scholarly journals A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A

2021 ◽  
Author(s):  
Yu Sui ◽  
Yongping lu ◽  
Meina Lin ◽  
Xiang Ni ◽  
Xinren Chen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
Autosomal Dominant ◽  
Large Family ◽  
Chinese Family ◽  
Autosomal Dominant Disorder ◽  
Amplification System ◽  
Reverse Primer ◽  
Dna Template ◽  
Disease Family ◽  
Forward Primer

Abstract Background: Milroy disease (MD) is a rare, autosomal dominant disorder. Mutations in the Fms-related tyrosine kinase 4 (FLT4) gene cause the symptoms of this disease. In this report, we investigated the mutations in a large Chinese family with MD.Methods: We conducted Sanger sequencing of exons 17–26 of the FLT4 (NM_182925.4) gene. The primers were as follows: forward, 5' CTTCATCAGCGTCGAGTGG 3' and reverse, 5' ATTATGGGCGGGTTCCTT 3'. The amplification system is as follows: 2×Biotech Power PCR Mix, 10 µl; forward primer, 0.8 µl (10 µM); reverse primer, 0.8 µl (10 µM); DNA template, 1 µl (50 ng/µl); and ddH2O, 13.4 µl. The mutation was evaluated with MutationTaster, SIFT and PolyPhen.Results: A heterozygous substitution was detected in all patients but not in any healthy controls (FLT4 gene: c.2774 T>A, p.V925E). The mutation was predicted to be pathogenic.Conclusions: In this report, we described a large family with MD caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E).

scholarly journals A family with Milroy disease caused by the FLT4/VEGFR3 gene variant c.2774 T > A

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Yu Sui ◽  
Yongping Lu ◽  
Meina Lin ◽  
Xiang Ni ◽  
Xinren Chen ◽  
...  
Keyword(s):  
Tyrosine Kinase ◽  
In Silico ◽  
Sanger Sequencing ◽  
Autosomal Dominant ◽  
Large Family ◽  
Missense Variant ◽  
Chinese Family ◽  
Healthy Controls ◽  
Gene Variant ◽  
Autosomal Dominant Disorder

Abstract Background Milroy disease (MD) is a rare, autosomal-dominant disorder. Variants in the Fms-related tyrosine kinase 4 (FLT4/VEGFR3) gene cause the symptoms of this disease. In this report, we investigated the variant in a large Chinese family with MD. Methods We conducted Sanger sequencing of exons 17–26 of FLT4/VEGFR3 (NM_182925.4). We assessed its pathogenicity based on the ACMG criteria and predicted it with an in silico program. Results A heterozygous substitution (NM_182925.4 (FLT4/VEGFR3):c.2774 T>A, p. (Val925Glu)) was detected in all patients with MD but not in any healthy controls. The variant was evaluated as pathogenic according to the ACMG criteria and was predicted to be pathogenic using an in silico program. Conclusions In this report, we described a large family with MD caused by a missense variant in FLT4/VEGFR3 (NM_182925.4 (FLT4/VEGFR3_v001):c.2774 T>A, p. (Val925Glu)). There are phenotypic heterogeneities among family members, and further research should be conducted to explore the possible reasons.

scholarly journals A Milroy Disease Family Caused by FLT4 Gene Mutation of c.2774 T>A with Phenotypes Heterogeneity

2020 ◽  
Author(s):  
Yu Sui ◽  
Yongping Lu ◽  
Meina Lin ◽  
Xiang Ni ◽  
Xinren Chen ◽  
...  
Keyword(s):  
Next Generation Sequencing ◽  
Tyrosine Kinase ◽  
Sanger Sequencing ◽  
Sequencing Analysis ◽  
Next Generation ◽  
Autosomal Dominant Disorder ◽  
Reverse Primer ◽  
Generation Sequencing ◽  
Disease Family ◽  
Forward Primer

Abstract Background: Milroy disease is a rare, autosomal dominant disorder. Mutations of FLT4 (Fms Related Tyrosine Kinase 4) gene impaired tyrosine kinase signaling, and further cause symptoms of Milroy disease. In this research, we found a large Chinese MD family with phenotype heterogeneities. And we conducted Next Generation Sequencing analysis to explore possible genetic causative factors might be related to clinical heterogeneities among family members.Methods: Sanger sequencing was conducted on the 17-26 exons of FLT4 (NM_182925.4) gene. Primers were as follows: Froward: 5' CTTCATCAGCGTCGAGTGG 3'; Reverse: 5' ATTATGGGCGGGTTCCTT 3'; Next-generation sequencing was conducted to explore pathogenic mutation might lead to phenotype heterogeneities. Then we conducted Sanger sequencing of the possible related genes. The GIMAP7 gene amplification primers as follows: Forward primer: 5’ ACCACCTGCAAGGAAATCAGCCGCT3’; Reverse primer: 5’GTTAGAGAAATACCTCCTTCCCCTT3’. The amplification system for two genes are as follows: 2×Biotech Power PCR Mix: 10µl; forward primer: 0.8µl (10µM); reverse primer: 0.8µl (10µM); DNA template: 1µl (50ng/µl); ddH20: 13.4µl. The effects of the mutations on the gene functions were evaluated with mutation taster and/or SIFT, PolyPhen.Results: A heterozygous substitution mutation was detected in all patients (FLT4 gene: c.2774 T>A, p.V925E). Meanwhile, a G deletion (c.826delG, p.Val276Phefs*29) of GIMAP7 gene was detected in all patients but two patients with phenotype heterogeneities (I1, and II1). Both the two mutations were predicted to be pathogenic.Conclusions: In this report, we described a large Milroy disease family caused by a missense mutation of the FLT4 gene (c.2774 T>A, p.V925E). Meanwhile, a frame-shift mutation (c.826delG, p.Val276Phefs*29) of GIMAP7 gene might be related to the clinical phenotype heterogeneities of the family.

A novel CRYBB2 mutation causes autosomal dominant cataract: A report from a Chinese family

2020 ◽  
pp. 112067212092645
Author(s):  
Li Juan Xu ◽  
Zhi Gang Lv ◽  
Ying Liu ◽  
Xiang Xiang Zhang ◽  
Yu Xin Cui ◽  
...  
Keyword(s):  
Axial Length ◽  
Healthy Subjects ◽  
Sanger Sequencing ◽  
Autosomal Dominant ◽  
Pathogenic Mutation ◽  
Chinese Family ◽  
Rare Mutation ◽  
Pathogenic Variants ◽  
Lens Opacities ◽  
Generation Sequencing

Purpose This study aimed to examine pathogenic mutation within one Chinese family of five-generations suffering from autosomal dominant cataract. Methods Next-generation sequencing and Sanger sequencing were used to find the pathogenic variants. Results A rare mutation, c.563G > A, in CRYBB2 gene was found in the proband that showed symptom of non-syndromic congenital autosomal dominant cataract. This mutation had been found in all affected individuals and in one healthy infant, but it did not exist between two individuals who did not develop such disease in that family, as well as in 100 healthy subjects who showed no relation with that family. Cataracts in this family varied with different severity of lens opacities and elongation of axial length. Conclusion One missense mutation c.563G > A is reported in the CRYBB2 gene among one Chinese family suffering from early-onset cataract, and associated novel phenotypes are the elongation of axial length and the types of cataract. Our results expand the spectrum of associated phenotypes of CRYBB2 mutation.

scholarly journals A Novel Mutation ofSMAD3Identified in a Chinese Family with Aneurysms-Osteoarthritis Syndrome

2015 ◽  
Vol 2015 ◽  
pp. 1-6
Author(s):  
Wenwen Zhang ◽  
Min Zhou ◽  
Cheng Liu ◽  
Chen Liu ◽  
Tong Qiao ◽  
...  
Keyword(s):  
Signal Transduction ◽  
Early Onset ◽  
Autosomal Dominant ◽  
Novel Mutation ◽  
Mutation Spectrum ◽  
Chinese Family ◽  
Phenotype Correlation ◽  
Autosomal Dominant Disorder ◽  
Arterial Tree ◽  
Craniofacial Features

Aneurysms-osteoarthritis syndrome (AOS) is a recently delineated autosomal dominant disorder characterized by aneurysms, dissections, and tortuosity throughout the arterial tree in association with early onset osteoarthritis, mild craniofacial features, and skeletal and cutaneous anomalies. Previous studies have demonstrated that mutations inSMAD3, a key regulator of TGF-βsignal transduction, contribute to AOS. Here, we investigated a family of three generations affected by AOS. A novelSMAD3mutation, c.266G>A (p.C89Y), was identified and cosegregated with the affected individuals in this family. Our finding expands the mutation spectrum ofSMAD3gene and further strengthens the connection between the presence of aneurysms-osteoarthritis phenotype andSMAD3mutations, which facilitates the understanding of the genotype-phenotype correlation of AOS.

scholarly journals A Novel Splicing Mutation ofKITResults in Piebaldism and Auburn Hair Color in a Chinese Family

2013 ◽  
Vol 2013 ◽  
pp. 1-6 ◽  
Author(s):  
Yong-jia Yang ◽  
Rui Zhao ◽  
Xin-yu He ◽  
Li-ping Li ◽  
Ke-wei Wang ◽  
...  
Keyword(s):  
Autosomal Dominant ◽  
Mutation Screening ◽  
Chinese Family ◽  
Hair Color ◽  
Splicing Mutation ◽  
Autosomal Dominant Disorder ◽  
Kit Mutation ◽  
Key Characteristics ◽  
Color Variant

Piebaldism is a rare autosomal dominant disorder of melanocyte development, which is mostly caused byKITgene. The key characteristics of piebaldism include localized poliosis, congenital leukoderma, and other variable manifestations. The previous study has illustrated that the homogeneousMC1R(a gene which is associated with the hair color) variant (p.I120T) coordinating withKITmutation may lead to auburn hair color and piebaldism. In this study, we have investigated a Chinese family with piebaldism and auburn hair color; the mutation screening ofKITandMC1Rgenes identified that only a splicing mutation (c. 2484+1G>A) ofKITgene cosegregated with the auburn hair color and piebaldism. The data of this study and others suggests that the KIT mutation may causes of the auburn hair color in the piebaldism patients.

scholarly journals PRPF3-Associated Autosomal Dominant Retinitis Pigmentosa and CYP4V2-Associated Bietti’s Crystalline Corneoretinal Dystrophy Coexist in a Multigenerational Chinese Family

2017 ◽  
Vol 2017 ◽  
pp. 1-10
Author(s):  
Xiaohong Meng ◽  
Qiyou Li ◽  
Hong Guo ◽  
Haiwei Xu ◽  
Shiying Li ◽  
...  
Keyword(s):  
Missense Mutation ◽  
Clinical Features ◽  
Sanger Sequencing ◽  
Mutation Screening ◽  
Retinal Dystrophy ◽  
Family Members ◽  
Large Family ◽  
Chinese Family ◽  
Compound Heterozygous ◽  
Genetic Characteristics

Purpose. To characterize the clinical and molecular genetic characteristics of a large, multigenerational Chinese family showing different phenotypes. Methods. A pedigree consisted of 56 individuals in 5 generations was recruited. Comprehensive ophthalmic examinations were performed in 16 family members affected. Mutation screening of CYP4V2 was performed by Sanger sequencing. Next-generation sequencing (NGS) was performed to capture and sequence all exons of 47 known retinal dystrophy-associated genes in two affected family members who had no mutations in CYP4V2. The detected variants in NGS were validated by Sanger sequencing in the family members. Results. Two compound heterozygous CYP4V2 mutations (c.802-8_810del17insGC and c.992A>C) were detected in the proband who presented typical clinical features of BCD. One missense mutation (c.1482C>T, p.T494M) in the PRPF3 gene was detected in 9 out of 22 affected family members who manifested classical clinical features of RP. Conclusions. Our results showed that two compound heterozygous CYP4V2 mutations caused BCD, and one missense mutation in PRPF3 was responsible for adRP in this large family. This study suggests that accurate phenotypic diagnosis, molecular diagnosis, and genetic counseling are necessary for patients with hereditary retinal degeneration in some large mutigenerational family.

scholarly journals Case Report: A Novel CACNA1S Mutation Associated With Hypokalemic Periodic Paralysis in a Chinese Family

2021 ◽  
Vol 12 ◽  
Author(s):  
Jie-Yuan Jin ◽  
Bing-Bing Guo ◽  
Yi Dong ◽  
Yue Sheng ◽  
Liang-Liang Fan ◽  
...  
Keyword(s):  
Autosomal Dominant ◽  
Frameshift Mutation ◽  
Periodic Paralysis ◽  
Chinese Family ◽  
Hypokalemic Periodic Paralysis ◽  
Autosomal Dominant Disorder ◽  
Contraction Coupling ◽  
Voltage Dependent Calcium Channel ◽  
Voltage Dependent ◽  
New Perspective

Hypokalemic periodic paralysis (HypoPP) is a rare autosomal dominant disorder characterized by episodic flaccid paralysis with concomitant hypokalemia. More than half of patients were associated with mutations in CACNA1S that encodes the alpha-1-subunit of the skeletal muscle L-type voltage-dependent calcium channel. Mutations in CACNA1S may alter the structure of CACNA1S and affect the functions of calcium channels, which damages Ca2+-mediated excitation-contraction coupling. In this research, we identified and described a Chinese HypoPP patient with a novel frameshift mutation in CACNA1S [NM_000069.2: c.1364delA (p.Asn455fs)] by targeted sequencing. This study would expand the spectrum of CACNA1S mutations, further our understanding of HypoPP, and provided a new perspective for selecting effective treatments.

scholarly journals Hypertension and Brachydactyly Syndrome Associated With Vertebral Artery Malformation Caused by a PDE3A Missense Mutation

2019 ◽  
Author(s):  
Peng Fan ◽  
Di Zhang ◽  
Kun-Qi Yang ◽  
Qiong-Yu Zhang ◽  
Fang Luo ◽  
...  
Keyword(s):  
Vertebral Artery ◽  
Missense Mutation ◽  
Autosomal Dominant ◽  
Chinese Family ◽  
Autosomal Dominant Disorder ◽  
Conserved Domain ◽  
Long Term Follow Up ◽  
Generation Sequencing

Abstract BACKGROUND Hypertension and brachydactyly syndrome (HTNB), also called Bilginturan syndrome, is a rare autosomal dominant disorder characterized by severe salt-independent hypertension, a short stature, brachydactyly, and death from stroke before the age of 50 years when untreated. The purpose of the present study was to identify a PDE3A mutation leading to HTNB associated with vertebral artery malformation in a Chinese family. METHODS Peripheral blood samples were collected from all subjects for DNA extraction. Next-generation sequencing and Sanger sequencing were performed to identify the PDE3A mutation. A comparative overview was performed in the probands with HTNB caused by PDE3A mutations. RESULTS Genetic analysis identified a missense mutation in PDE3A, c.1346G>A, in the proband with HTNB. This mutation, resulting in p.Gly449Asp, was located in a highly conserved domain and predicted to be damaging by different bioinformatics tools. Cosegregation analyses showed that the proband inherited the identified mutation from her father. Antihypertensive therapy was effective for the proband. Comparative overview of HTNB probands with 9 different PDE3A mutations revealed phenotypic heterogeneity. CONCLUSIONS Genetic screening can significantly improve the diagnosis of HTNB patients at an early age. Our study not only adds to the spectrum of PDE3A mutations in the Chinese population and extends the phenotype of HTNB patients to include vertebral malformation but also improves the awareness of pathogenesis in HTNB patients. We emphasize the importance of antihypertensive treatment and long-term follow-up to prevent stroke and adverse cardiovascular events.

scholarly journals A KRT6A Mutation p.Ile462Asn In A Chinese Family With Pachyonychia Congenita, And Identification of Maternal Mosaicism

2021 ◽  
Author(s):  
Li Yue ◽  
Wang Yumeng ◽  
Yan Ming ◽  
Pan Chaolan ◽  
Zhang Jia ◽  
...  
Keyword(s):  
Deep Sequencing ◽  
Sanger Sequencing ◽  
Low Frequency ◽  
Gene Mutations ◽  
Chinese Family ◽  
Heterozygous Mutation ◽  
Low Grade ◽  
Autosomal Dominant Disorder ◽  
Keratin Gene ◽  
Pachyonychia Congenita

Abstract Background: Pachyonychia congenita (PC, OMIM #167200, #167210, #615726, #615728, and #615735) is a rare autosomal dominant disorder caused by keratin gene mutations in KRT6A, KRT6B, KRT6C, KRT16 or KRT17. It is characterized with nail dystrophy and palmoplantar keratoderma (PPK). The most prominent manifestation is plantar pain. This is the first reported case of maternal mosaicism in PC. Although very rare, germ cell mosaicism should be considered when providing genetic counselling for unaffected parents of a child with PC. Methods: Genomic DNA was extracted from peripheral blood samples, hair bulbs, buccal smears and the father’s germ cells. The entire coding and flanking intronic sequences of 5 keratin genes were screened for mutations in every individuals of the family by Sanger sequencing. We used whole exome sequencing (WES) to search for mosaicism in the parents who had no KRT6A mutation identified by Sanger sequencing. Mosaicism was confirmed by SNaPshot sequencing and HiSeq deep sequencing.Results: A previously reported heterozygous mutation, p.Ile462Asn, was identified in KRT6A in the proband and his affected sister. The variant was detected in one sequencing read from 86 sequencing reads from DNA from the mother’s blood by WES. The mutation was not identified in DNA from the father’s blood. Frequency of reads was 47% and 49% in proband and his sister, respectively. SNaPshot sequencing revealed mosaicism at a level of 2.5% and 4.7% in DNA from blood and hair bulbs from the unaffected mother. HiSeq deep sequencing demonstrated low-grade mosaicism in the patient’s younger sister and parents.Conclusion: These findings indicate the ability of WES and SNaPshot sequencing to detect low-frequency mosaic mutations. Although very rare, germinal mosaicism should be considered when genetic counseling is given to families with presumed spontaneous cases of PC.

scholarly journals Novel SOX2 Mutation in Autosomal Dominant Cataract-Microcornea Syndrome

2021 ◽  
Author(s):  
Zhi-Bo Lin ◽  
Jin Li ◽  
Hai-Sen Sun ◽  
A-Yong Yu ◽  
Shi-Hao Chen ◽  
...  
Keyword(s):  
Exome Sequencing ◽  
Missense Mutation ◽  
Whole Exome Sequencing ◽  
Sanger Sequencing ◽  
Congenital Cataract ◽  
Autosomal Dominant ◽  
Family Members ◽  
High Mobility ◽  
Chinese Family ◽  
Whole Exome

Abstract Background: Congenital cataract-microcornea syndrome (CCMC) is characterized by the association of congenital cataract and microcornea without any other systemic anomaly or dysmorphism. Although several causative genes have been reported in patients with CCMC, the genetic etiology of CCMC is yet to be clearly understood. Purpose: To unravel the genetic cause of autosomal dominant family with CCMC.Methods: All patients and available family members underwent a comprehensive ophthalmologic clinical examination in the hospital by expert ophthalmologists and carried out to clinically diagnosis. All the patients were screened by whole-exome sequencing and then validated using co-segregation by Sanger sequencing. Results: Four CCMC patients from a Chinese family, and five unaffected family members were enrolled in this study. Using whole-exome sequencing, missense mutation c.295G>T (p.a99s, NM_003106.4) in the SOX2 gene was identified and validated by segregation analysis. In addition, this missense mutation was predicted to be damaging by multiple predictive tools. Variant p.Ala99Ser was located in a conservation high mobility group (HMG)-box domain in SOX2 protein, with a potential pathogenic impact of p.Ala99Ser on protein level.Conclusions: A novel missense mutation (c.295G>T, p.Ala99Ser) in the SOX2 gene was found in this Han Chinese family with congenital cataract and microcornea. Our study firstly determined that mutations in SOX2 were associated with CCMC, warranting further investigations on the pathogenesis of this disorder. This result expands the mutation spectrum of SOX2 and provides useful information to study the molecular pathogenesis of CCMC.

Sign in / Sign up

Export Citation Format

Share Document