Attractant for Vinegar Fly, Drosophila busckii, and Cluster Fly, Pollenia rudis (Diptera: Drosophilidae et Calliphoridae)

2009 ◽  
Vol 64 (3-4) ◽  
pp. 267-270 ◽  
Author(s):  
Vincas Būda ◽  
Sandra Radžiutė ◽  
Erikas Lutovinovas
Keyword(s):  
Field Test ◽  
Methyl Salicylate ◽  
Sticky Traps ◽  
First Report ◽  
Baited Traps ◽  
Vinegar Fly ◽  
The Mean ◽  
Dipteran Species ◽  
Drosophila Busckii

A field test carried out in an industrial greenhouse in Lithuania revealed the attractiveness of synthetic methyl salicylate (MeSa) to two dipteran species: the vinegar fl y, Drosophila busckii (Drosophilidae), and the cluster fl y, Pollenia rudis (Calliphoridae). The attractant for the former fl y species was especially effective, as sticky traps containing 0.25 ml of MeSa captured (814 ± 55) D. busckii flies/trap on average compared to (12 ± 4) flies/trap in control traps. The mean capture of P. rudis [(42 ± 4) flies/trap] was significantly higher in MeSa-baited traps compared to the control traps [(13 ± 4) flies/trap]. The presence of MeSa in emissions of many fruits suitable for D. busckii feeding allows to attribute this attractant to kairomones. In case of P. rudis, MeSa should be attributed to synomones (compounds beneficial for both receiver and sender), because adult flies feeding on flowers act as pollinators. This is the first report on the field-active attractant for D. busckii and the second for P. rudis.

scholarly journals Field Efficacy of Two Ixodicide Collars, 1995

1997 ◽  
Vol 22 (1) ◽  
pp. 401-401
Author(s):  
A. Estrada-Pefia ◽  
F. Ascher
Keyword(s):  
Field Test ◽  
Beagle Dogs ◽  
Brown Dog Tick ◽  
Field Efficacy ◽  
Natural Infestation ◽  
The Mean ◽  
Dog Tick ◽  
Tick Load

Abstract Ixodicidal activity of two collars against the brown dog tick was verified by a field test in northeast Spain, following the tick load on dogs over a 4-month period. Collars were a 9% Amitraz (AMZ) (Preventic®, Virbac) and a Propoxur + Flumethrin (PPX) (Kiltix®, Bayer) formulation. For this field test, we used 30 adult Beagle dogs, in 2 groups of 10 each, with each collar, and a third group of 10 dogs with only placebo collar to serve as the check. After collar fitting, and every week, dogs were allowed to walk freely across a periurban area, heavily infested with ticks. Counts of ticks were done 3 days after each natural infestation. Natural infestations were carried out while the mean number of ticks/check dog was equal to or higher than 10, allowing a total of 8 infestations. Ticks were counted as alive unfed females, alive feeding females, dead unfed females, and dead feeding females.

scholarly journals Trapping for invasive crayfish: comparisons of efficacy and selectivity of baited traps versus novel artificial refuge traps

2018 ◽  
pp. 15 ◽  
Author(s):  
Nicky Green ◽  
Matt Bentley ◽  
Paul Stebbing ◽  
Demetra Andreou ◽  
Robert Britton
Keyword(s):  
Ecological Impacts ◽  
Catch Per Unit Effort ◽  
Metal Base ◽  
Baited Traps ◽  
Trapping Method ◽  
Invasive Crayfish ◽  
Trapping Methods ◽  
Body Sizes ◽  
The Mean ◽  
Native Crayfish

Non-native crayfish can dominate the invertebrate biomass of invaded freshwaters, with their high ecological impacts resulting in their populations being controlled by numerous methods, especially trapping. Although baited funnel traps (BTs) are commonly used, they tend to be selective in mainly catching large-bodied males. Here, the efficacy and selectivity of BTs were tested against an alternative trapping method based on artificial refuges (ARTs) that comprised of a metal base with several tubes (refuges) attached. The target species was signal crayfish Pacifastacus leniusculus in an upland river in southwest England. Trapping was completed in April to October over two consecutive years. In total, 5897 crayfish were captured, with 87% captured in ARTs. Comparison of the catch per unit effort (CPUE) between the trapping methods in the same 24 hour periods revealed significantly higher CPUE in ARTs than of BTs. ARTs fished for 6 consecutive days had higher catches than both methods over 24 hours. Whilst catches in BTs were significantly dominated by males (1.49M:1F), the sex ratio of catches in ARTs was 0.99M:1F. The mean carapace length of crayfish was also significantly larger in BTs (43.2 ± 0.6 mm) than in ARTs (33.6 ± 0.2 mm). Thus, ARTs had higher CPUE over 24 hour and 6 day periods versus BTs and also captured a greater proportion of smaller and female individuals. These results indicate that when trapping methods are deployed for managing invasions, the use of ARTs removes substantial numbers of crayfish of both sexes and of varying body sizes.

Hypokinesis in Rats Induced by a Schizophrenic Mimicking Compound

1967 ◽  
Vol 25 (3) ◽  
pp. 889-892
Author(s):  
Eleanor Machale ◽  
Evans Mandes
Keyword(s):  
Open Field ◽  
Field Test ◽  
Open Field Test ◽  
Activity Level ◽  
Post Injection ◽  
Baseline Activity ◽  
The Mean

An experiment was performed to study the effects of a schizophrenic mimicking compound (B 3,4 Dimethoxyphenel-ethalamine) on the activity of rats. Baseline activity was derived for two groups of 10 rats each during four 3-min. trials in an open-field test. 2.8 g/kg weight of the drug or placebo was then injected into the rats. They were run at 50-min. intervals. The activity level of the post-injection trials was compared with the mean baseline activity within and between the groups. The activity level of the compound-injected group decreased significantly as predicted.

scholarly journals Scavenging behaviour by Ergalatax contractus (Gastropoda: Muricidae) and interactions with Nassarius nodifer (Gastropoda: Nassariidae) in the Cape d'Aguilar Marine Reserve, Hong Kong

2006 ◽  
Vol 86 (1) ◽  
pp. 141-152 ◽  
Author(s):  
Brian Morton
Keyword(s):  
Hong Kong ◽  
Field Experiments ◽  
Marine Reserve ◽  
Flowing Water ◽  
Large Numbers ◽  
Baited Traps ◽  
Behavioural Characteristics ◽  
Shallow Subtidal ◽  
The Mean ◽  
Mean Time

Aspects of the feeding behaviour of Ergalatax contractus (Muricidae) were studied. Field experiments demonstrated that large numbers of individuals of this species, comprising ∼90% of a suite of gastropod scavengers, were attracted to baited traps in the subtidal sands of Lobster Bay, Cape d'Aguilar Marine Reserve, Hong Kong. Laboratory experiments identified the effective chemo-detection distances of E. contractus as 60 cm in still and >80 cm in flowing water, respectively. The average times to arrival at bait in still and flowing water were 92.3 and 69.0 min, respectively, but were significantly less for individuals experiencing a longer period of starvation. The mean time taken for E. contractus to consume a meal was 70.6 min.Comparisons were made between Ergalatax contractus and Nassarius nodifer, representative of a suite of sympatric scavenging nassariids in Lobster Bay. The nassariid arrived significantly faster at bait in both still (30.2 min) and flowing water (20.8 min) than E. contractus and fed faster (25.7 min), as is typical of representatives of the Nassariidae. Although the two species partition carrion resources temporally, manipulation experiments provided evidence for inter-specific competition between them. That is, although E. contractus possesses the morphological and behavioural characteristics of a predator, its opportunistic scavenging abilities have led to its success and numerical superiority on the shallow subtidal sands of Lobster Bay. The dominance of E. contractus in Lobster Bay, and elsewhere in Hong Kong, is unusual. Here, the normally predatory E. contractus, far outnumbers all other scavengers, possibly because of an enhanced, largely allochthonous, supply of food which it is able to exploit by virtue of its previously identified opportunistic habit of scavenging the leftovers of other predators. The presence of inter-specific competition between E. contractus and a sympatric suite of nassariids enhances, not impedes, carrion exploitation.

Efficacy of antiaggregants for the pine engraver, Ipspini (Coleoptera: Scolytidae)

1994 ◽  
Vol 24 (12) ◽  
pp. 2469-2476 ◽  
Author(s):  
D.R. Devlin ◽  
J.H. Borden
Keyword(s):  
Untreated Control ◽  
Ground Surface ◽  
High Rate ◽  
High Dose ◽  
Dose Rates ◽  
Pine Engraver ◽  
Baited Traps ◽  
Initial Release ◽  
The Mean ◽  
Lodgepole Pines

The responses of pine engravers, Ipspini (Say), in British Columbia to ipsdienol-baited traps containing low, medium, and high dose rates of the antiaggregants verbenone and ipsenol, released from impregnated polyethylene and polypropylene beads, respectively, remained significantly lower than responses to ipsdienol-baited control traps throughout the spring. During the summer, the responses remained low only in traps containing medium and high dose rates of impregnated beads. Antiaggregant treatment densities of 100 and 400 bubble cap release points per hectare reduced the numbers of pine engravers caught in ipsdienol-baited, multiple-funnel traps by 66.1 and 76.8%, respectively. In 50 × 50 m thinning-simulation plots treated with a broadcast distribution of antiaggregant-impregnated beads in 1990, 32.9% of the felled lodgepole pines, Pinuscontorta Dougl., were attacked; in untreated control plots, 53.1% were attacked. The mean attack density per square metre of available bark surface in the treated plots (1.3) was significantly lower than that in the untreated plots (1.9); however, where attack occurred there was no difference (8.8 and 9.4 attacks/m2, respectively). In a 1991 experiment, verbenone- and ipsenol-impregnated beads were applied to 15 × 15 m thinning-simulation plots at initial release rates of 2.5 mg of verbenone and 0.05 mg of ipsenol per square metre of ground surface per day, and at double these rates. For three treatments, low and high rates 3 weeks prior to the first attack by I. pini and a high rate 2 weeks prior to attack, the mean attacks per square metre of available bark surface per week were reduced by 77.1, 82.9, and 97.1%, respectively, compared with attacks on felled pines in untreated control plots. The results of these experiments suggest that a timely application of broadcast antiaggregants would prevent the development of an outbreak population of I. pini.

scholarly journals First Report of Eggplant mottled dwarf virus in Pittosporum tobira in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
C. Córdoba-Sellés ◽  
T. Tornos ◽  
M. C. Cebrián ◽  
M. I. Font
Keyword(s):  
Plant Viruses ◽  
Dwarf Virus ◽  
Eastern Coast ◽  
Rt Pcr ◽  
Pcr Assay ◽  
Specific Primers ◽  
First Report ◽  
Type Isolate ◽  
The Mean ◽  
Pittosporum Tobira

In 2009, Pittosporum tobira (Thunb.) Ait. plants showing virus-like symptoms were observed in two ornamental greenhouses in two regions of the eastern coast of Spain (Tarragona and Valencia). Affected plants showed veinal yellowing and interveinal yellow mottling on the leaves. In addition, surveys conducted in 2010 in three public gardens in Valencia revealed 4% of P. tobira plants grown as hedges showed similar, but less severe symptoms. Five symptomatic and five asymptomatic P. tobira leaves were collected and analyzed by double antibody sandwich-ELISA using polyclonal antisera for Alfalfa mosaic virus (AMV) (SEDIAG S.A.S., Longvic, France) and Eggplant mottled dwarf virus (EMDV) (Deutsche Sammlung von Mikroorganismen und Zellkulturen Gmbh [DSMZ], Braunschweig, Germany). Samples were considered positive only if the mean absorbance value of duplicate wells was more than three times the mean absorbance of healthy control leaf samples. Only the five symptomatic samples tested positive for EMDV in the serological analyses. To confirm the results, a pair of EMDV-specific primers was designed using the published sequence of a fragment of the EMDV polymerase gene available in GenBank (Accession No. AM922322): EMDV-D (5′ TATGCGAGAATTGGGAGTGGGTAGT 3′) and EMDV-R (5′ CATTGTTATCCCGGGAAGTATTT 3′) targeting a 400-bp fragment. Total RNA was extracted from the symptomatic leaves and tested by reverse transcription (RT)-PCR assay with specific primers for AMV (4) and the primer pair designed for EMDV. The type isolate (EMDV-PV-0031, DSMZ) was used as a positive control sample in the serological and molecular analyses. None of the samples tested positive for AMV. The same five symptomatic samples that tested positive in the serological assays also tested positive for EMDV in the RT-PCR assay. Two RT-PCR products amplified from RNA of symptomatic P. tobira leaves and one from the type isolate were purified and directly sequenced. BLAST analyses of two sequences from infected P. tobira leaves (Accession Nos. HM636918 and HM636919) revealed 90% nucleotide identity to both the EMDV-Egg isolate (Accession No. AM922322) and the type isolate (EMDV-PV-0031, DSMZ), and 98% similarity among the P. tobira isolates. EMDV was first reported in the Canary Islands, Spain (3), and later was detected in the northeastern peninsular Spain on cucumber and eggplant (1). Although EMDV has been described as affecting P. tobira in countries such as Italy, Libya, and the former Yugoslavia (3), to our knowledge, this is the first report of EMDV infecting P. tobira in Spain. EMDV is generally considered of minor importance. However, P. tobira infection might have epidemiological consequences for susceptible cultivated crops such as eggplant or cucumber. Moreover, where P. tobira is used as a vegetatively propagated ornamental plant, EMDV could be transmitted from infected plants by the leafhopper vector (2). References: (1) J. Aramburu et al. Plant Pathol. 55:565, 2006. (2) G. H. Babaie and K. Izadpanah. J. Phytopathol. 151:679, 2003. (3) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Version: 20. Retrieved from http://biology.anu.edu.au/Groups/MES/vide/ , August, 1996. (4) L. Martínez-Priego et al. Plant Dis. 88:908, 2004.

scholarly journals First Report of Powdery Mildew (Microsphaera palczewskii) on Siberian Pea Tree (Caragana arborescens) in North America

Plant Disease ◽  
2003 ◽  
Vol 87 (4) ◽  
pp. 451-451 ◽  
Author(s):  
C. Nischwitz ◽  
G. Newcombe
Keyword(s):  
North America ◽  
Powdery Mildew ◽  
First Report ◽  
Powdery Mildews ◽  
Leaf Surfaces ◽  
Mean Diameter ◽  
Caragana Arborescens ◽  
The Mean ◽  
Northern United States ◽  
The U.S

Caragana arborescens Lam. is an exotic ornamental that can also be somewhat invasive. In July 2002, powdery mildew was observed on C. arborescens along the Idaho-Washington border in Moscow and Pullman, respectively. Leaves were colonized as soon as they emerged, and entire plants were affected. The fungus covered both leaf surfaces, but cleistothecia were more abundant on abaxial surfaces. The mean diameter of the cleistothecia was 91 (± 9.8) μm. Short-stalked asci averaged 67 (± 7.1) μm × 37 (± 5.2) μm, and the ascospores were 21 (± 2.0) μm × 13 (± 0.8) μm. There are records of four species of Microsphaera on C. arborescens in Europe and Asia. The measurements fit the description of Microsphaera palczewskii Jacz. (1), and the identification was confirmed by comparison with specimens of this fungus on C. arborescens from Sweden (U.S. National Fungus Collections: BPI 749057 and 749058). Specimens of M. grossulariae (Wallr. ex Fr.) Lev. on Ribes divaricatum Dougl. from California (BPI 558266) were also examined, but the cleistothecial appendages were distinctly different from those of the Idaho specimens. To our knowledge, this is the first reported occurrence in North America of powdery mildew on C. arborescens and the first report of M. palczewskii. The latter may have been introduced recently into North America because there are areas in southern Canada and the northern United States in which C. arborescens is unaffected by powdery mildew. Interestingly, it is only in recent decades that M. palczewskii has spread from Asia into Europe (2). Now, host and parasite have been reunited in North America as well. Specimens have been deposited in the U.S. National Fungus Collections (BPI). References: (1) U. Braun. A monograph of the Erysiphales (powdery mildews) J. Cramer, Berlin-Stuttgarg, 1987. (2) S. Huhtinen et al. Karstenia 41:31, 2001.

scholarly journals Pengembangan Perangkat Pembelajaran IPA Berbasis Guided Inquiry

2020 ◽  
Vol 3 (2) ◽  
pp. 125
Author(s):  
Nur’aini Nur’aini ◽  
Muhammad Danial ◽  
Sugiarti Sugiarti
Keyword(s):  
Field Test ◽  
Lesson Plan ◽  
Descriptive Analysis ◽  
Learning Tools ◽  
Guided Inquiry ◽  
Design Development ◽  
Analysis Technique ◽  
The Mean ◽  
D Model ◽  
Academic Year

This study is development research, which aims at producing guided inquiry-based IPA (Natural Sciences) learning tools in energy and life system subject which is valid, practical, and effective, discovering the level of validity, practicality, and effectiveness of guided inquiry-based IPA learning tools in energy and life system subject developed. The development of learning tools employed Thiagarajan (Four-D) model which consists of four stages, namely defining, design, development, and dissemination. The test of learning tools was conducted to the students of grade VII.1 at SMPN 36 Makassar of academic year 2018/2019. Data collecting employed observation sheet and questionnaire. The data were then analyzed by using descriptive analysis technique. The products produce in this study are the lesson plan (RPP), student’s worksheet (LKPD), and student’s textbook (BAPD). The results of the validation on the learning tools developed, it is obtained the mean score based on the assessors which met the valid criteria and all of the components of learning tools are valued as reliable. The result of the field test on the practicality of learning tools developed shows that there is consistency between the result of experts’ perceptions and observers’, which is both gave high criteria or good. The learning tools are also effective to be applied because the result of the field test indicates that there is consistency between the result of experts’ perceptions and observers’. The result of experts perceptions gave the effectiveness result with high criteria or good. The result of observation on four indicators of effective criteria were all met.

scholarly journals Can Mating Disruption Be a Possible Route to Control Plum Fruit Moth in Mediterranean Environments?

Insects ◽  
2020 ◽  
Vol 11 (9) ◽  
pp. 589
Author(s):  
Gabriella Lo Verde ◽  
Salvatore Guarino ◽  
Stefano Barone ◽  
Roberto Rizzo
Keyword(s):  
Mating Disruption ◽  
Solid Phase ◽  
Economic Damage ◽  
Infestation Level ◽  
Essential Factor ◽  
Field Exposure ◽  
Pheromone Emission ◽  
Baited Traps ◽  
The Mean ◽  
Number Of Males

Control of the plum fruit moth, Grapholita funebrana Treitschke (Lepidoptera: Tortricidae), has been mainly based on the use of chemical insecticides, which can cause undesirable side effects, leading to a growing interest towards alternative sustainable strategies. The aim of this study was to evaluate the effect of the mating disruption technique on G. funebrana infestation in plum orchards, by comparing the number of male captures in pheromone-baited traps, and evaluating the damage to fruits in plots treated with the pheromone dispersers and in control plots. The study was carried out in 2012 and 2014 in three organic plum orchards, on the cultivars Angeleno, Friar, President and Stanley. To evaluate the pheromone emission curve of the dispensers from the openings to the end of the trials, a chemical analysis was carried out by solid phase micro-extraction followed by gas chromatography, followed by mass spectrometry. In all years and orchards the mean number of males caught in traps placed in the treatment plots was always significantly lower than untreated plots. Pheromone emission from the dispensers was highest at the opening, and was still considerable at 54 days of field exposure, while it significantly decreased after 72 days of field exposure. Cultivar was confirmed to be an essential factor in determining the fruit infestation level. Pheromone treatment significantly reduced fruit infestation, but not economic damage.

scholarly journals Decreased Sensitivity of Leptosphaeria maculans to Pyraclostrobin in Alberta, Canada

Plant Disease ◽  
2020 ◽  
Vol 104 (9) ◽  
pp. 2462-2468
Author(s):  
Yixiao Wang ◽  
Alireza Akhavan ◽  
Sheau-Fang Hwang ◽  
Stephen E. Strelkov
Keyword(s):  
Brassica Napus ◽  
Growth Inhibition ◽  
Growth Plate ◽  
Leptosphaeria Maculans ◽  
Fungal Growth ◽  
Microtiter Plate ◽  
Single Spore ◽  
First Report ◽  
Fungal Populations ◽  
The Mean

Leptosphaeria maculans, the causal agent of blackleg of canola (Brassica napus), can be managed with pyraclostrobin and other strobilurin fungicides. Their frequent application, however, poses a risk for the development of insensitivity in fungal populations. A collection of L. maculans single-spore isolates recovered from infected canola stubble in Alberta, Canada, in 2016 was evaluated for its pyraclostrobin sensitivity. In conventional growth plate assays, the concentration of pyraclostrobin required to inhibit fungal growth by 50% (EC50) was determined to be 0.28 mg/liter in a subset of 38 isolates. This EC50 was four times greater than the mean EC50 (0.07 mg/liter) of baseline isolates collected in 2011. Two hundred sixty-three isolates were screened further with two discriminatory doses of 0.28 and 3.5 mg/liter of pyraclostrobin, resulting in growth inhibition values ranging from 16 to 82% and 41 to 100%, respectively. In microtiter plate assays with the same isolates, the mean EC50 was determined to be 0.0049 mg/liter, almost 3.3 times greater than the mean EC50 (0.0015 mg/liter) of the baseline isolates. The sensitivity of the isolates was also evaluated in microtiter plate assays with discriminatory doses of 0.006 and 0.075 mg/liter of pyraclostrobin, resulting in inhibition values ranging from 20 to 88% and 49 to 100%, respectively. This is the first report of isolates of L. maculans with increased insensitivity to pyraclostrobin in Canada, suggesting the need for improved fungicide stewardship.

Sign in / Sign up

Export Citation Format

Share Document