Association of the scuttle fly Megaselia leucozona Schmitz (Diptera: Phoridae) with sweat bees (Hymenoptera: Halictidae), with a description of the male fly

Megaselia leucozona Schmitz (Diptera, Phoridae) is reported from nests of Lasioglossum malachurum Kirby and Halictus scabiosae (Rossi) in Central Italy. The flies patrolled two nesting sites of the hosts and sometimes mated close to their nest entrances before entering. Observations agree with the general behaviour reported for other Megaselia species associated with fossorial bees and wasps. The hitherto unknownmale of M. leucozona is described, and the original description of a female is augmented and modified. This is the first report of a scuttle fly associated with nests of Halictidae in the Palaearctic Region.

Download Full-text

First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽

10.1094/pdis-02-14-0119-pdn ◽

2014 ◽

Vol 98 (7) ◽

pp. 1019-1019 ◽

Cited By ~ 2

Author(s):

Y. F. Wang ◽

S. Xiao ◽

Y. K. Huang ◽

X. Zhou ◽

S. S. Zhang ◽

...

Keyword(s):

Morphological Characteristics ◽

Severe Infection ◽

Original Description ◽

First Record ◽

Vegetable Crops ◽

Species Identity ◽

Fujian Province ◽

First Report ◽

Lateral Lines ◽

Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text

A new record confirms the occurrence of Aphanius mesopotamicus Coad, 2009, in southwestern Iran (Actinopterygii: Cyprinodontidae)

Check List ◽

10.15560/8.2.283 ◽

2012 ◽

Vol 8 (2) ◽

pp. 283 ◽

Cited By ~ 3

Author(s):

Yazdan Keivany ◽

Mohammad Sadegh Alavi-Yeganeh ◽

Jafar Seyfabadi

Keyword(s):

New Record ◽

Original Description ◽

Museum Specimens ◽

First Report ◽

Southern Branch ◽

Southwestern Iran ◽

The Karkheh River

We report the occurrence of Mesopotamian tooth carp, Aphanius mesopotamicus Coad 2009, in a southern branch of the Karkheh River, 10 km west of Hoor-Al-Azim Wetland. This is the first report of successful collection of this species after its first collection in 1978-80 and futile efforts during the last three decades and after its original description based on those old museum specimens.

Download Full-text

Naticid gastropod and octopodid cephalopod predatory traces: evidence of drill holes on the leucosid crab Ristoria pliocaenica (Ristori, 1891), from the Pliocene of the “La Serra” quarry (Tuscany, Italy)

Natural History Sciences ◽

10.4081/19 ◽

2012 ◽

Vol 153 (2) ◽

pp. 257 ◽

Cited By ~ 2

Author(s):

Giovanni Pasini ◽

Alessandro Garassino

Keyword(s):

Fossil Record ◽

Direct Evidence ◽

Central Italy ◽

Decapod Crustaceans ◽

Early Pliocene ◽

First Report ◽

Predatory Activity ◽

The Common ◽

Drill Holes

Garassino et al. (2012) reported on a rich community of decapod crustaceans including axiideans, gebiideans, anomurans, and brachyurans from the Zanclean (Early Pliocene) of the “La Serra” quarry near San Miniato (Pisa, Tuscany, central Italy). In this decapod-rich assemblage some carapaces of the common pebble crab Ristoria pliocaenica (Ristori, 1891) (Leucosiidae Samouelle, 1819) are drilled in characteristic ways, due to the predatory activity of individuals belonging to two different taxa of marine clades, possibly naticids (Gastropoda, Naticoidea), and to octopodids (Cephalopoda, Octopoda). This is the first report of direct evidence of predation by cephalopods on crabs in the fossil record.

Download Full-text

Intestinal Strongyle Genera in Different Typology of Donkey Farms in Tuscany, Central Italy

Veterinary Sciences ◽

10.3390/vetsci7040195 ◽

2020 ◽

Vol 7 (4) ◽

pp. 195

Author(s):

Michela Maestrini ◽

Marcelo Beltrão Molento ◽

Simone Mancini ◽

Mina Martini ◽

Francesco Giovanni Salvo Angeletti ◽

...

Keyword(s):

Central Italy ◽

Poor Performance ◽

Morphological Identification ◽

High Agreement ◽

Farm Typology ◽

First Report ◽

Organic Farm ◽

Identification Keys ◽

Third Stage ◽

Metrical Analysis

Intestinal strongyles are common helminths of donkeys, in which they may be responsible for disease and poor performance. This study aimed to identify intestinal strongyle genera in 55 naturally infected donkeys from three different farm typologies in Tuscany, central Italy, using morphological and metrical analysis of third stage larvae (L3) obtained from faecal cultures. Larvae were identified using two previous reported morphological identification keys. Moreover, eggs per gram (EPG) data were also evaluated to assess differences, if any, according to the farm typology, sex, and age of the examined donkeys. The results showed that small strongyles were prevalent in all donkey farms. In all examined farms, most (92–100%) of L3 were identified as cyathostomin species of the genera Cylicocyclus spp. and Cylicostephanus spp. Large strongyles of the genera Strongylus spp. and Triodontophorus spp., were identified at low percentage (8%), only in the single organic farm included in the study. A high agreement was observed between the two different morphometric keys used. No significant differences were found for EPG according to farm typology, and sex and age from the examined donkeys. This is the first report about genera identification of intestinal strongyles infecting donkeys in Tuscany, Italy.

Download Full-text

First report of egg predation by an unpaired Eurasian Coot,Fulica atra, L., 1758 (Aves: Gruiformes) on Black-winged Stilt,Himantopus himantopus, L., 1758 (Aves: Charadriiformes): one case from central Italy

Italian Journal of Zoology ◽

10.1080/11250003.2013.783631 ◽

2013 ◽

Vol 80 (2) ◽

pp. 313-316 ◽

Cited By ~ 1

Author(s):

G. Bruni ◽

F. Boggiano ◽

M. Menchetti ◽

E. Mori

Keyword(s):

Central Italy ◽

Egg Predation ◽

First Report ◽

Fulica Atra

Download Full-text

Occurrence of Class 1 and 2 Integrons in Resistant Enterobacteriaceae Collected from a Urban Wastewater Treatment Plant: First Report from Central Italy

Microbial Drug Resistance ◽

10.1089/mdr.2010.0117 ◽

2011 ◽

Vol 17 (2) ◽

pp. 229-234 ◽

Cited By ~ 18

Author(s):

Cristina Pellegrini ◽

Giuseppe Celenza ◽

Bernardetta Segatore ◽

Pierangelo Bellio ◽

Domenico Setacci ◽

...

Keyword(s):

Wastewater Treatment ◽

Wastewater Treatment Plant ◽

Central Italy ◽

Treatment Plant ◽

Urban Wastewater ◽

First Report ◽

Class 1 ◽

Urban Wastewater Treatment

Download Full-text

First Report of Root-Knot Nematode Meloidogyne hispanica Infecting Grapevines in Southern Spain

Plant Disease ◽

10.1094/pdis-93-12-1353b ◽

2009 ◽

Vol 93 (12) ◽

pp. 1353-1353 ◽

Cited By ~ 2

Author(s):

P. Castillo ◽

C. Gutiérrez-Gutiérrez ◽

J. E. Palomares-Rius ◽

C. Cantalapiedra Navarrete ◽

B. B. Landa

Keyword(s):

Phylogenetic Analyses ◽

Original Description ◽

Southern Spain ◽

Enzyme Analysis ◽

Root Knot Nematode ◽

First Report ◽

North Carolina State University ◽

General Decline ◽

Disease Surveys ◽

Meloidogyne Sp

Some commercial vineyards producing the ‘Condado de Huelva’ wine denomination of origin in Almonte, Bonares, and Rociana (Huelva Province), southern Spain, showed general decline in sandy soils in 2009. Disease surveys revealed severe infections of grapevine rootstock Richter 110 feeder roots and heavy soil infestations by a root-knot nematode (Meloidogyne sp.). Infected plants showed a general decline as the only visible aboveground symptom, but when roots were inspected, moderate to small galls on secondary feeder roots were detected. The Meloidogyne sp. population was extracted and quantified from soil and root samples as previously described (1) and identified by the female perineal pattern, esterase (Est) and malate dehydrogenase (Mdh) phenotypes, and sequencing and maximum parsimony (MP) analysis of the ribosomal DNA region D2-D3 of 28S (2,4). Morphology of the perineal patterns and measurements of the second-stage juveniles (J2s) matched those of the original description of Meloidogyne hispanica (3). Enzyme analysis revealed two slow and a medium Est bands, a strong band, and two additional weaker bands coincident with the S2-M1 and N3 Mdh M. hispanica phenotypes (2,4). D2-D3 sequences of all three populations sampled were 100% homologous (GenBank Accession No. GQ375158). Phylogenetic analyses with MP of those sequences placed the Meloidogyne sp. in a clade (100% support) that included all M. hispanica sequences available from the GenBank database (4). M. hispanica was first found in Seville Province, southern Spain, infecting rootstocks of Prunus spp. Its distribution has been confirmed worldwide on different agricultural crops. Thus, M. hispanica has been reported to be infecting grapevines in South Africa and Australia (4); however, to our knowledge, this is the first report of M. hispanica infecting grapevines in Europe. Our data suggest that M. hispanica may pose a threat for vineyard production in southern Spain since M. hispanica was found in 52.63 and 47.36% of soil and root samples, respectively, from 19 fields in ‘Condado de Huelva’, with nematode population densities ranging from 2.4 to 129.6 eggs and J2s per 100 cm3 of soil and 1 to 1,797 eggs and J2s per gram of fresh roots. Furthermore, genes that confer resistance to other common root-knot nematodes reported on grapevine in Europe may not protect against M. hispanica. References: (1) K. R. Barker. Nematode extraction and bioassays. Page 19 in: An Advanced Treatise on Meloidogyne. Vol. II, Methodology. K. R. Barker et al., eds. North Carolina State University Graphics, Raleigh, 1985. (2) P. R. Esbenshade and A. C. Triantaphyllou. J. Nematol. 22:10, 1990. (3) H. Hirschmann. J. Nematol. 18:520, 1986. (4) B. B. Landa et al. Plant Dis. 92:1104, 2008.

Download Full-text

First Report of the Root-Knot Nematode Meloidogyne enterolobii Parasitizing Watermelon from Veracruz, Mexico

Plant Disease ◽

10.1094/pdis-06-13-0636-pdn ◽

2014 ◽

Vol 98 (3) ◽

pp. 428-428 ◽

Cited By ~ 12

Author(s):

A. Ramírez-Suárez ◽

L. Rosas-Hernández ◽

S. Alcasio-Rangel ◽

T. O. Powers

Keyword(s):

Phylogenetic Trees ◽

Citrullus Lanatus ◽

Pcr Amplification ◽

Original Description ◽

Root Knot Nematode ◽

Morphometric Characters ◽

First Report ◽

Worldwide Distribution ◽

Meloidogyne Enterolobii ◽

Stylet Length

In early April 2012, a sampling of watermelon crop Citrullus lanatus (Thunb.) Matsum & Nakai, 1916 cv. Sunsugar took place as part of the National System of Epidemiological Phytosanitary Surveillance (SINAVEF-MEX). This sampling was conducted at Riachuelos locality, Tecolutla, Veracruz, located at the geographic coordinates: 20.42008° N and 96.9627° W, within 50 meters of the Gulf of Mexico. Plants showed yellowing, stunting, and high levels of infection expressed by extensive galling on the roots. These symptoms were reproduced in the greenhouse on watermelon cv. Sunsugar. Egg masses were extracted to obtain juveniles (J2). Female necks and perineal patterns were mounted as well as males and J2 to take measurements of selected morphometric characters. To determine the nematode identity based on a morphological species concept, the following characters were considered. Females: stylet length, DGO and perineal pattern; males: stylet length; J2: body, stylet, tail, and hyaline tail terminus length. The morphometric analysis showed that those values corresponded to the original description of the root-knot nematode Meloidogyne enterolobii Yang & Eisenback, 1983 (=M. mayaguensis Rammah & Hirschmann, 1988) (1,2,3,4). For confirmation of this finding, a molecular diagnosis was performed using markers located in rDNA and mtDNA by PCR amplification and DNA sequencing. The rDNA region analyzed was the expansion segments D2-D3 of the 28S gene (primers D2A and D3B). This produced an amplified product of 780 bp. With regard to mtDNA, an amplification of the marker located between the genes COII/16S (primers C2F3 and 1108) resulted in a fragment of 705 bp that is specific for M. enterolobii (1). Sequences of the amplified products were compared with sequences from GenBank (NCBI). The sequences of both markers exhibited 99 and 100% identity with sequences corresponding to M. enterolobii isolates from Florida, Puerto Rico, and China. Maximum likelihood phylogenetic trees of rDNA and mtDNA sequences demonstrated that the Mexican isolate of M. enterolobii grouped among other isolates exclusive of other Meloidogyne species. The detection of this nematode in Veracruz, Mexico, expands the previously known worldwide distribution. It represents a serious threat due to the high level of aggressiveness shown in watermelon, which was so severe that growers had to change to a different crop. To our knowledge, this is the first report of the root-knot nematode M. enterolobii infecting watermelon cv. Sunsugar in Veracruz, Mexico. References: (1) J. Brito et al. J. Nematol. 36:232, 2004. (2) G. Karssen et al. ZooKeys 181:67, 2012. (3) A. Rammah and H. Hirshmann. J. Nematol. 20:58, 1988. (4) B. Yang and J. Eisenback. J. Nematol. 15:381, 1983.

Download Full-text