scholarly journals miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

2013 ◽  
Vol 2013 ◽  
pp. 1-7 ◽  
Author(s):  
Assyl Bari ◽  
Saltanat Orazova ◽  
Anatoliy Ivashchenko
Keyword(s):  
Binding Sites ◽  
Protein Coding ◽  
Coding Sequences ◽  
Interaction Sites ◽  
Plant Genes ◽  
Binding Sequence

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of theSPLandHAMgenes inA. thaliana. miRNAs from the miR156 and miR157 families inA. thalianaare shown to have binding sites within the mRNAs ofSPLgenes. The ath-miR156a–j binding sites located in the mRNAs of theSPLparalogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of theSPLfamily at the same site. We suggest merging the miR156 and miR157 families into one family. SeveralSPLgenes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 inHAM1,HAM2, andHAM3paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within theHAM1,HAM2, andHAM3miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

Avoidance of Truncated Proteins from Unintended Ribosome Binding Sites within Heterologous Protein Coding Sequences

2014 ◽  
Vol 4 (3) ◽  
pp. 249-257 ◽  
Author(s):  
Weston R. Whitaker ◽  
Hanson Lee ◽  
Adam P. Arkin ◽  
John E. Dueber
Keyword(s):  
Binding Sites ◽  
Heterologous Protein ◽  
Protein Coding ◽  
Coding Sequences ◽  
Ribosome Binding ◽  
Ribosome Binding Sites

scholarly journals Draft Genome Sequence of Urease-Producing Pseudorhodobacter sp. Strain E13, Isolated from the Yellow Sea in Gunsan, South Korea

2019 ◽  
Vol 8 (23) ◽  
Author(s):  
Si Chul Kim ◽  
Hyo Jung Lee
Keyword(s):  
South Korea ◽  
Genome Sequence ◽  
Yellow Sea ◽  
Draft Genome ◽  
The Yellow Sea ◽  
Draft Genome Sequence ◽  
Protein Coding ◽  
Coding Sequences ◽  
Gram Negative ◽  
Content Type

Here, we report the draft genome sequence of Pseudorhodobacter sp. strain E13, a Gram-negative, aerobic, nonflagellated, and rod-shaped bacterium which was isolated from the Yellow Sea in South Korea. The assembled genome sequence is 3,878,578 bp long with 3,646 protein-coding sequences in 159 contigs.

scholarly journals A Modified Autonomous En Transposon in Maize (Zea mays L.) Elicits a Differential Response of Reporter Alleles

Genetics ◽  
1997 ◽  
Vol 147 (3) ◽  
pp. 1329-1338
Author(s):  
Peter A Peterson
Keyword(s):  
Molecular Structure ◽  
Binding Sites ◽  
Molecular Basis ◽  
Zea Mays L ◽  
Phenotypic Expression ◽  
Terminal Inverted Repeat ◽  
Coding Sequences ◽  
Defective Element ◽  
Related Element ◽  
Unstable Genes

Transposable elements in maize are composed of a defined molecular structure that includes coding sequences, determiners of functionality and ordered terminal motifs that provide binding sites for transposase proteins. Alterations in these components change the phenotypic expression of unstable genes with transposon inserts. The molecular basis for the altered timing and frequency of transposition as determined by the size and number of spots on kernels or stripes on leaves has generally been described for defective inserts in genes. Most differential patterns can be ascribed to alterations in the terminal motifs of the reporter allele structure that supplies a substrate (terminal inverted repeat motifs) for transposase activity. For autonomously functioning alleles, the explanations for changes in phenotype are not so clear. In this report, an En-related element identified as F-En is described that shares with En the recognition of a specific defective element c1(mr)888104 but differs from En in that this F-En element does not recognize the canonical c1(mr) elements that are recognized by En. Evidence is provided suggesting that F-En does not recognize other En/Spm-related defective elements, some of whose sequences are known. This modified En arose from a c1-m autonomously mutating En allele.

scholarly journals Evolutionary Patterns of Sex-Biased Genes in Three Species of Haplodiploid Insects

Insects ◽  
2020 ◽  
Vol 11 (6) ◽  
pp. 326
Author(s):  
Yu-Jun Wang ◽  
Hua-Ling Wang ◽  
Xiao-Wei Wang ◽  
Shu-Sheng Liu
Keyword(s):  
Gene Expression ◽  
Slow Rate ◽  
Species Complex ◽  
Evolutionary Patterns ◽  
Protein Coding ◽  
Coding Sequences ◽  
Species Comparisons ◽  
Differential Gene ◽  
Males And Females ◽  
And Behavior

Females and males often differ obviously in morphology and behavior, and the differences between sexes are the result of natural selection and/or sexual selection. To a great extent, the differences between the two sexes are the result of differential gene expression. In haplodiploid insects, this phenomenon is obvious, since males develop from unfertilized zygotes and females develop from fertilized zygotes. Whiteflies of the Bemisia tabaci species complex are typical haplodiploid insects, and some species of this complex are important pests of many crops worldwide. Here, we report the transcriptome profiles of males and females in three species of this whitefly complex. Between-species comparisons revealed that non-sex-biased genes display higher variation than male-biased or female-biased genes. Sex-biased genes evolve at a slow rate in protein coding sequences and gene expression and have a pattern of evolution that differs from those of social haplodiploid insects and diploid animals. Genes with high evolutionary rates are more related to non-sex-biased traits—such as nutrition, immune system, and detoxification—than to sex-biased traits, indicating that the evolution of protein coding sequences and gene expression has been mainly driven by non-sex-biased traits.

scholarly journals Draft Genome Sequences of 10 Clinical K2-Type Klebsiella pneumoniae Strains Isolated in Russia

2018 ◽  
Vol 7 (14) ◽  
Author(s):  
Nikolay V. Volozhantsev ◽  
Angelina A. Kislichkina ◽  
Anastasia I. Lev ◽  
Ekaterina V. Solovieva ◽  
Vera P. Myakinina ◽  
...  
Keyword(s):  
Intensive Care Unit ◽  
Klebsiella Pneumoniae ◽  
Draft Genome ◽  
Capsular Type ◽  
Genome Sequences ◽  
Protein Coding ◽  
Coding Sequences ◽  
Content Type ◽  
Neurosurgical Intensive Care ◽  
Neurosurgical Intensive Care Unit

We report here the genome sequences of 10 Klebsiella pneumoniae strains of capsular type K2 isolated in Russia from patients in an infectious clinical hospital and neurosurgical intensive care unit. The draft genome sizes range from 5.34 to 5.87 Mb and include 5,448 to 6,137 protein-coding sequences.

scholarly journals Genome Sequence of Rheinheimera salexigens sp. nov. Isolated from a Fishing Hook off O‘ahu, Hawai‘i

2016 ◽  
Vol 4 (6) ◽  
Author(s):  
Xuehua Wan ◽  
Shaobin Hou ◽  
Kazukuni Hayashi ◽  
James Anderson ◽  
Stuart P. Donachie
Keyword(s):  
Genome Sequence ◽  
Draft Genome ◽  
Draft Genome Sequence ◽  
Protein Coding ◽  
Coding Sequences ◽  
Coding Regions ◽  
Roche 454

Rheinheimera salexigens KH87 T is an obligately halophilic gammaproteobacterium. The strain’s draft genome sequence, generated by the Roche 454 GS FLX+ platform, comprises two scaffolds of ~3.4 Mbp and ~3 kbp, with 3,030 protein-coding sequences and 58 tRNA coding regions. The G+C content is 42 mol%.

scholarly journals Draft Genome Sequence of Freshwater-Derived Streptomyces sp. Strain BPSDS2, Isolated from Damte Stream, Northeast India

2019 ◽  
Vol 8 (43) ◽  
Author(s):  
Zothanpuia ◽  
Ajit Kumar Passari ◽  
Purbajyoti Deka ◽  
Vinay Rajput ◽  
Lakshmi P. M. Priya ◽  
...  
Keyword(s):  
Genome Sequence ◽  
Draft Genome ◽  
Northeast India ◽  
Draft Genome Sequence ◽  
Freshwater Sediments ◽  
Protein Coding ◽  
Coding Sequences ◽  
Content Type ◽  
Streptomyces Sp

We report the draft genome sequence of Streptomyces sp. strain BPSDS2, isolated from freshwater sediments in Northeast India. The draft genome has a size of 8.27 Mb and 7,559 protein-coding sequences.

scholarly journals Stability of SARS-CoV-2 Phylogenies

2020 ◽  
Author(s):  
Yatish Turakhia ◽  
Bryan Thornlow ◽  
Landen Gozashti ◽  
Angie S. Hinrichs ◽  
Jason D. Fernandes ◽  
...  
Keyword(s):  
Binding Sites ◽  
Sequence Data ◽  
Scientific Discovery ◽  
Lineage Tracing ◽  
Protein Coding ◽  
Sequencing Errors ◽  
Scientific Inference ◽  
Recurrent Mutations ◽  
Sequence Quality ◽  
Essential Sequence

AbstractThe SARS-CoV-2 pandemic has led to unprecedented, nearly real-time genetic tracing due to the rapid community sequencing response. Researchers immediately leveraged these data to infer the evolutionary relationships among viral samples and to study key biological questions, including whether host viral genome editing and recombination are features of SARS-CoV-2 evolution. This global sequencing effort is inherently decentralized and must rely on data collected by many labs using a wide variety of molecular and bioinformatic techniques. There is thus a strong possibility that systematic errors associated with lab-specific practices affect some sequences in the repositories. We find that some recurrent mutations in reported SARS-CoV-2 genome sequences have been observed predominantly or exclusively by single labs, co-localize with commonly used primer binding sites and are more likely to affect the protein coding sequences than other similarly recurrent mutations. We show that their inclusion can affect phylogenetic inference on scales relevant to local lineage tracing, and make it appear as though there has been an excess of recurrent mutation and/or recombination among viral lineages. We suggest how samples can be screened and problematic mutations removed. We also develop tools for comparing and visualizing differences among phylogenies and we show that consistent clade- and tree-based comparisons can be made between phylogenies produced by different groups. These will facilitate evolutionary inferences and comparisons among phylogenies produced for a wide array of purposes. Building on the SARS-CoV-2 Genome Browser at UCSC, we present a toolkit to compare, analyze and combine SARS-CoV-2 phylogenies, find and remove potential sequencing errors and establish a widely shared, stable clade structure for a more accurate scientific inference and discourse.ForewordWe wish to thank all groups that responded rapidly by producing these invaluable and essential sequence data. Their contributions have enabled an unprecedented, lightning-fast process of scientific discovery---truly an incredible benefit for humanity and for the scientific community. We emphasize that most lab groups with whom we associate specific suspicious alleles are also those who have produced the most sequence data at a time when it was urgently needed. We commend their efforts. We have already contacted each group and many have updated their sequences. Our goal with this work is not to highlight potential errors, but to understand the impacts of these and other kinds of highly recurrent mutations so as to identify commonalities among the suspicious examples that can improve sequence quality and analysis going forward.

Sign in / Sign up

Export Citation Format

Share Document