scholarly journals A Modified Autonomous En Transposon in Maize (Zea mays L.) Elicits a Differential Response of Reporter Alleles

Genetics ◽  
1997 ◽  
Vol 147 (3) ◽  
pp. 1329-1338
Author(s):  
Peter A Peterson
Keyword(s):  
Molecular Structure ◽  
Binding Sites ◽  
Molecular Basis ◽  
Zea Mays L ◽  
Phenotypic Expression ◽  
Terminal Inverted Repeat ◽  
Coding Sequences ◽  
Defective Element ◽  
Related Element ◽  
Unstable Genes

Transposable elements in maize are composed of a defined molecular structure that includes coding sequences, determiners of functionality and ordered terminal motifs that provide binding sites for transposase proteins. Alterations in these components change the phenotypic expression of unstable genes with transposon inserts. The molecular basis for the altered timing and frequency of transposition as determined by the size and number of spots on kernels or stripes on leaves has generally been described for defective inserts in genes. Most differential patterns can be ascribed to alterations in the terminal motifs of the reporter allele structure that supplies a substrate (terminal inverted repeat motifs) for transposase activity. For autonomously functioning alleles, the explanations for changes in phenotype are not so clear. In this report, an En-related element identified as F-En is described that shares with En the recognition of a specific defective element c1(mr)888104 but differs from En in that this F-En element does not recognize the canonical c1(mr) elements that are recognized by En. Evidence is provided suggesting that F-En does not recognize other En/Spm-related defective elements, some of whose sequences are known. This modified En arose from a c1-m autonomously mutating En allele.

scholarly journals GENERAL CHARACTERISTICS OF INFLUENZA VIRUS A MOLECULAR STRUCTURE

2018 ◽  
pp. 13-19
Author(s):  
Deryabina Nina ◽  
Gritsenko Dilyara ◽  
Galiakparov Nurbol
Keyword(s):  
Molecular Structure ◽  
Influenza Virus ◽  
Binding Sites ◽  
Molecular Structures ◽  
Effective Vaccine ◽  
Clear Understanding ◽  
Human Species ◽  
The World ◽  
Critical Regions ◽  
Effective Drugs

The influenza virus is one of the most abundant viruses in the world. It causes both mild seasonal infections and severe pandemics killing thousands of people and mammals. Two main extracellular receptors – neuraminidase (NA) and hemagglutinin (HA) are responsible for infection symptoms development and spread. Error-prone RNA-polymerase incorporates mutations into both neuraminidase and hemagglutinin per replication cycle, which complicates the development of highly effective drugs against animal influenza. Incorporated mutations are also involved in the transition of influenza from animal to human species and vice versa. Transited influenza subtypes are the most dangerous, because it is unpredictable now, where the mutation might arise. However, it starts to become clear, which molecular regions are the most common for the mutation to occur. This article revises the molecular structure of influenza extracellular receptors, including critical regions of receptors binding sites and susceptible mutation sites. The clear understanding of molecular structures and critical regions of HA and NA might facilitate the development of an effective vaccine and/or drug development.

scholarly journals miR156- and miR171-Binding Sites in the Protein-Coding Sequences of Several Plant Genes

2013 ◽  
Vol 2013 ◽  
pp. 1-7 ◽  
Author(s):  
Assyl Bari ◽  
Saltanat Orazova ◽  
Anatoliy Ivashchenko
Keyword(s):  
Binding Sites ◽  
Protein Coding ◽  
Coding Sequences ◽  
Interaction Sites ◽  
Plant Genes ◽  
Binding Sequence

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of theSPLandHAMgenes inA. thaliana. miRNAs from the miR156 and miR157 families inA. thalianaare shown to have binding sites within the mRNAs ofSPLgenes. The ath-miR156a–j binding sites located in the mRNAs of theSPLparalogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of theSPLfamily at the same site. We suggest merging the miR156 and miR157 families into one family. SeveralSPLgenes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 inHAM1,HAM2, andHAM3paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within theHAM1,HAM2, andHAM3miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

scholarly journals Molecular Structure and Novel DNA Binding Sites Located in Loops of Flap Endonuclease-1 fromPyrococcus horikoshii

2002 ◽  
Vol 277 (40) ◽  
pp. 37840-37847 ◽  
Author(s):  
Eriko Matsui ◽  
Krishnasastry V. Musti ◽  
Junko Abe ◽  
Kazuhiko Yamasaki ◽  
Ikuo Matsui ◽  
...  
Keyword(s):  
Molecular Structure ◽  
Dna Binding ◽  
Binding Sites ◽  
Flap Endonuclease 1 ◽  
Dna Binding Sites

scholarly journals Anticipation in an Indo-Canadian Family with Crohn's Disease

2001 ◽  
Vol 15 (10) ◽  
pp. 695-698 ◽  
Author(s):  
Hugh J Freeman ◽  
Noel B Hershfield
Keyword(s):  
Crohn’S Disease ◽  
Crohn's Disease ◽  
Neurological Disorders ◽  
Molecular Basis ◽  
Present Report ◽  
Phenotypic Expression ◽  
Apparent Increase ◽  
The Family ◽  
Perianal Sepsis ◽  
Common Environmental Factor

Genetic anticipation, associated elsewhere with monogenic neurological disorders, has been hypothesized to be present in familial forms of Crohn's disease. Usually, with studies of parent-child pairs, the parent who is initially diagnosed is older at the onset of disease than the child. With each successive generation, an apparent increase in disease severity or behaviour occurs. This phenomenon is believed to have a molecular basis. In the present report, an Indo-Canadian family with Crohn's disease is described. In all members of the family, disease was diagnosed only after prolonged residence in Canada, supporting the view that Crohn's disease arises in individuals with a genetic predisposition following exposure to some, as yet unknown, common environmental factor. Three siblings with Crohn's disease, first diagnosed between ages 15 and 27 years, or six to 11 years after arrival in Canada, had phenotypically concordant disease localized in the ileum and colon, with fistulizing complications, including perianal sepsis. Crohn's disease was only diagnosed in the father at the age of 76 years, almost three decades after his arrival in Canada. His disease was localized to the ileum and had a fibrostenosing behaviour. This is the first reported instance of familial Crohn's disease in an immigrant population, illustrating potential biases in genetically based studies of Crohn's disease that rely solely on phenotypic expression.

scholarly journals Cytomegalovirus Basic Phosphoprotein (pUL32) Binds to Capsids In Vitro through Its Amino One-Third

2001 ◽  
Vol 75 (15) ◽  
pp. 6865-6873 ◽  
Author(s):  
Michael K. Baxter ◽  
Wade Gibson
Keyword(s):  
Molecular Structure ◽  
Binding Sites ◽  
Sequence Conservation ◽  
Binding Region ◽  
Present Evidence ◽  
Tegument Proteins ◽  
Infected Cells ◽  
Human Cmv

ABSTRACT The cytomegalovirus (CMV) basic phosphoprotein (BPP) is a component of the tegument. It remains with the nucleocapsid fraction under conditions that remove most other tegument proteins from the virion, suggesting a direct and perhaps tight interaction with the capsid. As a step toward localizing this protein within the molecular structure of the virion and understanding its function during infection, we have investigated the BPP-capsid interaction. In this report we present evidence that the BPP interacts selectively, through its amino one-third, with CMV capsids. Radiolabeled simian CMV (SCMV) BPP, synthesized in vitro, bound to SCMV B-capsids, and C-capsids to a lesser extent, following incubation with either isolated capsids or lysates of infected cells. Human CMV (HCMV) BPP (pUL32) also bound to SCMV capsids, and SCMV BPP likewise bound to HCMV capsids, indicating that the sequence(s) involved is conserved between the two proteins. Analysis of SCMV BPP truncation mutants localized the capsid-binding region to the amino one-third of the molecule—the portion of BPP showing the greatest sequence conservation between the SCMV and HCMV homologs. This general approach may have utility in studying the interactions of other proteins with conformation-dependent binding sites.

scholarly journals A universal pocket in Fatty acyl-AMP ligases ensures redirection of fatty acid pool away from Coenzyme A-based activation

eLife ◽  
2021 ◽  
Vol 10 ◽  
Author(s):  
Gajanan Shrikant Patil ◽  
Priyadarshan Kinatukara ◽  
Sudipta Mondal ◽  
Sakshi Shambhavi ◽  
Ketan D Patel ◽  
...  
Keyword(s):  
Fatty Acids ◽  
Binding Sites ◽  
Molecular Basis ◽  
Coenzyme A ◽  
Acyl Carrier Protein ◽  
Fatty Acyl ◽  
Carrier Protein ◽  
Binding Pockets ◽  
Fatty Acid Pool ◽  
Do So

Fatty acyl-AMP ligases (FAALs) channelize fatty acids towards biosynthesis of virulent lipids in mycobacteria and other pharmaceutically or ecologically important polyketides and lipopeptides in other microbes. They do so by bypassing the ubiquitous coenzyme A-dependent activation and rely on the acyl carrier protein-tethered 4'-phosphopantetheine (holo-ACP). The molecular basis of how FAALs strictly reject chemically identical and abundant acceptors like coenzyme A (CoA) and accept holo-ACP unlike other members of the ANL superfamily remains elusive. We show FAALs have plugged the promiscuous canonical CoA-binding pockets and utilize highly selective alternative binding sites. These alternative pockets can distinguish adenosine 3', 5'-bisphosphate-containing CoA from holo-ACP and thus FAALs can distinguish between CoA and holo-ACP. These exclusive features helped identify the omnipresence of FAAL-like proteins and their emergence in plants, fungi, and animals with unconventional domain organisations. The universal distribution of FAALs suggests they are parallelly evolved with FACLs for ensuring a CoA-independent activation and redirection of fatty acids towards lipidic metabolites.

Sign in / Sign up

Export Citation Format

Share Document