Report ◽  
Tuber Necrosis ◽  
Potato Mop Top Virus

Potato mop top virus (PMTV) is considered the type member of the genus Pomovirus. PMTV is an important pathogen of potato vectored by the plasmodiophorid Spongospora subterranea f. sp. subterranea (Sss), which causes powdery scab of potato (1). Sss and PMTV are usually associated with cool and humid environments. PMTV-infected potato tubers generally exhibit internal hollow necrotic spots or concentric rings, and the virus is known to cause significant economic losses in Northern Europe, North and South America, and Asia (4). PMTV in the United States was first reported in Maine (2). Potato (Solanum tuberosum L.) tubers cv. FL2048 and cv. Atlantic were sent to our laboratory from fields in Saguache County in Colorado and in San Juan County in New Mexico, respectively, during the spring of 2013. The tubers from both locations had multiple, internal, concentric, necrotic arcs and circles. Internal tissue with necrotic lesion from six symptomatic tubers from each location were crushed in liquid nitrogen followed by ribonucleic acid extraction using a Total RNA Isolation kit (Promega Corp., Madison, WI). These extracts were tested by reverse transcription (RT)-PCR using three different sets of previously published primers for molecular detection of PMTV. The primer set H360/C819 targeting the coat protein (CP) on RNA 3 of PMTV yielded an amplicon (H360-CO and H360-NM) of 460 bp (4). The second set of primers, pmtF4/pmtR4 (5), amplified a 417-bp product (PMTF-CO and PMTF-NM) in RNA 2, and the third set, PMTV-P9/PMTV-M9 (3), designed to amplify the region encoding an 8-KD cysteine-rich protein in RNA 3 of PMTV, yielded a 507-bp amplicon (PMTV9-CO and PMTV9-NM). The amplicons generated from RT-PCR using all three sets were cloned (PGEMT-easy) and sequenced. Since the sequences from symptomatic tuber extracts from each location were identical to their respective primer sets, a consensus sequence from each primer set was submitted to National Center for Biotechnology Information (NCBI) GenBank. Sequences obtained from the H360/C819 primer set (GenBank Accession Nos. KM207013 and KM207014 for H360-CO and H360-NM, respectively) were 100% identical to the corresponding CP regions of PMTV isolates from North Dakota (HM776172). Sequences from the pmtF4/pmtR4 primer set (KM207015 and KM207016 for PMTF-CO and PMTF-NM, respectively) were 100% identical to the corresponding protein in RNA2 of PMTV isolates from North Dakota (GenBank HM776171), and sequences from the PMTV-P9/PMTV-M9 primer set (KM207017 and KM207018 for PMTV9-CO and PMTV9-NM respectively) were 99% identical to the corresponding protein in RNA3 of PMTV isolates (AY187010). The 100-99% homology of the sequences from this study to the corresponding PMTV sequences published in NCBI confirmed the occurrence of symptoms in the tubers from both Colorado and New Mexico due to PMTV. None of the symptomatic tubers tested positive for Tobacco rattle virus, Tomato spotted wilt virus, Alfalfa mosaic virus, Potato leafroll virus, or the necrotic strains of Potato virus Y by RT-PCR. To our knowledge, this is the first report of PMTV in potato in states of Colorado and New Mexico. References: (1) R. A. C. Jones and B. D. Harrsion. Ann. Appl. Biol. 63:1, 1969. (2) D. H. Lambert et al. Plant Dis. 87:872, 2003. (3) T. Nakayama et al. Am. J. Pot. Res. 87:218, 2010. (4) J. Santala et al. Ann. Appl. Biol. Online publication. DOI: 10.1111/j.1744-7348.2010.00423.x (5) H. Xu et al. Plant Dis. 88:363, 2004.

scholarly journals First Report of Septoria Leaf Spot of Pistachio in New Mexico

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 762-762
Author(s):  
J. M. French ◽  
R. J. Heerema ◽  
E. A. Gordon ◽  
N. P. Goldberg
Keyword(s):  
New Mexico ◽  
Leaf Spot ◽  
Morphological Characteristics ◽  
The United States ◽  
The State ◽  
Department Of Agriculture ◽  
Widespread Occurrence ◽  
Agricultural Industry ◽  
First Report ◽  
Septoria Leaf Spot

In September of 2008, a Septoria sp., the causal agent of Septoria leaf spot of pistachio (Pistacia vera L.) was isolated from leaf lesions in an orchard in southern New Mexico. Tree fruit and nut crops including pistachios are becoming an increasingly important part of New Mexico's agricultural industry with total cash receipts of $103 million in 2007 (3). This preliminary positive for Septoria prompted a survey of pistachio-growing counties in the state. The surveyed orchards accounted for approximately 30% of the pistachio acreage in New Mexico. Results indicated that all five pistachio-growing counties had orchards infected with a Septoria sp. Isolates of Septoria from leaf lesions were identified as Septoria pistaciarum Caracc. based on the following symptoms and morphological characteristics of the fungus: leaf lesions were usually circular, 0.5 to 3 mm in diameter, and contained many pycnidia per lesion; pycnidia were dark, ostiolate, and measured 101 to 255 × 69 to 133 μm; and conidia were hyaline, filiform, contained 3 to 9 septa, and measured 3 to 4 × 60 to 149 μm. Most orchards were only mildly affected. In severe cases, hundreds of leaf lesions were present on diseased leaves; large sections of the leaves turned tan and some trees defoliated prematurely. This widespread occurrence of Septoria leaf spot in New Mexico in 2008 suggests that the disease had already been present in the state for several years. A higher average rainfall in the summer of 2008 provided excellent conditions for disease development. Because of the high amounts of inoculum currently present in New Mexico orchards, Septoria leaf spot may emerge as a recurring disease problem for pistachio producers. This disease was first reported in the United States in Texas in 1971 and was also reported in Arizona in 1989 (1,2,4). To our knowledge, this is the first report of Septoria leaf spot of pistachio in New Mexico. References: (1) A. Chitzandis. Ann. Inst. Phytopathol. Benaki 10:29, 1956. (2) J. L. Maas et al. Plant Dis. Rep. 55:72, 1971. (3) New Mexico Agricultural Statistics, Department of Agriculture, 2007. (4) D. J. Young and T. Michailides. Plant Dis. 73:775, 1989.

scholarly journals First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
M. C. Cebrián ◽  
C. Córdoba-Sellés ◽  
J. A. Herrera-Vásquez ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Sequence Data ◽  
Triple Gene Block ◽  
Economic Losses ◽  
Sequence Information ◽  
Specific Primers ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Gene Block

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

scholarly journals First Report of Tomato chlorosis virus in Tomato from Hungary

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 363-363 ◽  
Author(s):  
G. Bese ◽  
K. Bóka ◽  
L. Krizbai ◽  
A. Takács
Keyword(s):  
Electron Microscopy ◽  
Sequence Data ◽  
Trialeurodes Vaporariorum ◽  
Economic Losses ◽  
Cdna Synthesis ◽  
Specific Primers ◽  
First Report ◽  
Reverse Transcription Pcr ◽  
Pcr Product ◽  
Tomato Chlorosis Virus

A disease of tomato (Lycopersicon esculentum Mill.) was observed in three greenhouses in Tömörkény in southern Hungary in the autumn of 2007. Thirty percent of the plants were chlorotic and stunted and had mottled leaves with interveinal yellowing and necrosis. Similar symptoms induced by Tomato chlorosis virus (ToCV) on tomato have been reported in other countries (1,2). ToCV is a Crinivirus in the Closteroviridae family, which can cause a decline in plant vigor and reduced fruit yield. ToCV is transmitted by whiteflies (Trialeurodes vaporariorum West., T. abutilonea Hald., and Bemisia tabaci Genn.) and grafting, but cannot be transmitted mechanically. Only T. vaporariorum is known to be present and widespread in Hungary. Virus presence was confirmed by reverse transcription-PCR as described by Louro et al. (2). cDNA synthesis with ToCV specific primers (ToCV-UP 5′-TCATTAAAACTCAATGGGACCGAG-3′ (3) and ToCV-DW 5′-GCGACGTAAATTGAAACCC-3′) was successful and electron microscopy revealed ToCV-like particles. The PCR product has been sequenced (GenBank Accession No. HQ444266) and showed 97 to 99% identity to ToCV isolates in GenBank. According to the symptoms, amplified region, sequence data, and electron microscopy, the tomato samples from Tömörkény were confirmed to be infected with ToCV. The economic losses associated with ToCV were minor. To our knowledge, this is the first report on the occurrence of ToCV in Hungary. References: (1) G. P. Accotto et al. Plant Dis. 85:1208, 2001. (2) D. Louro et al. Eur. J. Plant Pathol. 106:589, 2000 (3) J. Th. J. Verhoven et al. Plant Dis. 87:872, 2003.

scholarly journals First Report of Paulownia Witches'-Broom Phytoplasma in China

Plant Disease ◽  
2008 ◽  
Vol 92 (7) ◽  
pp. 1134-1134 ◽  
Author(s):  
H. N. Yue ◽  
Y. F. Wu ◽  
Y. Z. Shi ◽  
K. K. Wu ◽  
Y. R. Li
Keyword(s):  
16S Rdna ◽  
Sequence Data ◽  
Rflp Analysis ◽  
Shaanxi Province ◽  
Economic Losses ◽  
Rrna Gene ◽  
First Report ◽  
Ctab Method ◽  
Phytoplasma Infection ◽  
Total Dna

Paulownia witches'-broom (PaWB) is one of the most important diseases affecting Paulownia tomentosa trees in China. According to 2006 statistics, the disease has affected 880,000 ha of trees for timber production causing billions of dollars in economic losses. During the spring and summer of 2006, a survey was done in Shaanxi Province to confirm phytoplasma infection of paulownia trees exhibiting symptoms of witches'-broom, stunting, yellowing, and proliferating secondary shoots. Foliage samples were collected from 24 symptomatic and 8 symptomless paulownia plants in eight different production fields. Total DNA was extracted from 0.5 g of leaf midrib and stem phloem tissue with a modified cetyltrimethylammoniumbromide (CTAB) method (3). Resulting DNA extracts were analyzed by a nested PCR assay using phytoplasma 16S rRNA gene primer pairs R16mF2/R16mR1 followed by R16F2n/ R16R2 (1), which amplified a 1.4-kb and a 1.2-kb product, respectively, from symptomatic plants. Restriction fragment length polymorphism (RFLP) analysis of the nested 1.2-kb 16S rDNA products with AluI, MseI, HhaI, HpaI, RsaI, BfaI, HinfI, and TaqI endonuclease (2) indicated that all symptomatic plants were infected by a phytoplasma belonging to aster yellows group (16SrI) subgroup D (16SrI-D) phytoplasma strains. A 1.2-kb 16S rDNA sequence (GenBank Accession No. DQ851169) derived from representative strain PaWB-Shaanxi was identical (100%) to that of PaWB phytoplasma (L27033), a known subgroup 16SrI-D strain from Taiwan (2). The agreement between the RFLP analysis and sequence data confirms that PaWB from Shaanxi is a member of subgroup 16SrI-D. To our knowledge, this is the first report of PaWB disease being present in China and of its association with the 16SrI-D subgroup. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) I.-M. Lee et al. Inst. J. Syst. Bacteriol. 48:1153, 1998. (3) Y. Qi et al. Biotechnol. Bull. 4:44, 2004.

scholarly journals First Report of Recombinant Potato virus Y Strains in Potato in Jalisco, Mexico

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 430-430 ◽  
Author(s):  
A. Quintero-Ferrer ◽  
A. V. Karasev
Keyword(s):  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
Potato Production ◽  
The State ◽  
Rt Pcr ◽  
First Report ◽  
Fta Cards ◽  
The One ◽  
Production Areas

Potato virus Y (PVY) is a serious problem for potato production worldwide. The virus reduces both tuber yield and quality, and recent spread of recombinant strains of PVY in potato production areas is largely credited with the spread of potato tuber necrotic ringspot disease (PTNRD) (1). In Mexico, recombinant strains of PVY were reported in at least two states, Chihuahua (4) and the State of Mexico (3); however, no surveys have been conducted in other potato-producing areas, and the spectrum of PVY isolates circulating in the country has remained uncharacterized. In October 2011, a small-scale survey of seed potato was conducted in the state of Jalisco, Mexico, to identify PVY isolates present in fields. Twelve seed potato fields were inspected visually. These represented various generations of seed potato, from nuclear to G2. Leaf samples were collected from plants displaying mosaic, crinkling, and yellowing symptoms, and were tested for PVY. Fifty samples were collected from cultivars Fabula, Mondial, Fianna, Gigant, Caesar, and Adora. Of the 50 leaf samples collected, seven were PVY-positive using the Immuno-strip Kit (Agdia, Elkhart, IN), and six of these were determined to have a N-serotype according to the typing by the Pocket Diagnostics lateral flow kit (Forsite Diagnostics, Ltd., York, UK). PVY-positive samples came from cultivars Fabula (2 with N serotype), Mondial (4 with N serotype), and Fianna (1 with O serotype). Extracts of the seven PVY-positive leaf samples were applied to Whatman FTA cards (Sigma, St. Louis, MO), dried, and transported to the Plant Virology Laboratory at the University of Idaho for further characterization. All samples immobilized on FTA cards were subjected to RNA extraction and standard reverse transcriptase (RT)-PCR typing using a set of PVY-specific primers (2) to determine the strain type. All PVY isolates were recombinant. The six N-serotype samples were found to contain recombinant PVYNTN isolates and produced characteristic bands of 181 and 452 bp in RT-PCR, which indicated the presence of two recombination junctions in the HC-Pro/P3 and VPg regions typical of European PVYNTN isolates. The one O-serotype sample was identified as a recombinant PVYN-Wi/N:O isolate, and produced 181 and 689 bp bands in RT-PCR, which indicated the presence of one recombination junction in the HC-Pro/P3 region. Sequence analysis of RT-PCR products amplified from five samples with N serotype identified them as PVYNTN isolates, and from the one with O serotype identified it as PVYN-Wi/N:O isolate. Sequence comparisons confirmed that N serotype samples contained PVY isolates most closely related to typical PVYNTN sequences (Accession No. EF026075), while the O serotype sample contained the PVY isolate most closely related to PVYN-Wi from Europe (HE608963). The data obtained suggest the presence of two different types of PVY recombinants, PVYNTN and PVYN-Wi, in seed potato in Jalisco. Additional surveillance for these recombinant isolates may be needed, as well as a survey of their effects on tuber quality in production areas. This is the first report of recombinant isolates of PVY often associated with PTNRD circulating in seed potato in Jalisco, Mexico. References: (1) S. M. Gray et al. Plant Dis. 94:1384, 2010. (2) J. H. Lorenzen et al. Plant Dis. 90:935, 2006. (3) V. R. Ramirez-Rodriguez et al. Virol. J. 6:48, 2009. (4) L. Robles-Hernandez et al. Plant Dis. 94:1262, 2010.

New Mexico

2017 ◽  
Author(s):  
David K. Jones
Keyword(s):  
New Mexico ◽  
Board Of Directors ◽  
The State ◽  
Governance Model ◽  
The Board Of Directors ◽  
Set Up ◽  
The Right

The fight over an exchange had a very different dynamic in New Mexico because there were no loud voices on the right calling for the state to reject control. Republican Governor Susanna Martinez supported retaining control, but strongly preferred a governance model that allowed insurers to serve on the board of directors and limited the degree of oversight by the board on the types of plans that could be sold on the exchange. Governor Martinez vetoed legislation in 2011 that would have set up a different model of an exchange. Institutional quirks meant the legislature did not have the opportunity to weigh in again for two years, until 2013. By this point it was too late and the state had to rely on the federal website despite passing legislation to run its own exchange.

Sign in / Sign up

Export Citation Format

Share Document