Species discrimination of novel chloroplast DNA barcodes and their application for identification of Panax (Aralioideae, Araliaceae)

Certain species within the genus Panax L. (Araliaceae) contain pharmacological precious ginsenosides, also known as ginseng saponins. Species containing these compounds are of high commercial value and are thus of particular urgency for conservation. However, within this genus, identifying the particular species that contain these compounds by morphological means is challenging. DNA barcoding is one method that is considered promising for species level identification. However, in an evolutionarily complex genus such as Panax, commonly used DNA barcodes such as nrITS, matK, psbA-trnH, rbcL do not provide species-level resolution. A recent in silico study proposed a set of novel chloroplast markers, trnQ-rps16, trnS-trnG, petB, and trnE-trnT for species level identification within Panax. In the current study, the discriminatory efficiency of these molecular markers is assessed and validated using 91 reference barcoding sequences and 38 complete chloroplast genomes for seven species, one unidentified species and one sub-species of Panax, and two outgroup species of Aralia L. along with empirical data of Panax taxa present in Vietnam via both distance-based and tree-based methods. The obtained results show that trnQ-rps16 can classify with species level resolution every clade tested here, including the highly valuable Panax vietnamensis Ha et Grushv. We thus propose that this molecular marker to be used for identification of the species within Panax to support both its conservation and commercial trade.

New records of oribatid mites from Michoacán state, Mexico

Eleven species of oribatid mites are reported from Michoacán state, Mexico for the first time: Ceratozetidae: unidentified species of Adoribatella Woolley, 1967; Damaeidae: Belbodamaeus (Lanibelba) palaciosi (Iglesias & Guzmán, 2012); Eremobelbidae: Eremobelba piffli Mahunka, 1985; Microzetidae: Acaroceras (Acaroceras) similis Balogh, 1962; Nothridae: Nothrus anauniensis Canestrini & Fanzago, 1877; Oppiidae: unidentified species of Cheloppia Hammer, 1971; Oppiella (Oppiella) nova (Oudemans, 1902); Pseudoamerioppia barrancensis (Hammer, 1961); Ramusella (Insculptoppia) merimna (Balogh & Mahunka, 1977); Wallworkoppia cervifer (Mahunka, 1983); and Scheloribatidae: Scheloribates (Scheloribates) elegans Hammer, 1958. The genera Cheloppia and Adoribatella are reported for the first time from Mexico.

Comparison of point and roadside transect methods to evaluate the abundance and richness of diurnal raptors in the arid region of Rajasthan

Diurnal raptors show a wider distribution compared to other groups of birds including passerines, woodpeckers, and seriemas, but occur at lower-than-expected densities. Estimating the precise abundance is essential to achieve conservation goals but the methods used to estimate the populations of birds need to be appropriate to arrive at meaningful conclusions. We compared the two survey methods: roadside point count and strip transects, for estimating species richness and abundance of raptors in the arid landscape of Rajasthan. Roadside point counts and roadside strip transects were done on 50 transects between December 2019- February 2020 (with an average length of 20 km and a total distance of 3000 km) to assess the species richness and abundance of raptors. A total of 2954 observations of raptors belonging to 35 species were recorded using both methods. Mann Whitney U test result showed no significant difference in species richness and abundance estimates between both methods (p = 0.206). The point count method yielded a higher relative abundance of 2.79 individuals [10 km2]-1h-1 than the 1.90 individuals [10 km2]-1h-1 obtained during the strip transect. Also, the number of unidentified species were less for point counts. Extrapolation values indicated that both the methods do not differ much for the detection of unsampled species. The choice of survey method depends on the objectives of the study, but our results favor the use of point counts rather than strip transects to survey raptors in open habitats. The information generated from this study is expected to provide the most efficient method to study the abundance and distribution of raptors in similar landscapes.

Nanocarbon mesh in the flame of aromatic compounds

The soot in the flame of the pyrotechnic composition is presented in a variety of shapes and structures. Part of the dispersed particles consists entirely of carbon. The sizes of such particles are in the submicron range. Another part of the particles contains carbon in the form of nanostructures - needles and tubes. A detailed study of the morphology and chemical composition of dispersed particles on optical and scanning electron microscopes showed the existence of yet another unidentified species of particles - tuba. The resulting formations are micron-sized and retain the properties of nanostructures.

Development of DNA Barcode for Magnoliopsida and Liliopsida using In silico Approaches Based on mat-K Sequences from Chloroplast Genomes

Indonesia has been estimated to contain 20,000 species of Magnoliophyta around the world. The current status of Indonesia's biodiversity shows that only 15.5% of the total flora in Indonesia has been identified. This is such a low percentage, requires researchers to obtain a rapid identification method, so that unidentified species can be grouped, at least at the level of the Magnoliopsida and Liliopsida classes. DNA barcoding is a technique that can be used to quickly identify species based on short sequences of specific regions in the genome. The purpose of this study was to analyze the relationship between Magnoliopsida and Liliopsida plants based on the mat-K marker and to obtain DNA barcodes for each of the Magnoliopsida and Liliopsida classes. This study used an in silico approach because the molecular data about these two selected classes with 101 species for samples are abundant in Genbank NCBI database. The primary design was carried out after analyzing the phylogenetic relationship between Magnoliopsida and Liliopsida. In silico analysis using BioEdit and PAUP to reconstructthe phylogenetic tree based on mat-K DNA showed results that were in line with previous studies. The phylogenetic tree using molecular data confirms that Magnoliopsida is the ancestor of Liliopsida. This study succeeded in obtaining two pairs of specific primers for Magnoliopsida and Liliopsida, which are cttcagtggtacggagtcaaat and gagccaaagttttagcacaagaa for Magnoliopsida, whereas cccatccatatggaaatcttggt and ttgaagccagaattgcttttcc for Liliopsida. These primers can later be used to distinguish the Magnoliopsida group from Liliopsida.

Climate Change Effects On Height-Diameter Allometric Relationship Vary With Tree Species And Size For Larch Plantations In Northern And Northeastern China

Background: Tree height-diameter relationship is very important in forest investigation, understanding forest ecosystem structure and estimating carbon storage. Climate change may modify the relationship. However, our understanding of the effects of climate change on height-diameter allometric growth is still limited at large scale.Methods: In this study, we explore how the climate change effects on height-diameter allometric relationship vary with tree species and size for larch plantations in northern and northeastern China. Based on the repeated measurement data of 535 plots from the 6th to 8th national forest inventory of China, climate-sensitive tree height-diameter models of Larix plantations in north and northeast China were developed by two-level nonlinear mixed effect (NLME) method. The final model was used to analyze the height-diameter relationship of different Larch species under RCP2.6, RCP 4.5, and RCP8.5 climate change scenarios from 2010 to 2100.Results: The values of B(adjusted coefficient of determination), MAE(mean absolute error) and RMSE(root mean squared error) of the NLME models for calibration data were 0.92, 0.76m and 1.06m, respectively. The inclusion of climate variables MAT (Mean annual temperature), CMD (Hargreaves climatic moisture deficit) with random effects was able to increase a by 19.5% and reduce the AIC (Akaike’s information criterion), MAE and RMSE by 22.2%, 44.5% and 41.8%, respectively. The climate sensitivity was ranked as L. gmelinii > the unidentified species group > L. pincipis-rupprechtii > L. kaempferi > L. olgensis under RCP4.5, but L. gmelinii > L. pincipis-rupprechtii > the unidentified species group > L. olgensis > L. kaempferi under RCP2.6 and RCP8.5. Conclusion: According to the climate sensitivity, tree species could be classified as group I(L. gmelinii, L. pincipis-rupprechtii and the unidentified species group) with large c (from -4.77% to 18.17%) and group II (L. kaempferi and L. olgensis) with small k (from -6.37% to 9.4%).Large trees were more sensitive to climate change than small trees.

Postmortem Evaluation of Rabbit Carcasses Using Insect Populations in Keffi Nasarawa State, Nigeria

Untimely, forceful, and unexpected death is inevitable and common worldwide. Evidence for causes of death may be obtained through the knowledge of insects’ successional pattern and postmortem interval on dead carcasses. Two rabbits (Lepus cuniculus) weighing 2.5 kg each were used as the experimental animals. The rabbits were sacrificed by poisoning and stabbing, postmortem evaluation was achieved by taking record of the insect’s successional pattern. The insects’ successional pattern revealed the following insects’ species in order in which they arrived on the carcasses: Musca domestica, Lucilia sericata, Chrysomya albiceps, Dermestes maculatus, and Armadillidium vulgare (usual sp). The family Formicidae were represented by two unidentified species. M. domestica arrived first on the stabbed carcass while L. sericata on poisoned carcass. A total of 105±50 insects were collected throughout the study period, with stabbed rabbit contributing 61±10 and poisoned 44±60 insects’ species. Variation in the number of forensically important insects’ species encountered in the study site did not show any significant difference (p>0.05) in relation to each decomposition stage. There was however a significant difference (p<0.05) between insects’ relative abundance and mode of killing. Insect evidence was found 3 minutes after death on the stabbed carcass and 3 days after on the poisoned carcass. The study has shown that insects' population can be used to establish postmortem evidence in rabbit carcasses.

Phytophthora spp. associated with Appalachian oak forests and waterways in Pennsylvania, with P. abietivora as a pathogen of five native woody plant species.

To document the distribution of potentially harmful Phytophthora spp. within Pennsylvania (PA), the PA Department of Agriculture collected 89 plant, 137 soil, and 48 water samples at 64 forested sites from 2018 to 2020. In total, 231 Phytophthora strains were isolated using baiting assays and identified based on morphological characteristics and sequences of nuclear and mitochondrial loci. Twenty-one Phytophthora spp. in nine clades and one unidentified species were present. Phytophthora abietivora, a recently described clade 7a species, was recovered from diseased tissue of 10 native broadleaved plants and twice from soil from 12 locations. Phytophthora abietivora is most likely endemic to PA based on pathogenicity tests on six native plant species, intraspecific genetic diversity, wide distribution, and recoveries from Abies Mill. and Tsuga Carrière plantations dating back to 1989. Cardinal temperatures and morphological traits are provided for this species. Other taxa, in decreasing order of frequency, include P. chlamydospora, P. plurivora, P. pini, P. cinnamomi, P. xcambivora, P. irrigata, P. gonapodyides, P. cactorum, P. pseudosyringae, P. hydropathica, P. stricta, P. xstagnum, P. caryae, P. intercalaris, Phytophthora ‘bitahaiensis’, P. heveae, P. citrophthora, P. macilentosa, P. cryptogea, and P. riparia. Twelve species were associated with diseased plant tissues. This survey documented 53 new plant-Phytophthora associations and expanded the known distribution of some species.

Wall eyed bilateral internuclear ophthalmoplegia (WEBINO) syndrome as a false localising sign in intracranial haemorrhage due to snake bite

A 48-year-old woman presented with sudden-onset altered sensorium 2 days after a snake bite (unidentified species) and was found to have a large right frontal intracerebral haemorrhage (ICH) with transtentorial herniation (TTH) causing brain stem compression. A day later, neurological examination revealed internuclear ophthalmoplegia (INO) fitting the clinical description of wall eyed bilateral INO syndrome. INO is a rare ocular motor sign, the most common causes being brain stem infarction, haemorrhage or demyelinating disease. It rarely acts as a false localising sign, such as in this case, and in an even rarer cause for ICH, that is, haemotoxic snake bite without initial evidence of coagulopathy. An emphasis needs to be laid on detailed physical examination, often considered a lost art nowadays, to help detect subtle clinical signs which could herald ominous complications of conditions like TTH and help in early diagnosis and treatment of the same.

Suspect and positive cases of bovine tuberculosis in the Republic of Croatia from 2017 to 2020

During regular implementation of the bovine tuberculosis-free cattle herd certification programme in the period from 2017 to 2020, the Laboratory for Bacterial Zoonoses and Molecular Diagnostics of Bacterial Diseases of Croatian veterinary institute Zagreb, Croatia tested material from 161 cattle from 27 holdings in 11 counties. The material was submitted following findings of pathoanatomical changes detected in the slaughter line suggesting tuberculosis, or after a positive reaction of cows to the tuberculin comparative methods. Species from the M. tuberculosis complex (M. bovis and M. caprae) were isolated from samples of 58 bovines (36%) from 16 holdings in eight counties. M. caprae was confirmed in 55 bovines (34%) originating from 13 holdings in seven counties, and M. bovis in three bovines (2%), each from a different holding in a different county. Saprophytic mycobacteria were isolated from four bovine samples (2.5%) from three holdings in two counties, i.e., M. gordonae (1), M. celatum (1) and two unidentified species (M. sp.). Based on the obtained results, we can conclude that the main causative agent of bovine tuberculosis in the Republic of Croatia is M. caprae, which confirmed previous findings. Control of bovine tuberculosis in the Republic of Croatia is still needed and, in the future, should be further suppressed using tuberculinisation, controls on slaughter lines, depopulation of infected herds, and etiological determination of the causative agents.