scholarly journals Genetic Identification of Soybean [Glycine Max(L.) Merr.] Growing in Turkey for Molecular Breeding using Molecular Markers

2010 ◽  
Vol 24 (3) ◽  
pp. 2004-2008 ◽  
Author(s):  
H.C. Vural
Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.


2012 ◽  
Vol 13 (1) ◽  
pp. 13 ◽  
Author(s):  
Alemu Mengistu ◽  
Jason Bond ◽  
Rouf Mian ◽  
Randall Nelson ◽  
Grover Shannon ◽  
...  

Frogeye leaf spot (FLS) caused by Cercospora sojina Hara is a disease of soybean [Glycine max (L.) Merr.] that causes significant seed yield loss in warm, humid environments worldwide. The Rcs3 gene in soybean has been reported to condition resistance to all known races of C. sojina. The objectives of this study were to: (i) identify maturity group (MG) I to VI accessions resistant to C. sojina race 11 by field screening at two locations; and (ii) determine if the FLS resistance of the symptomless soybean accessions is likely to be conditioned by the Rcs3 allele. A total of 260 accessions including 12 differentials were evaluated for reaction to race 11 in field trials in Missouri and Illinois during 2009, and 20 accessions that did not develop symptoms were retested in 2010 to validate their resistance. The 20 accessions remained resistant and were tested for the potential presence of Rcs3 allele using molecular markers; and none was predicted to carry the Rcs3 allele. These accessions may contain novel loci for FLS resistance and may be used to broaden the base for developing soybean cultivars with frogeye leaf spot resistance. Accepted for publication 16 April 2012. Published 21 May 2012.


2017 ◽  
Vol 8 ◽  
Author(s):  
Hwang-Bae Sohn ◽  
Su-Jeong Kim ◽  
Tae-Young Hwang ◽  
Hyang-Mi Park ◽  
Yu-Young Lee ◽  
...  

Author(s):  
R. W. Yaklich ◽  
E. L. Vigil ◽  
W. P. Wergin

The legume seed coat is the site of sucrose unloading and the metabolism of imported ureides and synthesis of amino acids for the developing embryo. The cell types directly responsible for these functions in the seed coat are not known. We recently described a convex layer of tissue on the inside surface of the soybean (Glycine max L. Merr.) seed coat that was termed “antipit” because it was in direct opposition to the concave pit on the abaxial surface of the cotyledon. Cone cells of the antipit contained numerous hypertrophied Golgi apparatus and laminated rough endoplasmic reticulum common to actively secreting cells. The initial report by Dzikowski (1936) described the morphology of the pit and antipit in G. max and found these structures in only 68 of the 169 seed accessions examined.


2017 ◽  
Vol 2 (02) ◽  
pp. 204-218
Author(s):  
Hendra Saputra ◽  
Intan Sari ◽  
Muhammad Arfah
Keyword(s):  

Penelitian tentang pengaruh pemberian Pupuk organik cair (POC) asal limbah tumbuhan terhadap serapan hara N dan P serta produksi tanaman kedelai (Glycine max (L) Merrill) di lahan gambut telah dilaksanakan di kampus II Unisi Fakultas Pertanian Jl. Lintas Propinsi Parit 01, Desa Pulau Palas, Kecamatan Tembilahan Hulu, Kabupaten Indragiri Hilir Propinsi Riau. Dimulai dari bulan Agustus sampai bulan Oktober 2013. Tujuan dari penelitian ini untuk mendapatkan POC asal limbah tumbuhan yang terbaik untuk serapan hara N dan P serta produksi tanaman kedelai di lahan gambut. Penelitian ini menggunakan rancangan acak kelompok (RAK) faktor tunggal dengan 7 perlakuan dan 4 ulangan, 2 tanaman dijadikan sampel. Perlakuan dosis POC limbah tanaman pisang dan POC limbah sayur kol yang diberikan yaitu 0 L/Ha, 200 L/Ha, 400 L/Ha dan 600 L/Ha. Parameter pengamatan yaitu : serapan hara N dan P pada fase awal generatif, tinggi tanaman, jumlah bintil akar, polong hampa, produksi perplot, berat 100 biji dan brangkasan kering. Data pengamatan dianalisis dengan sidik ragam (ANOVA) dan dilanjutkan dengan Uji Lanjut Tukey HSD pada taraf 5%. Berdasarkan penelitian yang telah dilaksanakan dapat disimpulkan bahwa pemberian POC asal limbah tumbuhan tidak berpengaruh nyata terhadap serapan hara N dan P, tinggi tanaman, jumlah bintil akar, polong hampa, brangkasan kering tetapi berpengaruh nyata terhadap produksi perplot dan berat 100 biji.


2018 ◽  
Vol 1 (2) ◽  
pp. 96
Author(s):  
Siti Wahyuni ◽  
Umi Trisnaningsih ◽  
Meilina Prasetyo
Keyword(s):  

1970 ◽  
pp. 09
Author(s):  
K. SANKAR GANESH ◽  
P. SUNDARAMOORTHY

Heavy metals are one of the most important pollutants released to the aquatic environment by the various industrial activities. The use of these wastewater for irrigation results accumulation of heavy metals in soil and plants. So, the present investigation deals with the various concentrations (0, 5, 10, 25, 50, 100, 200 and 300 mg/l) of copper and zinc on germination studies of soybean. The different concentrations of copper and zinc were used for germination studies. The seedlings were allowed to grow upto seven days. The studied morphological traits increased at 5 mg/l concentration and these parameters are gradually decreased with the increase of copper and zinc concentrations.


Sign in / Sign up

Export Citation Format

Share Document