Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

2021 ◽  
Vol 6 (2) ◽  
pp. 295-302
Author(s):  
Denia Dwi Citra Resmi ◽  
Topik Hidayat ◽  
Siti Sriyati
Keyword(s):  
Phylogenetic Tree ◽  
In Silico ◽  
Dna Barcode ◽  
In Silico Analysis ◽  
Molecular Data ◽  
Rapid Identification ◽  
Current Status ◽  
Chloroplast Genomes ◽  
Unidentified Species ◽  
The Relationship

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.

In Silico Study of 1, 4 Alpha Glucan Branching Enzyme and Substrate Docking Studies

2020 ◽  
Vol 17 (1) ◽  
pp. 40-50
Author(s):  
Farzane Kargar ◽  
Amir Savardashtaki ◽  
Mojtaba Mortazavi ◽  
Masoud Torkzadeh Mahani ◽  
Ali Mohammad Amani ◽  
...  
Keyword(s):  
Phylogenetic Tree ◽  
In Silico ◽  
Alpha Helix ◽  
In Silico Analysis ◽  
Glycogen Storage ◽  
Docking Studies ◽  
Random Coil ◽  
Special Topic ◽  
Industrial Biotechnology ◽  
In Silico Study

Background: The 1,4-alpha-glucan branching protein (GlgB) plays an important role in the glycogen biosynthesis and the deficiency in this enzyme has resulted in Glycogen storage disease and accumulation of an amylopectin-like polysaccharide. Consequently, this enzyme was considered a special topic in clinical and biotechnological research. One of the newly introduced GlgB belongs to the Neisseria sp. HMSC071A01 (Ref.Seq. WP_049335546). For in silico analysis, the 3D molecular modeling of this enzyme was conducted in the I-TASSER web server. Methods: For a better evaluation, the important characteristics of this enzyme such as functional properties, metabolic pathway and activity were investigated in the TargetP software. Additionally, the phylogenetic tree and secondary structure of this enzyme were studied by Mafft and Prabi software, respectively. Finally, the binding site properties (the maltoheptaose as substrate) were studied using the AutoDock Vina. Results: By drawing the phylogenetic tree, the closest species were the taxonomic group of Betaproteobacteria. The results showed that the structure of this enzyme had 34.45% of the alpha helix and 45.45% of the random coil. Our analysis predicted that this enzyme has a potential signal peptide in the protein sequence. Conclusion: By these analyses, a new understanding was developed related to the sequence and structure of this enzyme. Our findings can further be used in some fields of clinical and industrial biotechnology.

scholarly journals Class A β-lactamases and inhibitors: In silico analysis of the binding mode and the relationship with resistance

2018 ◽  
Vol 279 ◽  
pp. 37-46
Author(s):  
Rebeca Pereira ◽  
Vitor Won-Held Rabelo ◽  
Alexander Sibajev ◽  
Paula Alvarez Abreu ◽  
Helena Carla Castro
Keyword(s):  
In Silico ◽  
In Silico Analysis ◽  
Binding Mode ◽  
Class A ◽  
The Relationship ◽  
Silico Analysis

scholarly journals Cloning, Sequencing, and In Silico Analysis of β-Propeller Phytase Bacillus licheniformis Strain PB-13

2014 ◽  
Vol 2014 ◽  
pp. 1-11 ◽  
Author(s):  
Vinod Kumar ◽  
Gopal Singh ◽  
Punesh Sangwan ◽  
A. K. Verma ◽  
Sanjeev Agrawal
Keyword(s):  
Phylogenetic Tree ◽  
Bacillus Licheniformis ◽  
In Silico ◽  
Catalytic Mechanism ◽  
Specific Activity ◽  
In Silico Analysis ◽  
Homology Search ◽  
Multiple Sequence ◽  
Bioinformatic Tools ◽  
C Terminus

β-Propeller phytases (BPPhy) are widely distributed in nature and play a major role in phytate-phosphorus cycling. In the present study, a BPPhy gene from Bacillus licheniformis strain was expressed in E. coli with a phytase activity of 1.15 U/mL and specific activity of 0.92 U/mg proteins. The expressed enzyme represented a full length ORF “PhyPB13” of 381 amino acid residues and differs by 3 residues from the closest similar existing BPPhy sequences. The PhyPB13 sequence was characterized in silico using various bioinformatic tools to better understand structural, functional, and evolutionary aspects of BPPhy class by multiple sequence alignment and homology search, phylogenetic tree construction, variation in biochemical features, and distribution of motifs and superfamilies. In all sequences, conserved sites were observed toward their N-terminus and C-terminus. Cysteine was not present in the sequence. Overall, three major clusters were observed in phylogenetic tree with variation in biophysical characteristics. A total of 10 motifs were reported with motif “1” observed in all 44 protein sequences and might be used for diversity and expression analysis of BPPhy enzymes. This study revealed important sequence features of BPPhy and pave a way for determining catalytic mechanism and selection of phytase with desirable characteristics.

scholarly journals Novel Insights into the Existence of the Putative UDP-Glucuronate 5-Epimerase Specificity

Catalysts ◽  
2020 ◽  
Vol 10 (2) ◽  
pp. 222 ◽  
Author(s):  
Ophelia Gevaert ◽  
Stevie Van Overtveldt ◽  
Matthieu Da Costa ◽  
Koen Beerens ◽  
Tom Desmet
Keyword(s):  
Phylogenetic Tree ◽  
In Silico ◽  
Molecular Level ◽  
In Silico Analysis ◽  
Current Work ◽  
Skin Extract ◽  
Rabbit Skin ◽  
Uniprot Database ◽  
Silico Analysis

C5-epimerases are promising tools for the production of rare l-hexoses from their more common d-counterparts. On that account, UDP-glucuronate 5-epimerase (UGA5E) attracts attention as this enzyme could prove to be useful for the synthesis of UDP-l-iduronate. Interestingly, l-iduronate is known as a precursor for the production of heparin, an effective anticoagulant. To date, the UGA5E specificity has only been detected in rabbit skin extract, and the respective enzyme has not been characterized in detail or even identified at the molecular level. Accordingly, the current work aimed to shed more light on the properties of UGA5E. Therefore, the pool of putative UGA5Es present in the UniProt database was scrutinized and their sequences were clustered in a phylogenetic tree. However, the examination of two of these enzymes revealed that they actually epimerize UDP-glucuronate at the 4- rather than 5-position. Furthermore, in silico analysis indicated that this should be the case for all sequences that are currently annotated as UGA5E and, hence, that such activity has not yet been discovered in nature. The detected l-iduronate synthesis in rabbit skin extract can probably be assigned to the enzyme chondroitin-glucuronate C5-epimerase, which catalyzes the conversion of d-glucuronate to l-iduronate on a polysaccharide level.

scholarly journals Isolasi dan Karakterisasi Barcode DNA Tanaman Nusa indah putih (Mussaenda frondosa) Berdasarkan Gen matK

Jurnal MIPA ◽  
2015 ◽  
Vol 4 (2) ◽  
pp. 111
Author(s):  
Jein Damanis ◽  
Lidya Irma Momuat ◽  
Meiske S. Sangi ◽  
Maureen Kumaunang
Keyword(s):  
Polymerase Chain Reaction ◽  
In Silico ◽  
Dna Barcode ◽  
In Silico Analysis ◽  
Chain Reaction ◽  
Plant Dna ◽  
Barcode Dna ◽  
Reverse Primer ◽  
Polymerase Chain ◽  
Silico Analysis

Telah dilakukan penelitian untuk menentukan urutan nukleotida dari barcode DNA tanaman Nusa indah putih berdasarkan gen matK dan mengkarakterisasi matK tanaman nusa indah putih dengan analisis in-silico. Isolasi DNA dari tanaman Nusa indah putih telah dilakukan berdasarkan manual prosedur dari InnuPrep Plant DNA kit yang dilanjutkan dengan amplifikasi dengan metode Polymerase Chain Reaction (PCR) menggunakan primer forward matK-1RKIM-f dan primer reverse matK-3FKIM-r kemudian dielektroforesis dan disekuensing. Sekuensing tanaman  Nusa  indah  putih  menghasilkan  kromatogram  yang  berkualitas  tinggi, dengan panjang sekuens 843 bp. Hasil Analisis in-silico menunjukan matK tanaman nusa indah putih bersifat basa, stabil, dan berinteraksi baik dengan air.A study to determine the nucleotide sequence of the DNA barcode Nusa indah putih plants based on gene matK and to characterize the matK of Nusa indah putih plant using in-silico analysis had been done. Isolation of DNA from Nusa indah putih plant was conducted by manual procedures of InnuPrep Plant DNA kit, followed by amplification using Polymerase Chain Reaction (PCR) method using matK-1RKIM-f as forward primer and matK-3FKIM-r as reverse primer then electrophoresis and sequenced. Nusa indah putih plants sequencing produced a high-quality chromatogram produce, with a length of 843 bp sequences. Results of in-silico analysis showed that matK Nusa indah putih plant is a base, stable, and well-interacted with water.

scholarly journals Penentuan Barcode DNA berdasarkan Gen matK dan Analisis In-silico MatK Rumput Macan (Lantana camara L.)

Jurnal MIPA ◽  
2015 ◽  
Vol 4 (1) ◽  
pp. 24
Author(s):  
Billy L. Mokoagow
Keyword(s):  
Polymerase Chain Reaction ◽  
In Silico ◽  
Dna Barcode ◽  
In Silico Analysis ◽  
Lantana Camara ◽  
Chain Reaction ◽  
Barcode Dna ◽  
Matk Gene ◽  
Polymerase Chain ◽  
Silico Analysis

DNA barcoding merupakan metode identifikasi spesies menggunakan potongan DNA pendek yang disebut barcode DNA. Gen matK merupakan gen standar untuk penentuan  barcode DNA tanaman. Penelitian ini bertujuan untuk menentukan barcode DNA tumbuhan rumput macan (L. camara L.) berdasarkan gen matK, serta melakukan analisis in-silico terhadap produk gen matK tumbuhan rumput macan (L. camara L.) dengan kerabat terdekatnya. Gen matK L. camara L. telah berhasil diamplifikasi dengan Polymerase Chain Reaction (PCR) menggunakan primer forward matK-1RKIM-f dan primer reverse matK-3FKIM-r. Analisis terhadap sekuens matK L. camara L. menunjukkan bahwa barcode DNA tumbuhan rumput macan (L. camara L.) terdiri dari 843 nukleotida. Selanjutnya, hasil analisis in-silico menunjukkan bahwa matK Lantana camara L. bersifat basa, stabil, dan dapat berinteraksi baik dengan air.DNA barcoding is a method of species identification using short pieces of DNA called DNA barcode. matK is a standard gene to determine DNA barcode of a plant. The aim of this research was to determine the DNA barcode of Rumput Macan plant (Lantana camara L.) based on matK gene, as well as in-silico analysis of the product matK gene Rumput Macan (L camara L.) with its closest relatives. L. camara L. matK gene was successfully amplified by Polymerase Chain Reaction (PCR) using forward primer MATK-1RKIM-f and reverse primer MATK-3FKIM-r. Analysis of the matK sequence of L. camara L. showed that the barcode DNA of rumput macan plant (L. camara L.) consisting of 843 nucleotides. Furthermore, the result of in-silico analysis showed that the matK of L camara L. is alkaline, stable, and able to interact well with water.

scholarly journals Identifikasi Barcode Tumbuhan Gedi Merah (Abelmoschus manihot L. medik) dan Gedi Hijau (Abelmoschus moschatus) Berdasarkan Gen matK

Jurnal MIPA ◽  
2014 ◽  
Vol 3 (2) ◽  
pp. 120
Author(s):  
Yusuf R. Fattah ◽  
Vanda S. Kamu ◽  
Max R. J. Runtuwene ◽  
Lidya I. Momuat
Keyword(s):  
Polymerase Chain Reaction ◽  
Dna Barcoding ◽  
In Silico ◽  
Dna Barcode ◽  
In Silico Analysis ◽  
Chain Reaction ◽  
Barcode Dna ◽  
Matk Gene ◽  
Polymerase Chain ◽  
Silico Analysis

Gedi (Abelmoschus L.) merupakan tumbuhan tropis. Tumbuhan ini memilki efek farmakologis. Masyarakat Minahasa mengkonsumsi daun gedi yang direbus tanpa diberi bumbu sebagai obat tradisional untuk menurunkan kadar kolesterol, antihipertensi dan antidiabetes. Suatu metode baru untuk mengidentifikasi dan menganalisis keanekaragaman genetika spesies telah dikembangkan dengan menggunakan potongan gen standar yang dikenal dengan teknik DNA barcoding. Salah satu gen yang terdapat pada tumbuhan yaitu gen matK telah digunakan sebagai gen standar untuk barcoding. Pada penelitian ini telah dilakukan isolasi DNA total dan gen matK penanda barcode DNA dari gedi merah dan gedi hijau, serta analisis in-silico terhadap produk gen matK gedi merah, gedi hijau, dan kerabat terdekatnya. Gen matK diisolasi dan diamplifikasi menggunakan metode Polymerase Chain Reaction (PCR) menggunakan primer forward (5’-CGTACAGTACTTTTGTGTTT ACGAG-3’) dan primer reverse (5’-ACCCAGTCCATCTGGAAATCTTGGTTC-3’). Hasil pengurutan nukleotida DNA barcode matK menunjukkan bahwa sebanyak 828 pb matK berhasil diisolasi untuk tumbuhan gedi merah dan tumbuhan gedi hijau. Urutan nukleotida matK gedi merah dan gedi hijau menunjukkan tingkat kemiripan yang tinggi, yaitu > 95%. Selain itu, hasil analisis in-silico menunjukkan bahwa protein MatK gedi dan kerabat terdekatnya bersifat hidrofobik.Gedi (Abelmoschus L.) is a tropical plant. This plant has the pharmacological effects. Minahasan people consumed boiled gedi without any spices addition to lower cholesterol level, blood pressure, and glucose level. A new method for identifying and analyzing the genetic diversity of species has been developed using standard gene known as DNA barcoding technique. One of the genes found in plants called matK gene was used as standard for DNA barcoding. In this research, identification of DNA barcode of red gedi and green gedi based on matK gene, and in-silico analysis on the matK gene products of red gedi, green gedi, and its closest relatives gedi have been done. matK gene was isolated with Polymerase Chain Reaction (PCR) using forward primer (5'-CGTACAGTACTTTTGTGTTTACGAG-3') and reverse primer (5'-ACCCAGTCCATCTGGAAATCTTGGTTC-3'). Barcode DNA of red and green gedi showed 828 bp nucleotide sequence based on matK gene. In addition, matK of both gedi showed high similarity, i.e. >95%. Furthermore, in-silico analysis of MatK gedi and its closest relative showed that this protein is hidrophobic.

scholarly journals In silico analysis of Simple Sequence Repeats from chloroplast genomes of Solanaceae species

2009 ◽  
Vol 9 (4) ◽  
pp. 344-352 ◽  
Author(s):  
E.V. Tambarussi ◽  
D.M. Melotto-Passarin ◽  
S.G. Gonzalez ◽  
J.B. Brigati ◽  
F.A. Jesus ◽  
...  
Keyword(s):  
Simple Sequence Repeats ◽  
In Silico ◽  
In Silico Analysis ◽  
Chloroplast Genomes ◽  
Solanaceae Species ◽  
Silico Analysis ◽  
Simple Sequence

First molecular phylogeny of Agrilus (Coleoptera: Buprestidae), the largest genus on Earth, with DNA barcode database for forestry pest diagnostics

2018 ◽  
Vol 109 (2) ◽  
pp. 200-211 ◽  
Author(s):  
I. Kelnarova ◽  
E. Jendek ◽  
V.V. Grebennikov ◽  
L. Bocak
Keyword(s):  
Species Identification ◽  
Northern Hemisphere ◽  
Phylogenetic Trees ◽  
Dna Barcode ◽  
Intraspecific Variability ◽  
Molecular Data ◽  
Rapid Identification ◽  
Species Group ◽  
Molecular Phylogenetic ◽  
Multiple Species

AbstractAll more than 3000 species of Agrilus beetles are phytophagous and some cause economically significant damage to trees and shrubs. Facilitated by international trade, Agrilus species regularly invade new countries and continents. This necessitates a rapid identification of Agrilus species, as the first step for subsequent protective measures. This study provides the first DNA reference library for ~100 Agrilus species from the Northern Hemisphere based on three mitochondrial markers: cox1–5′ (DNA barcode fragment), cox1–3′, and rrnL. All 329 Agrilus records available in the Barcode of Life Database format, including specimen images and geo data, are released through a public dataset ‘Agrilus1 329’ available at: dx.doi.org/10.5883/DS-AGRILUS1. All Agrilus species were identified using adult morphology and by using molecular phylogenetic trees, as well as distance- and tree-based algorithms. Most DNA-based species limits agree well with the morphology-based identification. Our results include cases of high intraspecific variability and multiple species para- and polyphyly. DNA barcoding is a powerful species identification tool in Agrilus, although it frequently fails to recover morphologically-delimited Agrilus species-group. Even though the current three-gene database covers only ~3% of the known Agrilus diversity, it contains representatives of all principal lineages from the Northern Hemisphere and represents the most extensive dataset built for DNA-delimited species identification within this genus so far. Molecular data analyses can rapidly and cost-effectively identify an unknown sample, including immature stages and/or non-native taxa, or species not yet formally named.

Sign in / Sign up

Export Citation Format

Share Document