A Patient with Crimean-Congo Hemorrhagic Fever Serologically Diagnosed by Recombinant Nucleoprotein-Based Antibody Detection Systems

ABSTRACT We treated a male patient with Crimean-Congo hemorrhagic fever (CCHF). The diagnosis of CCHF was confirmed by reverse transcription-PCR and recombinant nucleoprotein (rNP)-based immunoglobulin G (IgG) and IgM capture enzyme-linked immunosorbent assays of serially collected serum samples. The patient was treated with intravenous ribavirin and recovered with no consequences. The study indicates that rNP-based CCHF virus antibody detection systems are useful for confirming CCHF virus infections. This case also suggests that intravenous ribavirin therapy may be promising for the treatment of CCHF patients.

Download Full-text

Crimean-Congo Hemorrhagic Fever in Iraq During 2010

The Iraqi Journal of Veterinary Medicine ◽

10.30539/iraqijvm.v36i0e.388 ◽

2012 ◽

Vol 36 (0E) ◽

pp. 99-103

Author(s):

Emad S. Abul-Eis ,

Keyword(s):

Human Serum ◽

Hemorrhagic Fever ◽

Zoonotic Disease ◽

Immunoglobulin M ◽

Serum Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Human Serum Samples ◽

Specific Immunoglobulin ◽

Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic disease with a highmortality rate in humans. CCHF is caused by genus Nairovirus, in family of Bunyaviridae,and is transmitted to humans through the bite of ticks Hyalomma spp or contact with blood ortissues of CCHF patients or infected livestock.The total numbers of positive patients to CCHF virus was 11 out of 44 suspected sampleswere examined from eight provinces during the period from January to December 2010 . Theway of transmission is due to contact with blood and tissues of infected animals, and onepatient slaughtered sheep in his house. ELISA was used to detect Crimean-Congohemorrhagic fever (CCHF) virus-specific immunoglobulin M (IgM) in human serum samples.

Download Full-text

Emerging diseases: Crimean-Congo hemorrhagic fever

Medicinski pregled ◽

10.2298/mpns0410453k ◽

2004 ◽

Vol 57 (9-10) ◽

pp. 453-456 ◽

Cited By ~ 4

Author(s):

Nada Kuljic-Kapulica

Keyword(s):

Eastern Europe ◽

Central Asia ◽

Hemorrhagic Fever ◽

Emerging Diseases ◽

Control Measures ◽

Ixodid Ticks ◽

Sub Saharan Africa ◽

Antibody Detection ◽

Crimean Congo Hemorrhagic Fever ◽

Cchf Virus

Introduction Recognized for many years in central Asia and Eastern Europe, Crimean-Congo hemorrhagic fever (CCHF) is a severe zoonotic disease which affects people coming into contact with livestock or ticks. The range of the CCHF virus is now known to extend form central Asia to India, Pakistan, Afghanistan, Iran, Iraq, the Middle East, Eastern Europe, and to most of Saharan and sub-Saharan Africa. Etiology CCHF virus is a member of the Bunyavirus family, and is classified as a Nairovirus. Clinical features After an incubation period of approximately 3 to 6 days the abrupt onset of acute febrile illness occurs. The first symptoms are similar to severe influenza and include fever, headache, severe back and abdominal pain. The hemorrhagic fever manifestations occur after several days of illnesses and include petechial rash, ecchymoses, hematemmesis, and melenna. Cases typically present with some form of hepatitis. The mortality rate is 10-50% in different outbreaks with deaths typically occurring during the second week of illness. Epidemiology The genus Hyalomma of ixodid ticks is the most important vector of the CCHF virus. Vertebrates including birds and small animals provide excellent amplifier hosts of both the virus and the tick. The virus can be transmitted to humans by direct contact with infected animals and from person to person. Diagnosis Early diagnosis is possible in special laboratories using antigen detection by imunofluorescence or ELISA tests or molecular methods as PCR and antibody detection. Control Tick control measures need to be emphasized and utilized to prevent CCHF. This includes spraying camp sites, clothing and danger areas with acaricides or repellent. Strict isolation of patients with CCHF and a focus on barrier nursing would help to prevent nosocomial spread. Presently the vaccine is a dangerous mouse brain-derived version. Future development of a vaccine would help to prevent human infection.

Download Full-text

Development of Novel Immunoglobulin G (IgG), IgA, and IgM Enzyme Immunoassays Based on Recombinant Puumala and Dobrava Hantavirus Nucleocapsid Proteins

Clinical and Vaccine Immunology ◽

10.1128/cvi.00208-06 ◽

2006 ◽

Vol 13 (12) ◽

pp. 1349-1357 ◽

Cited By ~ 39

Author(s):

Helga Meisel ◽

Anne Wolbert ◽

Ausra Razanskiene ◽

Andreas Marg ◽

Andris Kazaks ◽

...

Keyword(s):

Immunoglobulin G ◽

Hemorrhagic Fever ◽

Virus Infections ◽

Serum Samples ◽

Nucleocapsid Proteins ◽

Dobrava Virus ◽

Acute Infections ◽

Antibody Capture ◽

Human Infections ◽

Heterologous Antigens

ABSTRACT Human infections with Asian and European hantaviruses can result in hemorrhagic fever with renal syndromes of differing severities characterized by renal dysfunction and sometimes by pulmonary symptoms. For the serological detection of human infections by hantaviruses relevant for Europe, we developed monoclonal antibody capture immunoglobulin G (IgG) and IgA enzyme-linked immunosorbent assays (ELISAs) based on yeast-expressed nucleocapsid proteins of Puumala and Dobrava hantaviruses. Moreover, for diagnosis of acute infections, μ-capture IgM ELISAs were established with nucleocapsid proteins expressed in Drosophila melanogaster Schneider S2 cells. The cutoff values of the ELISAs were determined by investigation of up to 500 human anti-hantavirus-negative serum samples. The specificities of the Puumala and Dobrava virus-specific IgM, IgA, and IgG ELISAs were found to be 100%. The sensitivities of these ELISAs were determined to be 100% with panels of characterized anti-Puumala or anti-Dobrava virus-positive human serum samples. In most cases, Puumala and Dobrava virus infections could be differentiated by ELISA reactivity alone, i.e., endpoint titration with homologous and heterologous antigens.

Download Full-text

Immunoglobulin-like Domain of HsFcμR as a Capture Molecule for Detection of Crimean-Congo Hemorrhagic Fever Virus- and Zika Virus-Specific IgM Antibodies

Clinical Chemistry ◽

10.1373/clinchem.2018.294819 ◽

2019 ◽

Vol 65 (3) ◽

pp. 451-461 ◽

Cited By ~ 2

Author(s):

Anne Rackow ◽

Christa Ehmen ◽

Ronald von Possel ◽

Raquel Medialdea-Carrera ◽

David Brown ◽

...

Keyword(s):

Zika Virus ◽

Specific Binding ◽

Hemorrhagic Fever ◽

Fever Virus ◽

Size Exclusion ◽

Animal Origin ◽

Serum Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Hemorrhagic Fever Virus ◽

Igm Antibodies

Abstract BACKGROUND The cellular surface molecule HsTOSO/FAIM3/HsFcμR has been identified as an IgM-specific Fc receptor expressed on lymphocytes. Here, we show that its extracellular immunoglobulin-like domain (HsFcμR-Igl) specifically binds to IgM/antigen immune complexes (ICs) and exploit this property for the development of novel detection systems for IgM antibodies directed against Crimean-Congo hemorrhagic fever virus (CCHFV) and Zika virus (ZIKV). METHODS His-tagged HsFcμR-Igl was expressed in Escherichia coli and purified by affinity chromatography, oxidative refolding, and size-exclusion chromatography. Specific binding of HsFcμR-Igl to IgM/antigen ICs was confirmed, and 2 prototypic ELISAs for the detection of anti-CCHFV and anti-ZIKV IgM antibodies were developed. Thereby, patient sera and virus-specific recombinant antigens directly labeled with horseradish peroxidase (HRP) were coincubated on HsFcμR-Igl-coated ELISA plates. Bound ICs were quantified by measuring turnover of a chromogenic HRP substrate. RESULTS Assay validation was performed using paired serum samples from 15 Kosovar patients with a PCR-confirmed CCHFV infection and 28 Brazilian patients with a PCR-confirmed ZIKV infection, along with a panel of a priori CCHFV/ZIKV-IgM-negative serum samples. Both ELISAs were highly reproducible. Sensitivity and specificity were comparable with or even exceeded in-house gold standard testing and commercial kits. Furthermore, latex beads coated with HsFcμR-Igl aggregated upon coincubation with an IgM-positive serum and HRP-labeled antigen but not with either component alone, revealing a potential for use of HsFcμR-Igl as a capture molecule in aggregation-based rapid tests. CONCLUSIONS Recombinant HsFcμR-Igl is a versatile capture molecule for IgM/antigen ICs of human and animal origin and can be applied for the development of both plate- and bead-based serological tests.

Download Full-text

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Scientific Reports ◽

10.1038/s41598-021-91826-8 ◽

2021 ◽

Vol 11 (1) ◽

Author(s):

Tahmineh Jalali ◽

Mostafa Salehi-Vaziri ◽

Mohammad Hassan Pouriayevali ◽

Seyed Latif Mousavi Gargari

Keyword(s):

Point Of Care ◽

Hemorrhagic Fever ◽

Diagnostic Methods ◽

Clinical Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Point Of Care Test ◽

Specificity And Sensitivity ◽

Rural And Remote Areas ◽

Cchf Virus ◽

Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Download Full-text

Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

Journal of Virology ◽

10.1128/jvi.01638-21 ◽

2021 ◽

Author(s):

Maria Vittoria Salvati ◽

Claudio Salaris ◽

Vanessa Monteil ◽

Claudia Del Vecchio ◽

Giorgio Palù ◽

...

Keyword(s):

Viral Replication ◽

Cell Lines ◽

Persistent Infection ◽

Hemorrhagic Fever ◽

Viral Reservoir ◽

Tick Cell ◽

Infected Tick ◽

Crimean Congo Hemorrhagic Fever ◽

Cchf Virus ◽

Model Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

Download Full-text

Evaluation of a Crimean-Congo hemorrhagic fever virus recombinant antigen expressed by Semliki Forest suicide virus for IgM and IgG antibody detection in human and animal sera collected in Iran

Journal of Clinical Virology ◽

10.1016/j.jcv.2005.02.016 ◽

2006 ◽

Vol 35 (2) ◽

pp. 154-159 ◽

Cited By ~ 47

Author(s):

S. Garcia ◽

S. Chinikar ◽

D. Coudrier ◽

A. Billecocq ◽

B. Hooshmand ◽

...

Keyword(s):

Hemorrhagic Fever ◽

Recombinant Antigen ◽

Fever Virus ◽

Antibody Detection ◽

Igg Antibody ◽

Crimean Congo Hemorrhagic Fever ◽

Hemorrhagic Fever Virus ◽

Virus Recombinant

Download Full-text

Limited interlaboratory comparison of Schmallenberg virus antibody detection in serum samples

Veterinary Record ◽

10.1136/vr.102180 ◽

2014 ◽

Vol 174 (15) ◽

pp. 380-380 ◽

Cited By ~ 19

Author(s):

W. H. M. van der Poel ◽

B. Cay ◽

S. Zientara ◽

F. Steinbach ◽

J. F. Valarcher ◽

...

Keyword(s):

Interlaboratory Comparison ◽

Schmallenberg Virus ◽

Antibody Detection ◽

Virus Antibody ◽

Serum Samples

Download Full-text

Development of a Rapid and Convenient Method for Determination of Rubella Virus-Specific Immunoglobulin G Avidity

Clinical and Vaccine Immunology ◽

10.1128/cvi.00312-07 ◽

2007 ◽

Vol 14 (11) ◽

pp. 1416-1419 ◽

Cited By ~ 10

Author(s):

Christelle Vauloup-Fellous ◽

Jessica Ursulet-Diser ◽

Liliane Grangeot-Keros

Keyword(s):

Immunoglobulin G ◽

Rubella Virus ◽

Primary Infection ◽

Virus Infections ◽

Serum Samples ◽

Igg Avidity ◽

Specific Immunoglobulin ◽

Specific Igg ◽

Semiautomated Method

ABSTRACT We describe here a rapid and semiautomated method for the determination of rubella virus immunoglobulin G (IgG) avidity with the VIDAS instrument. A total of 153 serum samples from persons with naturally acquired rubella virus infections (n = 98), from vaccinated persons (n = 44), and from patients with autoantibodies (n = 11) were included in this study. The rubella virus-specific IgG avidity assay we developed for the VIDAS instrument was evaluated by comparison with an in-house method. Results obtained with the VIDAS instrument allow considering this method valuable to help confirm or exclude acute primary infection or recent vaccination.

Download Full-text