SOX9 and SF1 are involved in cyclic AMP-mediated upregulation of anti-Müllerian gene expression in the testicular prepubertal Sertoli cell line SMAT1

2011 ◽  
Vol 301 (3) ◽  
pp. E539-E547 ◽  
Author(s):  
Celina Lasala ◽  
Helena F. Schteingart ◽  
Nassim Arouche ◽  
Patricia Bedecarrás ◽  
Romina P. Grinspon ◽  
...  
Keyword(s):  
Cyclic Amp ◽  
Cell Line ◽  
Sertoli Cell ◽  
Nuclear Translocation ◽  
Targeted Mutagenesis ◽  
Signaling Cascades ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Alternative Pathways ◽  
Sertoli Cell Line

In Sertoli cells, anti-Müllerian hormone (AMH) expression is upregulated by FSH via cyclic AMP (cAMP), although no classical cAMP response elements exist in the AMH promoter. The response to cAMP involves NF-κB and AP2; however, targeted mutagenesis of their binding sites in the AMH promoter do not completely abolish the response. In this work we assessed whether SOX9, SF1, GATA4, and AP1 might represent alternative pathways involved in cAMP-mediated AMH upregulation, using real-time RT-PCR (qPCR), targeted mutagenesis, luciferase assays, and immunocytochemistry in the Sertoli cell line SMAT1. We also explored the signaling cascades potentially involved. In qPCR experiments, Amh, Sox9, Sf1, and Gata4 mRNA levels increased after SMAT1 cells were incubated with cAMP. Blocking PKA abolished the effect of cAMP on Sox9, Sf1, and Gata4 expression, inhibiting PI3K/PKB impaired the effect on Sf1 and Gata4, and reducing MEK1/2 and p38 MAPK activities curtailed Gata4 increase. SOX9 and SF1 translocated to the nucleus after incubation with cAMP. Mutations of the SOX9 or SF1 sites, but not of GAT4 or AP1 sites, precluded the response of a 3,063-bp AMH promoter to cAMP. In conclusion, in the Sertoli cell line SMAT1 cAMP upregulates SOX9, SF1, and GATA4 expression and induces SOX9 and SF1 nuclear translocation mainly through PKA, although other kinases may also participate. SOX9 and SF1 binding to the AMH promoter is essential to increase the activity of the AMH promoter in response to cAMP.

Alternation of Cellular Morphology and Proliferation Induced by microRNA in Human Leukemia Cell Line, UT-7/EPO.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 4203-4203
Author(s):  
Nobuyoshi Kosaka ◽  
Yusuke Yamamoto ◽  
Nami Nogawa ◽  
Keiichi Sugiura ◽  
Hiroshi Miyazaki ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Cell Line ◽  
Cell Lines ◽  
Macrocytic Anemia ◽  
Leukemia Cell ◽  
Leukemia Cell Line ◽  
Human Leukemia ◽  
Mrna Levels ◽  
Rt Pcr ◽  
Morphological Studies

Abstract Mature microRNA (miRNA) originated from primary miRNA (pri-miRNA) is a new group of potential regulator for cell differentiation, apoptosis, proliferation and oncogenesis. Some miRNAs were recently identified in hematopoietic cells, while the roles of miRNAs in erythrocytic and megakaryocytic cells had not been well examined. As a first step to explore for miRNAs specific for hematopoietic lineage, the expressions of several known primary microRNAs in erythrocytic and megakaryocytic cell lines, such as TF-1, HL-60, HEK293 and UT-7 leukemia cells, were examined by RT-PCR. We consequently focused on the pri-miR-10a, a primary transcript of miR-10a located within Hox gene clusters, and found the significant expression in TF-1 cells and UT-7/EPO cells. The UT-7/EPO cells were a subline established from the original UT-7 cells, as well as UT-7/GM and UT-7/TPO cells; therefore it was suitable for the further comparative analysis. Interestingly, in UT-7/EPO cells, the expression of pri-miR-10a increased under stimulation of erythropoietin (EPO; 1U/mL and 10U/mL). Based on these observations, it was postulated that pri-miR-10a might involve in modulating erythrocyte differentiation or proliferation. To clarify the role of pri-miR-10a in UT-7/EPO, we have established clonal cell lines by transfecting UT-7/EPO cells with either the control vector or the pri-miR-10a expression vector pCMV-pri-miR10a. Overexpression of pri-miR-10a in the UT-7/EPO cell line (miR10a-UT-7/EPO) was confirmed by RT-PCR. MiR10a-UT-7/EPO showed higher proliferation rate even at low concentration of EPO (0.1 mU/mL). Overexpression of pri-miR-10a did not appear to affect HOXB4 and HOXA1 expression, as similar mRNA levels were seen in both cell lines. It was notable that the cellular size of miR10a-UT-7/EPO became larger than its parental cells. Morphological studies of miR10a-UT-7/EPO were performed in detail. It is possible that miR-10a was capable to modulate morphological features particularly in cellular size relating to cell cycle regulation. For instance, loss of the E2F family members result in marked macrocytic anemia with megaloblastic features in adult mice (Mol Cell. 2000 Aug;6(2):281–91., Mol Cell Biol. 2003 May;23(10):3607–22., Blood. 2006 Aug 1;108(3):886–95.). Data presented here hypothesized that the roles of miR-10a in erythroid cells are tightly associated with cell cycle.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4247-4247
Author(s):  
Antonio Russo ◽  
Filomena Conforti ◽  
Maria Cristina Caroleo ◽  
Roberta Ionà ◽  
Giancarlo Statti ◽  
...  
Keyword(s):  
Cell Growth ◽  
Western Blot ◽  
Cell Line ◽  
Blot Analysis ◽  
Proliferative Activity ◽  
Methanolic Extract ◽  
Mrna Levels ◽  
Cynara Cardunculus ◽  
Rt Pcr ◽  
K562 Cell Line

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

Establishment and characterization of porcine Sertoli cell line for the study of xenotransplantation

2007 ◽  
Vol 14 (2) ◽  
pp. 112-118 ◽  
Author(s):  
Hak-Mo Lee ◽  
Byoung Chol Oh ◽  
Dong-Pyo Lim ◽  
Dong-Sup Lee ◽  
Jaejin Cho ◽  
...  
Keyword(s):  
Cell Line ◽  
Sertoli Cell ◽  
Sertoli Cell Line

Procholecystokinin and proenkephalin A mRNA expression is modulated by cyclic AMP and noradrenaline

1990 ◽  
Vol 4 (1) ◽  
pp. 37-41 ◽  
Author(s):  
H. J. Monstein ◽  
R. Folkesson ◽  
T. Geijer
Keyword(s):  
Cyclic Amp ◽  
Cell Line ◽  
Neuroblastoma Cell ◽  
Neuroblastoma Cell Line ◽  
Human Neuroblastoma Cell ◽  
Mrna Levels ◽  
Human Neuroblastoma ◽  
Hybridization Probes ◽  
Adrenoceptor Agonist ◽  
Proenkephalin A

ABSTRACT Regulation of the expression of procholecystokinin (proCCK) and proenkephalin A mRNA was studied in the human neuroblastoma cell line SK-N-MC. Cells were treated with dibutyryl-3′,5′-cyclic AMP (dbcAMP), noradrenaline or isoproterenol, a β-adrenoceptor agonist. Levels of proCCK and proenkephalin A mRNA were determined by Northern blot analysis with proCCK- and proenkephalin A-specific cRNA hybridization probes 9 h after drug treatments. ProCCK and proenkephalin A mRNA were co-expressed in SK-N-MC cells. ProCCK mRNA levels were increased 1·5–2·5 times by dbcAMP, noradrenaline and isoproterenol when compared with controls. The level of proenkephalin A mRNA increased approximately two to three times under the same drug conditions, whereas the level of N-myc mRNA did not change significantly. These results suggest that expression of proCCK and proenkephalin A mRNA may be regulated by a similar cAMP-dependent mechanism in the SK-N-MC cell line.

Establishment of a Mouse Sertoli Cell Line Producing Rat Androgen-binding Protein (ABP)

Steroids ◽  
1998 ◽  
Vol 63 (5-6) ◽  
pp. 285-287 ◽  
Author(s):  
Angélique Ducray ◽  
Michèle Bloquel ◽  
Ketsia Hess ◽  
Geoffrey L. Hammond ◽  
Hubert Gérard ◽  
...  
Keyword(s):  
Cell Line ◽  
Sertoli Cell ◽  
Binding Protein ◽  
Androgen Binding Protein ◽  
Androgen Binding ◽  
Sertoli Cell Line
Sign in / Sign up

Export Citation Format

Share Document