scholarly journals Dahlia latent viroid: a recombinant new species of the family Pospiviroidae posing intriguing questions about its origin and classification

2013 ◽  
Vol 94 (4) ◽  
pp. 711-719 ◽  
Author(s):  
Jacobus Th. J. Verhoeven ◽  
Ellis T. M. Meekes ◽  
Johanna W. Roenhorst ◽  
Ricardo Flores ◽  
Pedro Serra
Keyword(s):  
Potato Spindle Tuber Viroid ◽  
Minimum Free Energy ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Metastable Structures ◽  
Hop Stunt Viroid ◽  
The Family ◽  
Conserved Region ◽  
Characteristic Features ◽  
Maximum Sequence

A viroid-like RNA has been detected in two asymptomatic dahlia accessions by return and double PAGE. It appeared smaller than Chrysanthemum stunt viroid and Potato spindle tuber viroid, the two members of the genus Pospiviroid, family Pospiviroidae, reported in this ornamental previously. RT-PCR with primers designed for amplifying all pospiviroids produced no amplicons, but RT-PCR with random primers revealed a 342 nt RNA. The sequence of this RNA was confirmed with specific primers, which additionally revealed its presence in many dahlia cultivars. The RNA was named Dahlia latent viroid (DLVd) because it replicates autonomously, but symptomlessly, in dahlia and shares maximum sequence identity with other viroids of less than 56 %. Furthermore, DLVd displays characteristic features of the family Pospiviroidae: a predicted rod-like secondary structure of minimum free energy with a central conserved region (CCR), and the ability to form the metastable structures hairpins I and II. Its CCR is identical to that of Hop stunt viroid (HSVd, genus Hostuviroid). However, DLVd: (i) has the terminal conserved region present in members of the genus Pospiviroid, but absent in HSVd, and (ii) lacks the terminal conserved hairpin present in HSVd. Phylogenetic reconstructions indicate that HSVd and Pepper chat fruit viroid (genus Pospiviroid) are the closest relatives of DLVd, but DLVd differs from these viroids in its host range, restricted to dahlia so far. Therefore, while DLVd fulfils the criteria to be a novel species of the family Pospiviroidae, its recombinant origin makes assignment to the genera Pospiviroid or Hostuviroid problematic.

scholarly journals Citrus exocortis viroid and Hop Stunt viroid Doubly infecting grapevines in Brazil

2006 ◽  
Vol 31 (5) ◽  
pp. 440-446 ◽  
Author(s):  
Marcelo Eiras ◽  
Maria Luisa P.N. Targon ◽  
Thor V.M. Fajardo ◽  
Ricardo Flores ◽  
Elliot W. Kitajima
Keyword(s):  
Pcr Amplification ◽  
Rt Pcr ◽  
Specific Group ◽  
Specific Primers ◽  
Protein Coding ◽  
Stunt Viroid ◽  
Citrus Exocortis Viroid ◽  
Hop Stunt Viroid ◽  
The Family ◽  
Citrus Medica

Viroids, non-protein-coding small (246-401 nt) circular single-stranded RNAs with autonomous replication, are currently classified into two families. Within the family Pospiviroidae, Citrus exocortis viroid (CEVd) belongs to the genus Pospiviroid while Hop stunt viroid (HSVd) is the single member of the genus Hostuviroid. These pathogens are distributed worldwide and infect a large number of hosts. In Brazil, isolates of CEVd and HSVd have been detected in both citrus and grapevine. To characterize and study the genetic variability of these viroids, total RNA from leaves of grapevine Vitis vinifera 'Cabernet Sauvignon' and V. labrusca 'Niagara Rosada' from Bento Gonçalves, RS, was used as a template for RT-PCR amplification with specific primers for the five viroids described infecting grapevines [HSVd, CEVd, Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2 (GYSVd-2) and Australian grapevine viroid (AGVd)]. Leaf samples of Citrus medica infected with CEVd from São Paulo were also analyzed. The resulting products were separated by agarose gel electrophoresis and DNA fragments of the expected size were eluted, cloned and sequenced. The grapevine samples analyzed were doubly infected by CEVd and HSVd. A phylogenetic analysis showed that the Brazilian grapevine HSVd variants clustered with other grapevine HSVd variants, forming a specific group separated from citrus variants, whereas the Brazilian CEVd variants clustered with other citrus and grapevine variants.

scholarly journals Detection of Multiple Infections of Citrus exocortis viroid, Citrus viroid III, and Hop stunt viroid Variants in Hunan Province, China

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1205-1205 ◽  
Author(s):  
S. Rizza ◽  
A. Catara ◽  
X. F. Ma ◽  
Z. Deng
Keyword(s):  
Polyacrylamide Gel Electrophoresis ◽  
Leaf Roll ◽  
Poncirus Trifoliata ◽  
Hunan Province ◽  
Variable Degree ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Citrus Exocortis Viroid ◽  
Hop Stunt Viroid ◽  
Citrus Viroids

Citrus cultivation in China has increased since the late 1970s, with China now having the largest area of citrus in culture in the world that is spread in 22 provinces and municipalities. Hunan Province has undergone a program to become one of the major citrus producers in China. Poncirus trifoliata is the main rootstock, so citrus viroids are a limiting factor for further citriculture development. In mainland China, only the presence of Citrus exocortis viroid (CEVd) has been reported from Etrog citron indexing, sPAGE (sequential polyacrylamide gel electrophoresis) analysis (2), and reverse transcription (RT)-PCR (3). Three viroid-like RNAs, a1, b1, and d, based on sPAGE patterns were detected years ago in our laboratory in budsticks received from Sichuan Province. To identify different viroids and determine their distribution, a survey has been undertaken. Field trees showing stunting, bark scaling and cracking of the rootstock, and poor yield were tested using biological indexing and PCR for the most frequent citrus viroids. Samples from six trees of a local sweet orange variety and three of a Clementine variety introduced from abroad, both grafted on P. trifoliata and showing a variable degree of bark scaling and cracking, were collected near Changsha and in the County of Xin Ning at the end of summer 2006. Small pieces of bark were inserted in stems of young E. citron budwood grafted on rough lemon and maintained in a warm greenhouse (24 to 32°C). Indexing on E. citron showed mild epinasty and leaf roll typical of citrus viroid infections. To identify specific viroids, bark was ground to a fine powder with liquid nitrogen and total RNA was extracted with TRIZOL Reagent (Invitrogen, San Diego, CA) and tested by RT-PCR to detect CEVd, Hop Stunt viroid (HSVd), and Citrus viroid III (CVd-III), as well as to identify the cachexia variants of HSVd. Four primer pairs were used to test the RNA extracts by RT-PCR (1). All samples were infected by HSVd, eight with CVd-III, and six with CEVd. The cachexia variants of HSVd were detected in four of nine samples. Mixed infections were as follows: one sample had CEVd and HSVd, eight had HSVd and CVd-III, and five were infected by the three viroids. A second sampling 3 months after inoculation gave the same amplification patterns. The results show that at least three viroids are present in citrus orchards in Hunan Province. To our knowledge, this is the first report of cachexia variants of HSVd and CVd-III in China. The common occurrence of these viroids supports the need for proper indexing of mother trees and a specific shoot tip grafting program to create healthy budwood sources to provide healthy plants. References: (1) L. Bernard and N. Duran-Vila. Mol. Cell. Probes, 20:105, 2006. (2) L. Han et al. Viroids. CSIRO Publishing, Melbourne, 283, 2003. (3). Q. Hu et al. Acta Bot. Sin. 39:613, 1997.

scholarly journals Complete Genome Sequences of Grapevine Yellow Speckle Viroid 1 and Hop Stunt Viroid Assembled from the Transcriptome of Ixeridium dentatum Plants

2015 ◽  
Vol 3 (5) ◽  
Author(s):  
Joong-Hwan Lee ◽  
Seungmo Lim ◽  
Seung-Won Lee ◽  
Ran Hee Yoo ◽  
Davaajargal Igori ◽  
...  
Keyword(s):  
Complete Genome ◽  
Transcriptome Data ◽  
Genome Sequences ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
The Family

Here, we report complete genome sequences of grapevine yellow speckle viroid 1 (GYSVd1) and hop stunt viroid (HSVd), members of the family Pospiviroidae , assembled from the transcriptome data generated from Ixeridium dentatum plants. To our knowledge, this is the first report of GYSVd1 and HSVd in I. dentatum .

scholarly journals Development and validation of a real-time RT-PCR test for screening pepper and tomato seed lots for the presence of pospiviroids

2020 ◽  
Author(s):  
Marleen Botermans ◽  
Johanna W. Roenhorst ◽  
Marinus Hooftman ◽  
Jacobus Th.J. Verhoeven ◽  
Eveline Metz ◽  
...  
Keyword(s):  
Real Time ◽  
Seed Transmission ◽  
Potato Spindle Tuber Viroid ◽  
Rt Pcr ◽  
Tomato Seed ◽  
Stunt Viroid ◽  
Testing Laboratories ◽  
Tomato Chlorotic Dwarf Viroid ◽  
Development And Validation ◽  
Pcr Test

AbstractPotato spindle tuber viroid and other pospiviroids can cause serious diseases in potato and tomato crops. Consequently, pospiviroids are regulated in several countries. Since seed transmission is considered as a pathway for the introduction and spread of pospiviroids, some countries demand for the testing of seed lots of solanaceous crops for the presence of pospiviroids. A real-time RT-PCR test, named PospiSense, was developed for testing pepper (Capsicum annuum) and tomato (Solanum lycopersicum) seeds for seven pospiviroid species known to occur naturally in these crops. The test consists of two multiplex reactions running in parallel, PospiSense 1 and PospiSense 2, that target Citrus exocortis viroid (CEVd), Columnea latent viroid (CLVd), pepper chat fruit viroid (PCFVd), potato spindle tuber viroid (PSTVd), tomato apical stunt viroid (TASVd), tomato chlorotic dwarf viroid (TCDVd) and tomato planta macho viroid (TPMVd, including the former Mexican papita viroid). Dahlia latent viroid (DLVd) is used as an internal isolation control. Validation of the test showed that for both pepper and tomato seeds the current requirements of a routine screening test are fulfilled, i.e. the ability to detect one infested seed in a sample of c.1000 seeds for each of these seven pospiviroids. Additionally, the Pospisense test performed well in an inter-laboratory comparison, which included two routine seed-testing laboratories, and as such provides a relatively easy alternative to the currently used tests.

scholarly journals First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164 ◽  
Author(s):  
I. Fekih Hassen ◽  
J. Kummert ◽  
S. Marbot ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Plant Pathogens ◽  
Prunus Persica ◽  
Fruit Trees ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Italian Isolate ◽  
Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

scholarly journals Viróides em citros no Estado do Rio de Janeiro

2020 ◽  
Vol 46 (2) ◽  
pp. 121-128
Author(s):  
Jocarstea Aparecida Brinati Leone ◽  
Jorge Ferreira de Souza ◽  
André Felipe Andrade dos Santos ◽  
Paulo Sergio Torres Brioso
Keyword(s):  
Rio De Janeiro ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Citrus Exocortis Viroid ◽  
Hop Stunt Viroid

RESUMO Os viróides infectam plantas de grande importância econômica como os citros. Objetivando detectar a presença de viróides através de métodos moleculares em árvores cítricas, cinco propriedades em Araruama, no Estado do Rio de Janeiro foram avaliadas. Vinte e duas amostras foram coletadas a partir de plantas com nanismo, rachadura no tronco e epinastia, sendo realizada a extração de RNA das folhas e empregado a técnica de RT-PCR com primers específicos para cinco espécies de viróide que infectam citros. O resultado da eletroforese em gel de agarose mostrou-se positivo para os viróides Citrus exocortis viroid (CEVd); Citrus bent leaf viroid (CBLVd); Hop stunt viroid (HSVd) e Citrus dwarfing viroid (CDVd), sendo o último encontrado em todas as propriedades e na combinação com outros viróides, o HSVd e o CBLVd estavam presentes em duas propriedades e o CEVd isoladamente em apenas uma propriedade. Não foi detectada a presença do Citrus viroid IV (CVd-IV) nas amostras avaliadas. Foram observadas diferenças na expressão dos sintomas associados ao CEVd o que pode ter ocorrido devido a interferências entre as espécies de viróides que infectavam uma mesma planta. A transmissão pode ter sido mecanicamente através da poda das plantas cítricas ou através de mudas infectadas com viróide. A utilização de métodos moleculares mostrou-se eficiente na identificação da presença de viróides em plantas cítricas no Estado do Rio de Janeiro.

scholarly journals Rasta Disease of Tomato in Ghana is Caused by the Pospiviroids Potato spindle tuber viroid and Tomato apical stunt viroid

Plant Disease ◽  
2019 ◽  
Vol 103 (7) ◽  
pp. 1525-1535 ◽  
Author(s):  
Ozgur Batuman ◽  
Ö. Cem Çiftçi ◽  
Michael K. Osei ◽  
Sally A. Miller ◽  
Maria R. Rojas ◽  
...  
Keyword(s):  
Potato Spindle Tuber Viroid ◽  
Unknown Etiology ◽  
Rt Pcr ◽  
Tomato Cultivar ◽  
Tomato Plants ◽  
Tomato Seedlings ◽  
Stunt Viroid ◽  
Fta Cards ◽  
Polymerase Chain ◽  
Susceptible Tomato

Rasta is a virus-like disease of unknown etiology affecting tomato (Solanum lycopersicum) plants in Ghana. Symptoms include stunting; epinasty, crumpling, and chlorosis of leaves; and necrosis of leaf veins, petioles, and stems. Leaf samples with rasta symptoms were collected from commercial tomato fields in Ghana in October 2012 and applied to FTA cards, and RNA extracts were prepared. Reverse-transcription polymerase chain reaction (RT-PCR) tests with primers for Columnea latent viroid, which causes rasta-like symptoms in tomato plants in Mali, were negative, whereas tests with degenerate viroid primer pairs were inconclusive. However, tomato seedlings (Early Pak 7) mechanically inoculated with RNA extracts of 10 of 13 samples developed rasta-like symptoms. In RT-PCR tests with RNA from leaves of the 10 symptomatic seedlings and primers for Potato spindle tuber viroid (PSTVd) or Tomato apical stunt viroid (TASVd), the expected size (approximately 360 bp) of DNA fragment was amplified from eight and two seedlings, respectively. Sequence analyses confirmed that these fragments were from PSTVd and TASVd isolates, and revealed a single PSTVd haplotype and two TASVd haplotypes. The PSTVd and TASVd isolates from Ghana had high nucleotide identities (>94%) with isolates from other geographic regions. In a host range study, PSTVd and TASVd isolates from Ghana induced rasta symptoms in the highly susceptible tomato cultivar Early Pak 7 and mild or no symptoms in Glamour, and symptomless infections in a number of other solanaceous species. PSTVd and TASVd isolates were seed associated and possibly seed transmitted.

scholarly journals First Report of Hop stunt viroid Infecting Japanese Plum, Cherry Plum, and Peach in Greece

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1662-1662 ◽  
Author(s):  
M. S. Kaponi ◽  
P. E. Kyriakopoulou
Keyword(s):  
Stone Fruit ◽  
Economic Losses ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Japanese Plum ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Fruit Skin ◽  
Viroid Infection ◽  
Field Samples

Dapple plum and peach fruit is a widely distributed disorder of plum and peach resulting in significant economic losses (4). During a survey for the presence of Hop stunt viroid (HSVd) on stone fruit trees in Greece, samples from 30 European plums (Prunus domestica L., cvs. President, Tuleu Grass), 45 Japanese plums (Prunus salicina Lindl., cvs. Angeleno, Diamond, Santa Rosa), 12 cherry plums (Prunus domestica L. var. insititia (L.) Fiori & Paoletti of unknown cultivar), and 107 peaches (Prunus persica (L.) Batsch, cvs. Red Haven, Elberta, June Gold, Spring Crest, Lemonato) were collected in several orchards around Greece. Their fruit skin symptomatology indicated viroid infection (reddish dappling blotches and cracks in European and Japanese plum, green dappling in cherry plum, and light colored blotches and lines in peach). Samples were screened with tissue-print hybridization (TPH) for HSVd using a full length DIG-labelled riboprobe deriving from in vitro transcription of the positive control, a citrus isolate of HSVd (G. Vidalakis, CCPP, University of California, Riverside). In total, 44 out of the 194 trees surveyed were HSVd-positive with TPH. For a small number (40) of TPH-positive field samples, TNA phenol extraction from fruit skin, leaves, and bark and one-tube two-step reverse transcription (RT)-PCR assays followed, using a standardized protocol (3) with two different primer pairs, one new primer pair (this study) and a previously reported primer pair (2). RT-PCR analysis showed the presence of HSVd in peach and Japanese plum in prefectures Pella (Central Macedonia), Achaia, and Korinthia (Peloponnesus) and in cherry plum in Achaia (Peloponnesus). Six of 11 Japanese plums (cvs. Angeleno, Santa Rosa), 2 of 12 cherry plums, and 8 of 12 peaches (cvs. Spring Crest, Red Haven) examined were found HSVd-infected, but none of the five European plums were. Nucleotide sequence analyses of purified and cloned amplicons from peaches and Japanese and cherry plums revealed sizes of 297 to 308 nt and similarity to sequence variants of other HSVd isolates previously characterized: 95 to 97% identity with the Moroccan isolates apr.9, apr.10, apr.11, and apr.12 and the Spanish isolate apr.4 from apricot (1) (GenBank Accession Nos. AJ297825 to AJ297828 and Y09346, respectively). For confirmation of HSVd presence in field trees, 10 Japanese plums cv. Angeleno, 10 peaches cv. June Gold, and 10 peaches cv. Spring Crest, HSVd-negative (TPH), were bud- or chip-grafted from two of the aforementioned Japanese plums cv. Angeleno and two of the aforementioned peaches cv. Red Haven. Two years later, five Japanese plum trees (cv. Angeleno) and five peach trees (three cv. Spring Crest and two cv. June Gold) were found HSVd-positive with TPH; no fruits were observed to produce fruit symptoms as the grafted trees were kept in an insect-proof greenhouse (no bees for cross-pollination). To our knowledge, our investigation reports for the first time the occurrence of HSVd infecting Japanese plum, cherry plum, and peach in Greece, emphasizing the need for a certification program for the prevention of spreading stone fruit tree viroids in this country. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (3). F. Faggioli et al. Acta. Hort. 550:59, 2001. (4) T. Sano et al. J. Gen. Virol. 70:1311, 1989.

scholarly journals First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽  
2021 ◽  
Author(s):  
Dong Xu ◽  
Charith Raj Adkar-Purushothama ◽  
Pierre Lemoyne ◽  
Jean Pierre Perreault ◽  
Mamadou Fall
Keyword(s):  
Rna Extraction ◽  
Leaf Tissue ◽  
Positive Sequence ◽  
Wine Grape ◽  
Library Preparation ◽  
Rt Pcr ◽  
Tissue Samples ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

Sign in / Sign up

Export Citation Format

Share Document