Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

Development of double antibody sandwich ELISA as potential diagnostic tool for rapid detection of Crimean-Congo hemorrhagic fever virus

Crimean-Congo hemorrhagic fever (CCHF) virus, a highly pathogenic viral agent is responsible for severe fatal hemorrhagic infections in many parts of the world. The early diagnosis of CCHF infection is important for successful clinical management and epidemiological control. The nucleoprotein (NP) of CCHFV being highly conserved and immunogenic is used as early diagnostic marker. In this study, we report a rapid and sensitive double antibody based antigen capture ELISA to detect Crimean-Congo hemorrhagic fever virus (CCHFV). Highly specific polyclonal and monoclonal antibody against NP has been generated and used as capture and detector antibody respectively. The assay was able to detect viral nucleoprotein in different matrices including human serum, ticks and culture supernatant. The detection limit of the developed sandwich ELISA assay was 25 ng of purified antigen. Comparison with a real time RT-PCR revealed its detection limit to be 1000 genome equivalents of CCHFV. Further the assay was comparatively evaluated with a commercial kit employing gamma irradiated CCHFV, revealing a sensitivity and specificity of 100%. This newly developed sandwich ELISA (sELISA) with high sensitivity and specificity could be used as an efficient method for the detection of CCHF virus in humans, ticks and culture supernatant. The assay will be useful as alternate tool for diagnosis of acute infection and is amenable for screening of large scale samples in resource limited settings.

Spatial Distribution of Ticks (Arachniada: Argasidae and Ixodidae) and Their Infection Rate to Crimean-Congo Hemorrhagic Fever Virus in Iran

Background: The Crimean-Congo Hemorrhagic Fever (CCHF) is one of the most important arthropod-borne viral dis-eases with a mortality rate of about 30% among humans. The disease, caused by a Nairovirus, is transmitted to humans and animals by hard and soft ticks. This study aimed to determine the distribution of soft and hard ticks in the past three decades in Iran with an emphasis on the vectors of the CCHF virus. Methods: In this study, all studies that were carried out in different regions of Iran from 1979 to 2018 and their results were published in prestigious journals were used to create a database. The distribution of ticks was mapped using ArcMap10.3. Results: Based on the results, nine genera and 37 species of soft and hard ticks were recorded in Iran. So far, six genera and 16 species of hard and soft ticks were reported to be infected with the CCHF virus. The infection to this virus was reported from 18 out of 31 provinces, with a high rate in Sistan and Baluchistan as well as Khuzestan provinces. The highest levels of CCHF infection belonged to Hyalomma marginatum and H. anatolicum. Conclusion: The main vectors of CCHF, H. marginatum and H. anatolicum, were reported in more than 38.7% of Iran's provinces, and these two species were identified as invasive species in Iran. Thus, control activities should be strength-ened to avoid the outbreaks of CCHF.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Serologic and molecular evidence for circulation of Crimean-Congo hemorrhagic fever virus in ticks and cattle in Zambia

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonosis with a high case fatality rate in humans. Although the disease is widely found in Africa, Europe, and Asia, the distribution and genetic diversity of CCHF virus (CCHFV) are poorly understood in African countries. To assess the risks of CCHF in Zambia, where CCHF has never been reported, epidemiologic studies in cattle and ticks were conducted. Through an indirect immunofluorescence assay, CCHFV nucleoprotein-specific serum IgG was detected in 8.4% (88/1,047) of cattle. Among 290 Hyalomma ticks, the principal vector of CCHFV, the viral genome was detected in 11 ticks. Phylogenetic analyses of the CCHFV S and M genome segments revealed that one of the detected viruses was a genetic reassortant between African and Asian strains. This study provides compelling evidence for the presence of CCHFV in Zambia and its transmission to vertebrate hosts.

Risk factors associated with exposure to Crimean-Congo haemorrhagic fever virus in animal workers and cattle, and molecular detection in ticks, South Africa

Crimean-Congo haemorrhagic fever (CCHF) is a severe tick-borne viral zoonosis endemic to parts of Africa, Europe, the Middle East and Central Asia. Human cases are reported annually in South Africa, with a 25% case fatality rate since the first case was recognized in 1981. We investigated CCHF virus (CCHFV) seroprevalence and risk factors associated with infection in cattle and humans, and the presence of CCHFV in Hyalomma spp. ticks in central South Africa in 2017–18. CCHFV IgG seroprevalence was 74.2% (95%CI: 64.2–82.1%) in 700 cattle and 3.9% (95%CI: 2.6–5.8%) in 541 farm and wildlife workers. No veterinary personnel (117) or abattoir workers (382) were seropositive. The prevalence of CCHFV RNA was significantly higher in Hyalomma truncatum (1.6%) than in H. rufipes (0.2%) (P = 0.002). Seroprevalence in cattle increased with age and was greater in animals on which ticks were found. Seroprevalence in cattle also showed significant geographic variation. Seroprevalence in humans increased with age and was greater in workers who handled livestock for injection and collection of samples. Our findings support previous evidence of widespread high CCHFV seroprevalence in cattle and show significant occupational exposure amongst farm and wildlife workers. Our seroprevalence estimate suggests that CCHFV infections are five times more frequent than the 215 confirmed CCHF cases diagnosed in South Africa in the last four decades (1981–2019). With many cases undiagnosed, the potential seriousness of CCHF in people, and the lack of an effective vaccine or treatment, there is a need to improve public health awareness, prevention and disease control.

A survey of tick infestation of animals before Eid-al-Adha as suspected cases of Crimean-Congo Hemorrhagic Fever (CCHF) in Kabul city’s streets and live animal markets

Ticks are considered the crucial vectors of many infectious agents and considered the main vectors and reservoirs of Crimean-Congo Hemorrhagic Fever (CCHF) virus which is endemic in Afghanistan. The main objective of this study was to determine the prevalence of tick infestation in animals brought to Kabul city streets and live animal markets before Eid-al-Adha days as suspected cases of CCHF. Totally, 4,200 animals were examined in a four-day survey to estimate the prevalence of infested animals and related risk factors in Kabul city streets and live animal markets before Eid-al-Adha days in August 2019. The animals originated from 85.3% of provinces (29/34) and consisted of sheep (66.5%), goats (14.8%), cattle (14.9%), buffallos (1.9%) and camels (0.008%). The overall prevalence of the tick infestation was 25.2% and the mean number of ticks per animal was 2.6. The prevalence was 18.2% in animals <1 year old, 23.4% in animals 1-2 years old and 33.5% in animals > 2 years old (p<0.05), but it was 27.1% in female and 25.1% in male respectively (p>0.05). From the total 2,101 ectoparasites collected, Hyalomma was the dominant genus (40.7%), followed by Rhipicephalus (6.1%), Amblyomma (5.4%), Dermacentor (1.3%), Boophilus (1.0%), Ixodes (0.05%) and Argas (0.1%). The overall awareness about CCHF among sellers/farmers was low, and only 5% just had heard about the disease. It has been concluded that tick infestation is very prevalent in animals brought to Kabul city before Eid-al-Adha days and low awareness about zoonotic diseases including CCHF among society greatly threaten the health of people.

Synonymous codon usage pattern among the S, M, and L segments in crimean-congo hemorrhagic fever causing virus

Crimean-congo hemorrhagic fever (CCHF) virus is one among the major zoonosis viral diseases that use the Hyalomma ticks as their transmission vector to cause viral infection to the human and mammalian community. The fatality of infectious is high across the world especially in Africa, Asia, Middle East, and Europe. This study regarding codon usage bias of S, M, and L segments of the CCHF virus pertaining to the host Homo sapiens, reveals in-depth information about the evolutionary characteristics of CCHFV. Relative Synonymous Codon Usage (RSCU), Effective number of codons (ENC) were calculated, to determine the codon usage pattern in each segment. Correlation analysis between Codon adaptation index (CAI), GRAVY (Hydrophobicity), AROMO (Aromaticity), and nucleotide composition revealed bias in the codon usage pattern. There was no strong codon bias found among any segments of the CCHF virus, indicating both the factors i.e., natural selection and mutational pressure shapes the codon usage bias.

Epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Africa—Underestimated for Decades

Crimean-Congo hemorrhagic fever (CCHF) is endemic in Africa, but the epidemiology remains to be defined. Using a broad database search, we reviewed the literature to better define CCHF evidence in Africa. We used a One Health approach to define the impact of CCHF by reviewing case reports, human and animal serology, and records of CCHF virus (CCHFV) isolations (1956–mid-2020). In addition, published and unpublished collection data were used to estimate the geographic distribution of Hyalomma ticks and infection vectors. We implemented a previously proposed classification scheme for organizing countries into five categories by the level of evidence. From January 1, 1956 to July 25, 2020, 494 CCHF cases (115 lethal) were reported in Africa. Since 2000, nine countries (Kenya, Mali, Mozambique, Nigeria, Senegal, Sierra Leone, South Sudan, Sudan, and Tunisia) have reported their first CCHF cases. Nineteen countries reported CCHF cases and were assigned level 1 or level 2 based on maturity of their surveillance system. Thirty countries with evidence of CCHFV circulation in the absence of CCHF cases were assigned level 3 or level 4. Twelve countries for which no data were available were assigned level 5. The goal of this review is to inform international organizations, local governments, and healthcare professionals about shortcomings in CCHF surveillance in Africa to assist in a movement toward strengthening policy to improve CCHF surveillance.

Infection Rate in the Population of Ticks Hyalomma marginatum in the Territory of the Crimean Hemorrhagic Fever (CHF) Natural Focus and Assessment of the Link with the CHF Incidence in the Stavropol Region

Objective of the study was to assess the infection rate in the population of the main CCHF virus vector Hyalomma marginatum and its impact on the CHF incidence in the Stavropol Region.Materials and methods. The data on spontaneous infection of H. marginatum ticks in the territory of the CHF natural focus in the Stavropol Region for the period 2012–2018 are presented. In total, more than 22.000 H. marginatum specimens pooled in 1546 samples were tested. The indication of CCHF virus was performed by PCR method using the reagent set for detecting RNA of the CCHF virus “AmplySens® CCHFV-FL” (produced by Central Research Institute of Epidemiology, Russia). To determine the individual infection rate in pools Beklemishev`s method was used. The data on CCHF incidence and amount of tick-bitten persons are taken from official statistics and Annual Epidemiological Report on CHF Incidence provided by the Rospotrebnadzor Administration in the Stavropol Region for the period of 2012–2018.Results and discussion. RNA of CCHF virus was detected in 161 (10.4 %) out of 1546 pooled ticks. The highest infection rate (20 %) was among nymphs. The infection rate for pooled males of H. marginatum was 11 % and for females – 8.5 %. Circulation of Crimean-Congo hemorrhagic fever virus is confirmed in major part of the Stavropol Region. The average infection rate among H. marginatum population was 1.54 % for the period of 2012–2018, ranging from 0.23 % in 2014 to 2.97 % in 2017. It is established that the level of infection rate among H. marginatum population does not affect the CHF incidence in the Stavropol Region. Probably it is not the number of infected ticks in the population that determines the CHF incidence rate but their abundance.