scholarly journals A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A with Phenotypes Heterogeneity

2020 ◽  
Author(s):  
Yu Sui ◽  
Yongping Lu ◽  
Meina Lin ◽  
Xiang Ni ◽  
Xinren Chen ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Tyrosine Kinase ◽  
Sanger Sequencing ◽  
Sequencing Analysis ◽  
Next Generation ◽  
Autosomal Dominant Disorder ◽  
Reverse Primer ◽  
Generation Sequencing ◽  
Disease Family ◽  
Forward Primer

Abstract Background: Milroy disease is a rare, autosomal dominant disorder. Mutations of FLT4 (Fms Related Tyrosine Kinase 4) gene impaired tyrosine kinase signaling, and further cause symptoms of Milroy disease. In this research, we found a large Chinese MD family with phenotype heterogeneities. And we conducted Next Generation Sequencing analysis to explore possible genetic causative factors might be related to clinical heterogeneities among family members.Methods: Sanger sequencing was conducted on the 17-26 exons of FLT4 (NM_182925.4) gene. Primers were as follows: Froward: 5' CTTCATCAGCGTCGAGTGG 3'; Reverse: 5' ATTATGGGCGGGTTCCTT 3'; Next-generation sequencing was conducted to explore pathogenic mutation might lead to phenotype heterogeneities. Then we conducted Sanger sequencing of the possible related genes. The GIMAP7 gene amplification primers as follows: Forward primer: 5’ ACCACCTGCAAGGAAATCAGCCGCT3’; Reverse primer: 5’GTTAGAGAAATACCTCCTTCCCCTT3’. The amplification system for two genes are as follows: 2×Biotech Power PCR Mix: 10µl; forward primer: 0.8µl (10µM); reverse primer: 0.8µl (10µM); DNA template: 1µl (50ng/µl); ddH20: 13.4µl. The effects of the mutations on the gene functions were evaluated with mutation taster and/or SIFT, PolyPhen.Results: A heterozygous substitution mutation was detected in all patients (FLT4 gene: c.2774 T>A, p.V925E). Meanwhile, a G deletion (c.826delG, p.Val276Phefs*29) of GIMAP7 gene was detected in all patients but two patients with phenotype heterogeneities (I1, and II1). Both the two mutations were predicted to be pathogenic.Conclusions: In this report, we described a large Milroy disease family caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E). Meanwhile, a frame-shift mutation (c.826delG, p.Val276Phefs*29) of GIMAP7 gene might be related to the clinical phenotype heterogeneities of the family.

scholarly journals A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A

2021 ◽  
Author(s):  
Yu Sui ◽  
Yongping lu ◽  
Meina Lin ◽  
Xiang Ni ◽  
Xinren Chen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
Autosomal Dominant ◽  
Large Family ◽  
Chinese Family ◽  
Autosomal Dominant Disorder ◽  
Amplification System ◽  
Reverse Primer ◽  
Dna Template ◽  
Disease Family ◽  
Forward Primer

Abstract Background: Milroy disease (MD) is a rare, autosomal dominant disorder. Mutations in the Fms-related tyrosine kinase 4 (FLT4) gene cause the symptoms of this disease. In this report, we investigated the mutations in a large Chinese family with MD.Methods: We conducted Sanger sequencing of exons 17–26 of the FLT4 (NM_182925.4) gene. The primers were as follows: forward, 5' CTTCATCAGCGTCGAGTGG 3' and reverse, 5' ATTATGGGCGGGTTCCTT 3'. The amplification system is as follows: 2×Biotech Power PCR Mix, 10 µl; forward primer, 0.8 µl (10 µM); reverse primer, 0.8 µl (10 µM); DNA template, 1 µl (50 ng/µl); and ddH2O, 13.4 µl. The mutation was evaluated with MutationTaster, SIFT and PolyPhen.Results: A heterozygous substitution was detected in all patients but not in any healthy controls (FLT4 gene: c.2774 T>A, p.V925E). The mutation was predicted to be pathogenic.Conclusions: In this report, we described a large family with MD caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E).

Expanding the search for significant EGFR mutations in NSCLC outside of the tyrosine kinase domain with next-generation sequencing

2017 ◽  
Vol 34 (7) ◽  
Author(s):  
Matthew K. Stein ◽  
Lindsay Morris ◽  
Jennifer L. Sullivan ◽  
Moon Fenton ◽  
Ari VanderWalde ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Tyrosine Kinase ◽  
Kinase Domain ◽  
Egfr Mutations ◽  
Tyrosine Kinase Domain ◽  
Next Generation ◽  
Generation Sequencing

scholarly journals Diagnosis of Severe Tetanus Assisted by Next-Generation Sequencing Analysis of Etiology: A Case Report

2020 ◽  
Author(s):  
Yuling An ◽  
Mingming Fan ◽  
Ziyu Li ◽  
You Peng ◽  
Xiaomeng Yi ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Comprehensive Treatment ◽  
Sequencing Analysis ◽  
Next Generation ◽  
Next Generation Sequencing Analysis ◽  
Autonomic Instability ◽  
The Right ◽  
Next Generation Sequencing Ngs ◽  
Generation Sequencing ◽  
Severe Tetanus

Abstract We shared our successful treatment experience of a severe tetanus patient in China. A 50 year old male patient was admitted to our hospital 10 days after the right arm injury due to pain and masticatory weakness. The pathogen of wound secretion was confirmed to be clostridium tetanus by next-generation sequencing (NGS).The patient's condition rapidly progressed to a severe state with autonomic instability. After debridement and comprehensive treatment in ICU, including deep analgesia and sedation with dexmedetomidine, ventilator support and anti-infection treatment, the patient finally recovered and discharged. This case suggested that early diagnosis and reasonable intervention of severe tetanus could reduce mortality.

scholarly journals Identification of Genetic Hereditary Predisposition to Hematologic Malignancies By Clinical Next-Generation Sequencing

Blood ◽  
2015 ◽  
Vol 126 (23) ◽  
pp. 3854-3854 ◽  
Author(s):  
Amy E Knight Johnson ◽  
Lucia Guidugli ◽  
Kelly Arndt ◽  
Gorka Alkorta-Aranburu ◽  
Viswateja Nelakuditi ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Sanger Sequencing ◽  
Family Members ◽  
Hematologic Malignancies ◽  
Dyskeratosis Congenita ◽  
Molecular Diagnostic ◽  
Next Generation ◽  
Hereditary Predisposition ◽  
Ngs Data ◽  
Generation Sequencing

Abstract Introduction: Myelodysplastic syndrome (MDS) and acute leukemia (AL) are a clinically diverse and genetically heterogeneous group of hematologic malignancies. Familial forms of MDS/AL have been increasingly recognized in recent years, and can occur as a primary event or secondary to genetic syndromes, such as inherited bone marrow failure syndromes (IBMFS). It is critical to confirm a genetic diagnosis in patients with hereditary predisposition to hematologic malignancies in order to provide prognostic information and cancer risk assessment, and to aid in identification of at-risk or affected family members. In addition, a molecular diagnosis can help tailor medical management including informing the selection of family members for allogeneic stem cell transplantation donors. Until recently, clinical testing options for this diverse group of hematologic malignancy predisposition genes were limited to the evaluation of single genes by Sanger sequencing, which is a time consuming and expensive process. To improve the diagnosis of hereditary predisposition to hematologic malignancies, our CLIA-licensed laboratory has recently developed Next-Generation Sequencing (NGS) panel-based testing for these genes. Methods: Thirty six patients with personal and/or family history of aplastic anemia, MDS or AL were referred for clinical diagnostic testing. DNA from the referred patients was obtained from cultured skin fibroblasts or peripheral blood and was utilized for preparing libraries with the SureSelectXT Enrichment System. Libraries were sequenced on an Illumina MiSeq instrument and the NGS data was analyzed with a custom bioinformatic pipeline, targeting a panel of 76 genes associated with IBMFS and/or familial MDS/AL. Results: Pathogenic and highly likely pathogenic variants were identified in 7 out of 36 patients analyzed, providing a positive molecular diagnostic rate of 20%. Overall, 6 out of the 7 pathogenic changes identified were novel. In 2 unrelated patients with MDS, heterozygous pathogenic sequence changes were identified in the GATA2 gene. Heterozygous pathogenic changes in the following autosomal dominant genes were each identified in a single patient: RPS26 (Diamond-Blackfan anemia 10), RUNX1 (familial platelet disorder with propensity to myeloid malignancy), TERT (dyskeratosis congenita 4) and TINF2 (dyskeratosis congenita 3). In addition, one novel heterozygous sequence change (c.826+5_826+9del, p.?) in the Fanconi anemia associated gene FANCA was identified. . The RNA analysis demonstrated this variant causes skipping of exon 9 and results in a premature stop codon in exon 10. Further review of the NGS data provided evidence of an additional large heterozygous multi-exon deletion in FANCA in the same patient. This large deletion was confirmed using array-CGH (comparative genomic hybridization). Conclusions: This study demonstrates the effectiveness of using NGS technology to identify patients with a hereditary predisposition to hematologic malignancies. As many of the genes associated with hereditary predisposition to hematologic malignancies have similar or overlapping clinical presentations, analysis of a diverse panel of genes is an efficient and cost-effective approach to molecular diagnostics for these disorders. Unlike Sanger sequencing, NGS technology also has the potential to identify large exonic deletions and duplications. In addition, RNA splicing assay has proven to be helpful in clarifying the pathogenicity of variants suspected to affect splicing. This approach will also allow for identification of a molecular defect in patients who may have atypical presentation of disease. Disclosures No relevant conflicts of interest to declare.

Sign in / Sign up

Export Citation Format

Share Document