Virus-derived DNA forms mediate the persistent infection of tick cells by Hazara virus and Crimean-Congo hemorrhagic fever virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF virus (CCHFV), a biosafety level (BSL)-4 pathogen. Ticks of the genus Hyalomma are the viral reservoir and they represent the main vector transmitting the virus to its hosts during blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma -derived tick cell lines. However, the mechanism allowing the establishment of persistent viral infections in ticks is still unknown. Hazara virus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study virus/vector interactions. To investigate the mechanism behind the establishment of a persistent infection, we developed an in vitro model with Hyalomma -derived tick cell lines and HAZV. As expected, HAZV, like CCHFV, persistently infects tick cells without any sign of cytopathic effect, and the infected cells can be cultured for more than three years. Most interestingly, we demonstrated the presence of short viral-derived DNA forms (vDNAs) after HAZV infection. Furthermore, we demonstrated that the antiretroviral drug AZT could inhibit the production of vDNAs, suggesting that vDNAs are produced by an endogenous retrotranscriptase activity in tick cells. Moreover, we collected evidence that vDNAs are continuously synthesized, thereby downregulating viral replication to promote cell survival. Finally, vDNAs were also detected in CCHFV-infected tick cells. In conclusion, vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks allowing their persistent infection. IMPORTANCE Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne viral disease caused by CCHF virus (CCHFV). Ticks of the genus Hyalomma can be persistently infected with CCHFV representing the viral reservoir, and the main vector for viral transmission. Here we showed that tick cells infected with Hazara virus, a nonpathogenic model virus closely related to CCHFV, contained short viral-derived DNA forms (vDNAs) produced by endogenous retrotranscriptase activity. vDNAs are transitory molecules requiring viral RNA replication for their continuous synthesis. Interestingly, vDNA synthesis seemed to be correlated with downregulation of viral replication and promotion of tick cell viability. We also detected vDNAs in CCHFV-infected tick cells suggesting that they could represent a key element in the cell response to nairovirus infection and might represent a more general mechanism of innate immunity against RNA viral infection.

Download Full-text

The Persistent Infection of Tick Cells by Hazara orthonairovirus Is Mediated by Virus-Derived DNA Forms

Proceedings ◽

10.3390/proceedings2020050122 ◽

2020 ◽

Vol 50 (1) ◽

pp. 122

Author(s):

Maria Vittoria Salvati ◽

Claudia Del Vecchio ◽

Lesley Bell-Sakyi ◽

Cristina Parolin ◽

Arianna Calistri ◽

...

Keyword(s):

Viral Replication ◽

Cell Lines ◽

Persistent Infection ◽

Cytopathic Effect ◽

Viral Vector ◽

Severe Disease ◽

Hemorrhagic Fever ◽

Viral Reservoir ◽

Initial Time ◽

Infected Cells

Introduction: Crimean–Congo hemorrhagic fever (CCHF) is a severe disease of humans caused by CCHF orthonairovirus (CCHFV), a class 4 pathogen. Hyalomma ticks are the viral reservoir, and they represent the main vector. CCHFV can be transmitted to its hosts during tick blood feeding. We have previously shown that CCHFV can persistently infect Hyalomma-derived tick cell lines without any cytopathic effect. However, the mechanism allowing for the establishment of a persistent viral infection in ticks is still unknown. It has been recently reported that Hazara orthonairovirus (HAZV) can be used as a BSL-2 model virus instead of CCHFV to study viral/vector interaction. The aim of our study is to elucidate the mechanism that allows establishment of persistent CCHFV infection in ticks using HAZV as a model. Methods: We used classical and molecular methods applied to virology to characterize the establishment of persistent HAZV infection in two Hyalomma anatolicum-derived cell lines—HAE/CTVM8 and HAE/CTVM9. Results: As for CCHFV, we showed that HAZV persistently infects tick cells without any sign of cytopathic effect and that infected cells can be cultured for more than one year. The persistent infection is characterized by a low viral titer compared to the initial time points. Interestingly, short viral-derived DNA forms (vDNAs) start to be detected in parallel with the beginning of viral replication and are maintained in persistently-infected cells. Experiments with the antiretroviral drug AZT suggest that vDNAs are produced by retrotranscriptase activity. Furthermore, we collected evidence that vDNAs are not integrated and seem to be involved in the downregulation of viral replication by promoting cell survival. Conclusion: vDNA synthesis might represent a strategy to control the replication of RNA viruses in ticks, as recently demonstrated in insects, allowing for persistent infection of virus vectors.

Download Full-text

Differential Cell Line Susceptibility to Crimean-Congo Hemorrhagic Fever Virus

Frontiers in Cellular and Infection Microbiology ◽

10.3389/fcimb.2021.648077 ◽

2021 ◽

Vol 11 ◽

Author(s):

Shiyu Dai ◽

Qiaoli Wu ◽

Xiaoli Wu ◽

Cheng Peng ◽

Jia Liu ◽

...

Keyword(s):

Cell Lines ◽

Ex Vivo ◽

Animal Cell ◽

Hemorrhagic Fever ◽

Viral Disease ◽

Permissive Cell ◽

Hek 293 ◽

Crimean Congo Hemorrhagic Fever ◽

Hemorrhagic Fever Virus ◽

Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a severe tick-borne viral disease of global concerns due to the increasing incidence and lack of effective treatments. The causative agent, CCHF virus (CCHFV), has been characterized for years; however, its tropism in cell lines of different host and tissue origins remains unclear. This study characterized the susceptibility of 16 human and 6 animal cell lines to CCHFV. Increased viral load and viral nucleoprotein expression, and productive CCHFV replication were detected in human vascular (HUVEC), renal (SW-13 and HEK-293), hepatic (Huh7), and cerebral (U-87 MG) cell lines, which were considered CCHFV-highly permissive cell lines. Renal cell lines derived from monkey and dog could also support CCHFV replication. This study evaluated the susceptibility of different cell lines to CCHFV and identified CCHFV-permissive cell lines. Our findings raise concerns regarding the use of cell lines in ex vivo studies of CCHFV and may have important implications for further fundamental research, which would promote understanding of CCHFV pathogenesis and transmission, as well as benefit designing strategies for disease prevention and control.

Download Full-text

Tick Cell Lines for Study of Crimean-Congo Hemorrhagic Fever Virus and Other Arboviruses

Vector-Borne and Zoonotic Diseases ◽

10.1089/vbz.2011.0766 ◽

2012 ◽

Vol 12 (9) ◽

pp. 769-781 ◽

Cited By ~ 29

Author(s):

Lesley Bell-Sakyi ◽

Alain Kohl ◽

Dennis A. Bente ◽

John K. Fazakerley

Keyword(s):

Cell Lines ◽

Hemorrhagic Fever ◽

Fever Virus ◽

Tick Cell ◽

Crimean Congo Hemorrhagic Fever ◽

Hemorrhagic Fever Virus

Download Full-text

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens

Scientific Reports ◽

10.1038/s41598-021-91826-8 ◽

2021 ◽

Vol 11 (1) ◽

Author(s):

Tahmineh Jalali ◽

Mostafa Salehi-Vaziri ◽

Mohammad Hassan Pouriayevali ◽

Seyed Latif Mousavi Gargari

Keyword(s):

Point Of Care ◽

Hemorrhagic Fever ◽

Diagnostic Methods ◽

Clinical Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Point Of Care Test ◽

Specificity And Sensitivity ◽

Rural And Remote Areas ◽

Cchf Virus ◽

Exponential Enrichment

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Download Full-text

Epidémiologie de la fièvre Hémorragique de Crimée-Congo (FHCC) chez les bovins dans le département de Boboye au Niger

International Journal of Biological and Chemical Sciences ◽

10.4314/ijbcs.v14i3.5 ◽

2020 ◽

Vol 14 (3) ◽

pp. 698-705

Author(s):

Alima Maïna ◽

Abdoulkarim Issa Ibrahim ◽

Abdou Alassane ◽

Hassane Adakal

Keyword(s):

Immunosorbent Assay ◽

Disease Transmission ◽

Local Governments ◽

Indirect Elisa ◽

Hemorrhagic Fever ◽

Elisa Test ◽

Enzyme Linked Immunosorbent Assay ◽

Crimean Congo Hemorrhagic Fever ◽

Cchf Virus ◽

Made In

La distribution et la dynamique des populations des tiques est un élément clé dans la connaissance des maladies transmises par ces vecteurs. C’est ainsi que cette étude a été conduite afin de mieux connaître l’épidémiologie de la Fièvre Hémorragique de Crimée-Congo (FHCC) dans les 8 communes du département de Boboye au Niger, où 355 sérums de bovins ont été collectés. En plus des sérums, des tiques ont été collectées sur 144 bovins, soit 18 par commune. Les sérums ont été soumis à un test ELISA (Enzyme Linked Immunosorbent Assay) indirect pour la détection d’anticorps anti-FHCC. Soixante-douze (72) éleveurs ont été interviewés sur leur connaissance de l’écologie des tiques, vecteurs du virus de la FHCC. Les résultats de l’enquête ont révélé que les éleveurs n’ont pas recours aux acaricides et que, dans leur majorité (55/72 soit 76,4 %), ils pratiquent la transhumance. L’étude a permis l’identification de 1342 tiques réparties en trois genres : Hyalomma (91,7%), Amblyomma (5,7%) et Rhipicephalus (Boophilus) (2,6%). La séroprévalence globale a été de 9,1±0,03%. Les communes de Harikanassou et Kiota ont été celles où les fortes prévalences ont été observées de 26,7 ± 12,9% et 22,5 ±12,9%. Le virus de la FHCC est en circulation chez la population animale, alors des investigations doivent être faites chez la population humaine.Mots clés : Anticorps anti-FHCC, Enzyme Linked Immunosorbent Assay Indirecte, Prévalence, Sérums, Tiques. English Title: Crimean-Congo Hemorrhagic Fever (CCHF) ’s Epidemiology in cattle in Boboye’s department of Niger Republic To understand disease transmission by ticks, knowledge of population dynamics and distribution of these vectors are essentials. To sought that, the epidemiology of Crimean-Congo Hemorrhagic Fever (CCHF) in Niger Republic was studied by sampling 355 bovines (sera and ticks) in eight (8) local governments in Boboye’s department. Eighteen (18) bovines were sampled for ticks collection per local government making them a total of 144 bovine. Indirect ELISA test (enzyme-linked immunosorbent assay) was used to detect anti- CCHF antibodies. Seventy-two (72) farmers were surveyed on their knowledge on ticks’ ecology, main vectors of CCHF virus. The results revealed that farmers are not using acaricides, and their majority (55/72 thus 76.4%) practice Transhumance. The study allowed the identification of 1342 ticks distributed in 3 genus: Hyalomma (91.7%), Amblyomma (5.7%) and Rhipicephalus (Boophilus) (2.6%). The global seroprevalence against CCHF was (9.1 ± 0.03) %. Harikanassou and Kiota were the most affected local governments with respectively (26.7±12.9) % and (22.5±12,9) % prevalence. CCHV virus is circulating in animal population, so investigations must be made in human population. Keywords: Anti-CCHF antibodies, Indirect Enzyme Linked Immunosorbent Assay, Prevalence, Sera, Ticks.

Download Full-text

Detection of the RNA for new multicomponent virus in patients with Crimean-Congo hemorrhagic fever in southern Russia

Annals of the Russian academy of medical sciences ◽

10.15690/vramn1192 ◽

2020 ◽

Author(s):

Vladimir Ternovoi ◽

Anastasia Gladysheva ◽

Alexandra Sementsova ◽

Anna Zaykovskaya ◽

Anna Volynkina ◽

...

Keyword(s):

Phylogenetic Analyses ◽

Hemorrhagic Fever ◽

European Part ◽

Viral Rna ◽

Crimean Congo Hemorrhagic Fever ◽

Viral Genomes ◽

Cchf Virus ◽

European Part Of Russia ◽

Human Sera ◽

Southern Russia

Background: Recently, a new multicomponent RNA-containing virus was described and called as Jingmen tick virus (JMTV) supposedly belonging to flaviviruses. A virus consists of four viral particles and JMTV was firstly isolated from ticks in China and South America. Aims: Detection viral RNA specific for JMTV complex, sequencing genome fragments and taxonomy identification novel virus from JMTV complex in patients with Crimean-Congo hemorrhagic fever (CCHF) from southern European part of Russia. Materials and methods: Panel of 20 randomly selected sera from patients with confirmed Crimean-Congo hemorrhagic fever was collected in 2016 and was used for detection JMTV and CCHF viral RNA by PCR with experimental primers. Subsequent sequencing of isolated fragments of viral genomes was used for identification JMTV and CCHF virus genetic materials and phylogenetic analyses. Results: The viral RNAs of the CCHF virus and JMTV were detected in blood of four patients. Sequencing of the isolated PCR fragment of S segment CCHF virus allowed identifying these RNA isolates as Europe 1 lineage, subgroups Va and Vb of the CCHF virus that is a typical for the southern European part of the Russia. The nucleotide sequences of segment 2 (GP glycoprotein) of the JMTV were also detected by RP PCR and sequencing in these human sera. The new JMTV isolates were clustered together by phylogenetic analysis. The level of nucleotide identity for newly discovered JMTV isolates was only about 81-82% with comparison to the previously described European variants (Kosovo) of the JMTV. Conclusions: The results suggest that viral genomic RNA for new multicomponent flavivirus named as Manych virus and related to the JMTV complex was discovered in sera of CCHF patients in Russia.

Download Full-text

Molecular Assay on Detection of Crimean Congo Hemorrhagic Fever (CCHF) Virus in Ixodid Ticks Collected from Livestock in Slaughterhouse from South of Iran

Journal of Arthropod-Borne Diseases ◽

10.18502/jad.v14i3.4562 ◽

2020 ◽

Author(s):

Mostafa Salehi-Vaziri ◽

Hassan Vatandoos ◽

Alireza Sanei-Dehkordi ◽

Mehdi Fazlalipour ◽

Mohammad Hassan Pouriayevali ◽

...

Keyword(s):

Tick Infestation ◽

Hemorrhagic Fever ◽

The Body ◽

Ixodid Ticks ◽

Public Health Issue ◽

Hard Tick ◽

Crimean Congo Hemorrhagic Fever ◽

Hard Ticks ◽

Slaughter House ◽

Cchf Virus

Background: Ticks are vectors of a wide variety of pathogens that can be transmitted to humans, and tick-borne diseases are a significant public health issue worldwide. The present study was carried out on the hard tick infestation of livestock transported to Rafsanjan slaughter house in the southeast of Iran. Methods: A cross-sectional survey was carried out biweekly from April to September 2016 to determine tick infestation of the meat-producing animals. All the livestock included in our study were thoroughly inspected for the presence of hard ticks on different parts of their bodies. Results: A total of 258 hard ticks were collected from the body of livestock hosts. The ticks that were sampled were classified into two genera and five species: Hyalomma marginatum, Hy. anatolicum, Hy. asiaticum, Hy. dromedarii, and Rhipicephalus sanguineus. Hyalomma dromedarii was the most abundant species in the study area. More than 50 percent of the sampled ticks were collected from the body of camels brought to the slaughter house however molecular analysis showed no Crimean Congo Hemorrhagic Fever (CCHF) virus infection in tick specimens. The Sex ratio of the sampled hard ticks shows that female tick infestation was more common among the study livestock. Conclusion: Due to the crucial role of hard ticks in the transmission of different pathogens to humans, additional investigations are necessary to determine the risk of consumption of infested meat-producing animals in the study area.

Download Full-text

Crimean-Congo Hemorrhagic Fever in Iraq During 2010

The Iraqi Journal of Veterinary Medicine ◽

10.30539/iraqijvm.v36i0e.388 ◽

2012 ◽

Vol 36 (0E) ◽

pp. 99-103

Author(s):

Emad S. Abul-Eis ,

Keyword(s):

Human Serum ◽

Hemorrhagic Fever ◽

Zoonotic Disease ◽

Immunoglobulin M ◽

Serum Samples ◽

Crimean Congo Hemorrhagic Fever ◽

Human Serum Samples ◽

Specific Immunoglobulin ◽

Cchf Virus

Crimean-Congo hemorrhagic fever (CCHF) is a viral zoonotic disease with a highmortality rate in humans. CCHF is caused by genus Nairovirus, in family of Bunyaviridae,and is transmitted to humans through the bite of ticks Hyalomma spp or contact with blood ortissues of CCHF patients or infected livestock.The total numbers of positive patients to CCHF virus was 11 out of 44 suspected sampleswere examined from eight provinces during the period from January to December 2010 . Theway of transmission is due to contact with blood and tissues of infected animals, and onepatient slaughtered sheep in his house. ELISA was used to detect Crimean-Congohemorrhagic fever (CCHF) virus-specific immunoglobulin M (IgM) in human serum samples.

Download Full-text

Emerging diseases: Crimean-Congo hemorrhagic fever

Medicinski pregled ◽

10.2298/mpns0410453k ◽

2004 ◽

Vol 57 (9-10) ◽

pp. 453-456 ◽

Cited By ~ 4

Author(s):

Nada Kuljic-Kapulica

Keyword(s):

Eastern Europe ◽

Central Asia ◽

Hemorrhagic Fever ◽

Emerging Diseases ◽

Control Measures ◽

Ixodid Ticks ◽

Sub Saharan Africa ◽

Antibody Detection ◽

Crimean Congo Hemorrhagic Fever ◽

Cchf Virus

Introduction Recognized for many years in central Asia and Eastern Europe, Crimean-Congo hemorrhagic fever (CCHF) is a severe zoonotic disease which affects people coming into contact with livestock or ticks. The range of the CCHF virus is now known to extend form central Asia to India, Pakistan, Afghanistan, Iran, Iraq, the Middle East, Eastern Europe, and to most of Saharan and sub-Saharan Africa. Etiology CCHF virus is a member of the Bunyavirus family, and is classified as a Nairovirus. Clinical features After an incubation period of approximately 3 to 6 days the abrupt onset of acute febrile illness occurs. The first symptoms are similar to severe influenza and include fever, headache, severe back and abdominal pain. The hemorrhagic fever manifestations occur after several days of illnesses and include petechial rash, ecchymoses, hematemmesis, and melenna. Cases typically present with some form of hepatitis. The mortality rate is 10-50% in different outbreaks with deaths typically occurring during the second week of illness. Epidemiology The genus Hyalomma of ixodid ticks is the most important vector of the CCHF virus. Vertebrates including birds and small animals provide excellent amplifier hosts of both the virus and the tick. The virus can be transmitted to humans by direct contact with infected animals and from person to person. Diagnosis Early diagnosis is possible in special laboratories using antigen detection by imunofluorescence or ELISA tests or molecular methods as PCR and antibody detection. Control Tick control measures need to be emphasized and utilized to prevent CCHF. This includes spraying camp sites, clothing and danger areas with acaricides or repellent. Strict isolation of patients with CCHF and a focus on barrier nursing would help to prevent nosocomial spread. Presently the vaccine is a dangerous mouse brain-derived version. Future development of a vaccine would help to prevent human infection.

Download Full-text