Optimization of annealing temperature for amplification of EhoscnOla locus in pranajiwa (Euchresta horsfieldii) plant collected from mountains, urban and coastal areas in Bali

Pranajiwa plant is a medicinal plant that grows wildly and is classified as a rare plant. Currently, its existence is increasingly threatened. Pranajiwa grows around Indonesia and is known with several scientific names and morphological features due to unclear identification. Molecular identification is recommended to clarify its species. DNA Barcoding is considered the suitable method to identify pranajiwa plant molecularly. The purpose of this study was to optimized the PCR annealing temperature of EhcSnOla locus barcoding marker of pranajiwa plants collected from the coastal (Jimbaran), urban (Renon), and mountain (Bedugul) areas, representing three different areas in Bali. Research procedures include total DNA extraction, PCR procedure, and electrophoresis. The primers used in this study were EhoScnOla forward primer and EhoscnOla reverse primer. Five different temperatures were used for annealing temperature optimization: 51°C, 52°C, 55°C, 57°C, and 60°C. The result showed that all temperatures produced a clear, thick, and single electrophoresis band, indicating that all temperatures were suitable for the annealing temperature and the most optimal temperature is in the Mountains sample (Bedugul) which is 60°C. The Jimbaran, Renon, and Bedugul samples produced 882, 820, and 889 bp, respectively. EhcSnOla locus can be used as the barcoding marker to identify pranajiwa molecularly.

Variation of prolactin and β-Lactoglobulin genes in the Indonesian FH Cattle

Prolactin is a polypeptide hormone, encoded by the prolactin (PRL) gene, synthesized and secreted by anterior pituitary, and affecting milk yield and composition. β-Lactoglobulin (BLG) is the major whey proteinin the milk of ruminants. This study was conducted to identify the PRL and LGB genes polymorphism in the Indonesian FH cattle. A total of 139 individual cattle blood samples from West Java were used to obtain DNA samples through the DNA extraction process. Identification of the PRL and LGB genes was performed using PCR-RFLP method with RsaI (PRL gene) and HaeIII (BLG gene) restriction enzymes. The PRL gene was amplified using forward primer 5’-ccaaatccactgaattatgctt-3’ and reverse primer 5’-acagaaatcacctctctcattca-3’. The BLG gene was amplified using forward primer 5’-tgtgctggacaccgactacaaaaag-3’ and reverse primer 5’-gctcccggtatatgaccaccctct-3’. The PRL and BLG genes in the Indonesia FH cattle were polymorphic based on the PCR-RFLP analysis but the heterozygosity value was low. There were two alleles (G and A) and three genotypes (GG, GA, and AA) identified in the PRL gene of the Indonesian FH cattle with genotype frequencies were 0.914, 0.079, and 0,007 for GG, GA, and AA genotypes respectively. There were two genotypes (CC and CG) identified in the BLG gene with genotype frequencies were 0.91 (CC), and 0.09 (CG). Information about the PRL and BLG genes polymorphism in this study can be considered for further study to analyse its association with milk yield trait.

ΩqPCR measures telomere length from single-cells in base pair units

ΩqPCR determines absolute telomere length in kb units from single cells. Accuracy and precision of ΩqPCR were assessed using 800 bp and 1600 bp synthetic telomeres inserted into plasmids, which were measured to be 819 ± 19.6 and 1590 ± 42.3 bp, respectively. This is the first telomere length measuring method verified in this way. The approach uses Ω-probes, a DNA strand containing sequence information that enables: (i) hybridization with the telomere via the 3′ and 5′ ends that become opposed; (ii) ligation of the hybridized probes to circularize the Ω-probes and (iii) circularized-dependent qPCR due to sequence information for a forward primer, and for a reverse primer binding site, and qPCR hydrolysis probe binding. Read through of the polymerase during qPCR occurs only in circularized Ω-probes, which quantifies their number that is directly proportional to telomere length. When used in concert with information about the cell cycle stage from a single-copy gene, and ploidy, the MTL of single cells measured by ΩqPCR was consistent with that obtained from large sample sizes by TRF.

Primer Design and Analysis for Detection of mecA gene

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method

Morphological and molecular characters of Cherax quadricarinatus (von Martens, 1868) from Sermo Reservoir and Tambakboyo Retention Basin, Daerah Istimewa Yogyakarta, Indonesia

The Australian red claw freshwater crayfish, Cherax quadricarinatus is one of the most widely distributed and cultivated freshwater crayfish due to its high tolerance towards various environmental conditions. Native to North Australia and South Papua New Guinea, this crayfish was found in Tambakboyo Retention Basin in 2016 and Sermo Reservoir in 2019. This research was aimed to identify the morphological and molecular characters of C. quadricarinatus collected from Sermo Reservoir and Tambakboyo Retention Basin, Yogyakarta. The genetic information of the samples was compared to Australian red claw freshwater crayfish currently available. The methodology used for this research are morphological, morphometrical, meristic identification, and molecular identification using the PCR method. The primer used to be 1471 primers as the forward primer and 1472 primers as the reverse primer. In conclusion, all six specimens obtained were identified to be C. quadricarinatus. Morphological analysis using UPGMA showed that all specimens were formed one big cluster and has the highest similarity index (1.00). Molecular analysis using BLAST showed that specimen from Sermo Reservoir was 98.96% identical to C. quadricarinatus and specimen from Tambakboyo Retention Basin was 100% identical to C. quadricarinatus. Thus concluding that based on their morphological and molecular character, all samples of this study were C. quadricarinatus. This finding also contributes to the distribution information of C. quadricarinatus in Daerah Istimewa Yogyakarta

Perancangan primer gen lktB pada Fusobacterium necrophorum untuk analisis PCR

Fusobacterium necrophorum is a pathogen causing disease in animals, especially cattle, goats, and sheep. F. necrophorum infection can result in a variety of necrotic conditions (necrobacillosis). This study aimed to design a pair of primers for detecting the leukotoxin B (lktB) gene expressed by F. necrophorum as diagnostic support. The lktB gene sequence was obtained from GenBank NCBI with accession number AF312861.3:685-2337. Furthermore, the sequence was used as a template for in silico primer design using Primer-BLAST. Primer candidates successfully designed were then analyzed for their secondary structure using NetPrimer. The results showed that forward primer set 6 (5'-TCGGATGCTGGAATGCTACTT-3') and reverse primer set 6 (5'-GGGCTCCCAAATCCTTACGA-3') were a favorable primer set with a product size of 228 bp. However, laboratory experiments need to be carried out to determine the optimal conditions for this primer set.

In vitro evaluation of the effect of mutations in primer binding sites on detection of SARS-CoV-2 by RT-qPCR

A number of RT-qPCR assays for the detection of SARS-CoV-2 have been published and are listed by the WHO as recommended assays. Furthermore, numerous commercial assays with undisclosed primer and probe sequences are on the market. As the SARS-CoV-2 pandemic progresses, the virus accrues mutations, which in some cases - as seen with the B.1.1.7 variant - can outperform and push back other strains of SARS-CoV-2. If mutations occur in primer or probe binding sites, this can impact RT-qPCR results and impede SARS-CoV-2 diagnostics. Here we tested the effect of primer mismatches on RT-qPCR performance in vitro using synthetic mismatch in vitro transcripts. The effects of the mismatches ranged from a shift in ct values from -0.13 to +7.61. Crucially, we found that a mismatch in the forward primer has a more detrimental effect for PCR performance than a mismatch in the reverse primer. Furthermore, we compared the performance of the original Charite RdRP primer set, which has several ambiguities, with a primer version without ambiguities and found that without ambiguities the ct values are ca. 3 ct lower. Finally, we investigated the shift in ct values observed with the Seegene Allplex kit with the B.1.1.7 SARS-CoV-2 variant and found a three-nucleotide mismatch in the forward primer of the N target.

Amplifikasi DNA Kandidat Gen Kuda Pacu Sumba

The Sumba horse is one of the local horses in Indonesia which is known as racing horse Several candidate genes are known to influence the outward characteristics of the Sumba racehorse, which play main role in the development of the horse's muscles from embryo to adulthood. This research aims to identify candidate genes for the Sumba racehorse in stallion and mares. Blood samples from 5 stallions and 5 mares were collected and analyzed. The method used in this research was by using polymerase chain reaction (PCR), electrophoresis and DNA sequencing. The results of DNA amplification fragments at a temperature of 600c showed a fragment size of 463 bp. A total of 10 samples were sequenced on the PCR machine. The forward primer was 5'-TATTCTTCTTGGGAGGGAGGACTACT-3 'and reverse primer was 5'-GCAAGTAATTAGCACAAAAATTTGAATG-3'. The obtained data was analyzed using the Basic Local Alignment Sealing Tool (BLAST). Result of this study could be used as an initial identification of candidate genes for racing activity in stallion and mares that can complement the selection of racing horses.

A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A

Background: Milroy disease (MD) is a rare, autosomal dominant disorder. Mutations in the Fms-related tyrosine kinase 4 (FLT4) gene cause the symptoms of this disease. In this report, we investigated the mutations in a large Chinese family with MD.Methods: We conducted Sanger sequencing of exons 17–26 of the FLT4 (NM_182925.4) gene. The primers were as follows: forward, 5' CTTCATCAGCGTCGAGTGG 3' and reverse, 5' ATTATGGGCGGGTTCCTT 3'. The amplification system is as follows: 2×Biotech Power PCR Mix, 10 µl; forward primer, 0.8 µl (10 µM); reverse primer, 0.8 µl (10 µM); DNA template, 1 µl (50 ng/µl); and ddH2O, 13.4 µl. The mutation was evaluated with MutationTaster, SIFT and PolyPhen.Results: A heterozygous substitution was detected in all patients but not in any healthy controls (FLT4 gene: c.2774 T>A, p.V925E). The mutation was predicted to be pathogenic.Conclusions: In this report, we described a large family with MD caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E).

First Report of the Hop Cyst Nematode, Heterodera humuli, in Two Counties of the Yakima Valley Region, WA, USA

Cyst nematodes are ranked as the second most damaging plant-parasitic nematode genus of crops worldwide (Jones et al. 2013). The hop cyst nematode, Heterodera humuli, has been reported to cause up to 38% reduction in dry hops per bine (Hay and Pethybridge 2003). America is the top hop producing country worldwide, with 75% of production occurring in Washington state, with the majority of this production occurring in the Yakima Valley region (USDA, 2019). In late 2019, 30 soil samples from 15 different fields were collected from the hop cvs. HBC 394, HBC 369, and YCR 14. Nematodes were extracted using an adapted centrifugal floatation method (Jenkins 1964) from 100 cc subsamples of soil. Twenty of these samples contained at least one cyst and 23 contained at least one juvenile. Body length of juveniles (n = 5) averaged + standard deviation 377.62 ± 4.76 μm which is consistent with H. humuli juvenile body measurements (Sen 1968). Three samples from Yakima County and two from Benton County were identified to the species level using sequences from the internal transcribed spacer (ITS) region of the 5.8S gene. The sequences (GenBank accession numbers MT840678 to MT840682) were amplified using forward primer 5.8S-F (5’-GTGATTCCATTCACCAHCTACCTG-3’), and reverse primer 5.8S-R (5’-TTCGCACTAATTATCGCAGTTGG-3’). Sequence comparison with available ITS (5.8S) sequences in GenBank using BLAST showed 99.85% identity to H. humuli for all five samples. Because COI sequences of H. humuli are not available, to provide an additional marker for species identification, we amplified the COI sequences by using (forward primer Hete-COI-F (5’-TTTGGDCAYCCHGARGTTTATGTT-3’), and reverse primer Hete-COI-R (5’-AYWGTAAAAAGGRRAATAAAACC-3’) for these samples. Four COI sequences (GenBank accession numbers MT840683 to MT840686) were obtained. These COI sequences will be used to identify future H. humuli samples. To confirm pathogenicity, eight 1-gal pots were filled with a 90:10 play sand to potting soil mixture and one hop rhizome cv. ‘Centennial’ was planted in pots and maintained in a greenhouse. After above ground plant growth was observed, half the pots were inoculated with hand-picked H. humuli cysts from Yakima soil samples at a density of 10 cysts/100 cc of soil. The life cycle of H. humuli in potted experiments is 40 days (McNamara and Mende 1995). Forty-five days after inoculation, plant measurements were recorded and nematodes extracted from five 100 cc soil samples per pot as described above. Soil samples revealed that H. humuli populations had an average Reproductive Factor (RF = final nematode population/initial nematode population) of 2.08. Five cysts were crushed to determine eggs/cyst, which yielded an average of 101 eggs/cyst. Young infected hops lacked vigor, with all replicates stunted both in bine height and leaf length compared to healthy controls. Bine heights were reduced by an average of 40.4% in pots inoculated with H. humuli compared to control plants (P = 0.0016). Distribution of hop cyst within the United States is limited to the top four states for hop production: Washington, Oregon, Idaho and Michigan (Cobb 1962; Sen and Jensen 1967; Hafez et al. 2010, Warner and Bird, 2015). In 1962, Cobb reported H. humuli in Pierce County, Washington, but it had not been reported in Benton County and Yakima County until now. This is a significant finding that has the potential to impact the Washington state hop industry, valued at $475.7 million in 2019 (USDA, 2019). Due to the lack of known effective nematode control measures, the discovery of H. humuli in the major hop-growing region of Washington warrants concern.