scholarly journals Determinants of Persistent Patterns of Pepino Mosaic Virus Mixed Infections

2021 ◽  
Vol 12 ◽  
Author(s):  
Cristina Alcaide ◽  
Miguel A. Aranda
Keyword(s):  
Mosaic Virus ◽  
Economic Losses ◽  
Mixed Infections ◽  
Strong Positive Correlation ◽  
In Planta ◽  
Nucleotide Substitutions ◽  
Challenge Inoculation ◽  
Pepino Mosaic Virus ◽  
Time Lagged ◽  
Viral Accumulation

Pepino mosaic virus (PepMV) has become a pandemic virus in tomato crops, causing important economic losses worldwide. In Spain, isolates of the EU and CH2 strains co-circulate, with PepMV-EU predominantly found in mixed infections. Simultaneous in planta mixed infections result in an asymmetric antagonism against PepMV-CH2, but the outcome of over-infections has never been tested. PepMV-EU and PepMV-CH2 time-lagged inoculations were performed, and viral accumulation was measured 10 days after challenge inoculation. PepMV-EU had a protective effect over PepMV-CH2; in contrast, the accumulation of PepMV-EU increased in plants pre-inoculated with PepMV-CH2 as compared to single infections. We also studied the effect of the type of infection on viral transmission. Independently of the nature of the infection (single or mixed), we observed a strong positive correlation between virus accumulation in the source plant and transmission, excluding mixed infection effects different than modulating viral accumulation. Finally, in order to determine the genetic variability of PepMV strains in single and mixed infections, a 430 nucleotide region was RT-PCR amplified from samples from a serial passages experiment and deep-sequenced. No significant differences were found in the number of nucleotide substitutions between single and mixed infections for PepMV-EU; in contrast, significant differences were found for PepMV-CH2, which was more variable in single than in mixed infections. Comparing PepMV-EU with PepMV-CH2, a higher nucleotide diversity was found for PepMV-CH2. Collectively, our data strongly suggest that PepMV mixed infections can impact the virus epidemiology by modulating in planta virus strain accumulation and diversification.

scholarly journals Mixed Infections of Pepino Mosaic Virus Strains Modulate the Evolutionary Dynamics of this Emergent Virus

2009 ◽  
Vol 83 (23) ◽  
pp. 12378-12387 ◽  
Author(s):  
P. Gómez ◽  
R. N. Sempere ◽  
S. F. Elena ◽  
M. A. Aranda
Keyword(s):  
Mosaic Virus ◽  
Evolutionary Dynamics ◽  
Economic Losses ◽  
Mixed Infections ◽  
In Planta ◽  
Tomato Production ◽  
Pepino Mosaic Virus ◽  
Epidemiological Pattern ◽  
Virus Emergence ◽  
Virus Strains

ABSTRACT Pepino mosaic virus (PepMV) is an emerging pathogen that causes severe economic losses in tomato crops (Solanum lycopersicum L.) in the Northern hemisphere, despite persistent attempts of control. In fact, it is considered one of the most significant viral diseases for tomato production worldwide, and it may constitute a good model for the analysis of virus emergence in crops. We have combined a population genetics approach with an analysis of in planta properties of virus strains to explain an observed epidemiological pattern. Hybridization analysis showed that PepMV populations are composed of isolates of two types (PepMV-CH2 and PepMV-EU) that cocirculate. The CH2 type isolates are predominant; however, EU isolates have not been displaced but persist mainly in mixed infections. Two molecularly cloned isolates belonging to each type have been used to examine the dynamics of in planta single infections and coinfection, revealing that the CH2 type has a higher fitness than the EU type. Coinfections expand the range of susceptible hosts, and coinfected plants remain symptomless several weeks after infection, so a potentially important problem for disease prevention and management. These results provide an explanation of the observed epidemiological pattern in terms of genetic and ecological interactions among the different viral strains. Thus, mixed infections appear to be contributing to shaping the genetic structure and dynamics of PepMV populations.

scholarly journals Long-Term Cocirculation of Two Strains of Pepino Mosaic Virus in Tomato Crops and Its Effect on Population Genetic Variability

2020 ◽  
Vol 110 (1) ◽  
pp. 49-57 ◽  
Author(s):  
C. Alcaide ◽  
M. P. Rabadán ◽  
M. Juárez ◽  
P. Gómez
Keyword(s):  
Genetic Variability ◽  
Mosaic Virus ◽  
Evolutionary Dynamics ◽  
Geographical Area ◽  
Viral Fitness ◽  
Mixed Infections ◽  
Supporting Evidence ◽  
Pepino Mosaic Virus ◽  
Nucleotide Variability

Mixed viral infections are common in plants, and the evolutionary dynamics of viral populations may differ depending on whether the infection is caused by single or multiple viral strains. However, comparative studies of single and mixed infections using viral populations in comparable agricultural and geographical locations are lacking. Here, we monitored the occurrence of pepino mosaic virus (PepMV) in tomato crops in two major tomato-producing areas in Murcia (southeastern Spain), supporting evidence showing that PepMV disease-affected plants had single infections of the Chilean 2 (CH2) strain in one area and the other area exhibited long-term (13 years) coexistence of the CH2 and European (EU) strains. We hypothesized that circulating strains of PepMV might be modulating the differentiation between them and shaping the evolutionary dynamics of PepMV populations. Our phylogenetic analysis of 106 CH2 isolates randomly selected from both areas showed a remarkable divergence between the CH2 isolates, with increased nucleotide variability in the geographical area where both strains cocirculate. Furthermore, the potential virus–virus interaction was studied further by constructing six full-length infectious CH2 clones from both areas, and assessing their viral fitness in the presence and absence of an EU-type isolate. All CH2 clones showed decreased fitness in mixed infections and although complete genome sequencing indicated a nucleotide divergence of those CH2 clones by area, the magnitude of the fitness response was irrespective of the CH2 origin. Overall, these results suggest that although agroecological cropping practices may be particularly important for explaining the evolutionary dynamics of PepMV in tomato crops, the cocirculation of both strains may have implications on the genetic variability of PepMV populations.

scholarly journals A Thioredoxin Domain-Containing Protein Interacts with Pepino mosaic virus Triple Gene Block Protein 1

2018 ◽  
Vol 19 (12) ◽  
pp. 3747
Author(s):  
Matthaios Mathioudakis ◽  
Souheyla Khechmar ◽  
Carolyn Owen ◽  
Vicente Medina ◽  
Karima Ben Mansour ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Triple Gene Block ◽  
Polyclonal Antiserum ◽  
Post Inoculation ◽  
Mrna Levels ◽  
In Planta ◽  
Pepino Mosaic Virus ◽  
Gene Block ◽  
Triple Gene Block Protein

Pepino mosaic virus (PepMV) is a mechanically-transmitted tomato pathogen of importance worldwide. Interactions between the PepMV coat protein and triple gene block protein (TGBp1) with the host heat shock cognate protein 70 and catalase 1 (CAT1), respectively, have been previously reported by our lab. In this study, a novel tomato interactor (SlTXND9) was shown to bind the PepMV TGBp1 in yeast-two-hybrid screening, in vitro pull-down and bimolecular fluorescent complementation (BiFC) assays. SlTXND9 possesses part of the conserved thioredoxin (TRX) active site sequence (W__PC vs. WCXPC), and TXND9 orthologues cluster within the TRX phylogenetic superfamily closest to phosducin-like protein-3. In PepMV-infected and healthy Nicotiana benthamiana plants, NbTXND9 mRNA levels were comparable, and expression levels remained stable in both local and systemic leaves for 10 days post inoculation (dpi), as was also the case for catalase 1 (CAT1). To localize the TXND9 in plant cells, a polyclonal antiserum was produced. Purified α-SlTXND9 immunoglobulin (IgG) consistently detected a set of three protein bands in the range of 27–35 kDa, in the 1000 and 30,000 g pellets, and the soluble fraction of extracts of healthy and PepMV-infected N. benthamiana leaves, but not in the cell wall. These bands likely consist of the homologous protein NbTXND9 and its post-translationally modified derivatives. On electron microscopy, immuno-gold labelling of ultrathin sections of PepMV-infected N. benthamiana leaves using α-SlTXND9 IgG revealed particle accumulation close to plasmodesmata, suggesting a role in virus movement. Taken together, this study highlights a novel tomato-PepMV protein interaction and provides data on its localization in planta. Currently, studies focusing on the biological function of this interaction during PepMV infection are in progress.

scholarly journals In situ hybridization for the localization of two pepino mosaic virus isolates in mixed infections

2019 ◽  
Vol 267 ◽  
pp. 42-47 ◽  
Author(s):  
C. Gómez-Aix ◽  
C. Alcaide ◽  
P. Gómez ◽  
M.A. Aranda ◽  
M.A. Sánchez-Pina
Keyword(s):  
In Situ Hybridization ◽  
Mosaic Virus ◽  
Mixed Infections ◽  
Pepino Mosaic Virus ◽  
Virus Isolates

scholarly journals Sources of Resistance to Pepino mosaic virus (PepMV) in Tomato

HortScience ◽  
2007 ◽  
Vol 42 (1) ◽  
pp. 40-45 ◽  
Author(s):  
Salvador Soler-Aleixandre ◽  
C. López ◽  
J. Cebolla-Cornejo ◽  
F. Nuez
Keyword(s):  
Mosaic Virus ◽  
Solanum Lycopersicum ◽  
Infection Rate ◽  
Systemic Infection ◽  
European Countries ◽  
Sources Of Resistance ◽  
Pepino Mosaic Virus ◽  
Viral Accumulation

The disease incited by Pepino mosaic virus (PepMV) is currently a serious problem for tomato (Solanum lycopersicum L.) crops in several European countries. A collection of accessions from different Solanum species was screened to find sources of resistance to PepMV. All plants of S. lycopersicum, S. lycopersicum var. cerasiforme, S. pennellii Correll, S. cheesmaniae (L. Riley) Fosberg, S. habrochaites S. Knapp & D.M. Spooner, S. neorickii D.M. Spooner, G.J. Anderson & R.K. Jansen, S. pimpinellifolium L., S. basendopogon Bitter, S. canense Rydb., S. caripense Humb. & Bonpl. ex Dunal, and S. muricatum Aiton accessions showed a 100% systemic infection rate, high viral accumulation, and apparent symptoms. In some accessions of the species S. chilense (Dunal) Reiche and S. peruvianum L., a variable percentage of plants without systemic infection was observed. Although all plants of ECU-335 accession of S. ochranthum Dunal showed systemic infection by PepMV, the symptoms were mild and the levels of viral accumulation were low. PepMV was not detected in plants of AN-CA-214 accession of S. pseudocapsicum L. No symptoms were observed either on inoculated leaves or on growing leaves. The use of the latter two species is limited considering that they cannot be sexually crossed with cultivated tomato. As a result, S. chilense and S. peruvianum are the most promising species in the search for sources of resistance to PepMV.

scholarly journals Tomato Brown Rugose Fruit Virus Contributes to Enhanced Pepino Mosaic Virus Titers in Tomato Plants

Viruses ◽  
2020 ◽  
Vol 12 (8) ◽  
pp. 879 ◽  
Author(s):  
Chen Klap ◽  
Neta Luria ◽  
Elisheva Smith ◽  
Lior Hadad ◽  
Elena Bakelman ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Throughput Sequencing ◽  
Amino Acid Position ◽  
Viral Disease ◽  
Mixed Infections ◽  
Rt Pcr ◽  
Tomato Production ◽  
Pepino Mosaic Virus ◽  
Disease Symptoms ◽  
Tomato Plants

The tobamovirus tomato brown rugose fruit virus (ToBRFV), a major threat to tomato production worldwide, has recently been documented in mixed infections with the potexvirus pepino mosaic virus (PepMV) CH2 strain in traded tomatoes in Israel. A study of greenhouse tomato plants in Israel revealed severe new viral disease symptoms including open unripe fruits and yellow patched leaves. PepMV was only detected in mixed infections with ToBRFV in all 104 tested sites, using serological and molecular analyses. Six PepMV isolates were identified, all had predicted amino acids characteristic of CH2 mild strains excluding an isoleucine at amino acid position 995 of the replicase. High-throughput sequencing of viral RNA extracted from four selected symptomatic plants showed solely the ToBRFV and PepMV, with total aligned read ratios of 40.61% and 11.73%, respectively, indicating prevalence of the viruses. Analyses of interactions between the co-infecting viruses by sequential and mixed viral inoculations of tomato plants, at various temperatures, showed a prominent increase in PepMV titers in ToBRFV pre-inoculated plants and in mixed-infected plants at 18–25 °C, compared to PepMV-single inoculations, as analyzed by Western blot and quantitative RT-PCR tests. These results suggest that Israeli mild PepMV isolate infections, preceded by ToBRFV, could induce symptoms characteristic of PepMV aggressive strains.

scholarly journals Rapid evolutionary dynamics of the Pepino mosaic virus – status and future perspectives

2016 ◽  
Vol 56 (4) ◽  
pp. 337-345 ◽  
Author(s):  
Julia Minicka ◽  
Beata Hasiów-Jaroszewska ◽  
Natasza Borodynko-Filas ◽  
Henryk Pospieszny ◽  
Inge Maria Hanssen
Keyword(s):  
Mosaic Virus ◽  
Evolutionary Dynamics ◽  
Current Knowledge ◽  
Plant Protection ◽  
Diagnostic Tools ◽  
Nucleotide Substitutions ◽  
Single Nucleotide ◽  
Pepino Mosaic Virus ◽  
Worldwide Population ◽  
Protection Strategies

AbstractPepino mosaic virus (PepMV) has emerged as an important pathogen of greenhouse tomato crops and is currently distributed worldwide. Population genetic studies have revealed a shift in the dominant PepMV genotype from European (EU) to Chilean 2 (CH2) in North America and several European countries. New genetic variants are constantly being created by mutation and recombination events. Single nucleotide substitutions in different parts of the genome were found to affect on development of symptoms resulting in new pathotypes and accumulation of viral RNA. The variability of the PepMV population has a great impact on designing specific diagnostic tools and developing efficient and durable strategies of disease control. In this paper we review the current knowledge about the PepMV population, the evolutionary dynamics of this highly infective virus, methods for its detection and plant protection strategies.

scholarly journals First Report of the US1 Strain of Pepino mosaic virus in Tomato in the Canary Islands, Spain

Plant Disease ◽  
2008 ◽  
Vol 92 (11) ◽  
pp. 1590-1590 ◽  
Author(s):  
A. Alfaro-Fernández ◽  
M. C. Cebrián ◽  
C. Córdoba-Sellés ◽  
J. A. Herrera-Vásquez ◽  
C. Jordá
Keyword(s):  
Mosaic Virus ◽  
Canary Islands ◽  
Sequence Data ◽  
Triple Gene Block ◽  
Economic Losses ◽  
Sequence Information ◽  
Specific Primers ◽  
Pepino Mosaic Virus ◽  
First Report ◽  
Gene Block

Pepino mosaic virus (PepMV), a member of the genus Potexvirus, was first described in 1974 on pepino (Solanum muricatum Ait.) in Peru. In 1999, PepMV was reported to be affecting tomato (Solanum lycopersicum L.) (3), and currently, the virus is distributed throughout many parts of the world causing economic losses in tomato crops. This virus induces not only a high variability of symptoms on infected plants, including distortion, chlorosis, mosaic, blistering, and filiformity on leaves and marbling on fruits, but also exhibits substantial genetic diversity. Five strains or genotypes of PepMV have been described, including European tomato (EU), Peruvian (PE), Chilean 2 (CH2), and two American strains, US1 (including CH1) and US2. No correlation has been found between different genotypes and symptom expression of PepMV infection. Studies have demonstrated that field populations of PepMV in Europe belong to EU and US2 or CH2 strains. Mixed infections between these strains and interstrain recombinant isolates are also found (1,2). In Spain, the PE strain was also described, but at a lower relative frequency than other strains (2). In February 2007 in the Canary Islands (Tenerife, Spain), a PepMV isolate (PepMV-Can1) showing the typical leaf symptoms of blistering and mosaic was collected. PepMV was first identified by double-antibody sandwich (DAS)-ELISA with specific antisera against PepMV (DSMZ GMBH, Baunschweig, Germany) according to the manufacturer's instructions. The serological identification was confirmed by reverse transcription (RT)-PCR with two pairs of PepMV-specific primers Pep3/Pep4 and CP-D/CP-R that amplify a fragment of the RNA dependent RNA polymerase (RdRp) gene and the complete coat protein (CP) gene, respectively (2). PCR products were purified and directly sequenced. The amplified RdRp fragment of PepMV-Can1 (GenBank Accession No. EU791618) showed 82% nt identity with the EU and PE strains (GenBank Accession Nos. AJ606360 and AM109896, respectively), but more than 98% identity with the US2 and US1 strains (GenBank Accession Nos. AY509927 and AY 509926, respectively). Sequence information obtained from the amplified CP fragment (GenBank Accession No. EU797176) showed 99% nt identity with US1 and less than 83% with EU, PE, CH2 (GenBank Accession No. DQ000985), and US2. To confirm these results, specific primers for the triple gene block (TGB) were designed using the sequence data from GenBank Accession Nos. AY509926, AY509927, DQ000985, AJ606360, and AM109896. (PepTGB-D:5′ GATGAAGCTGAACAACATTTC 3′ and PepTGB-R: 5′ GGAGCTGTATTRGGATTTGA 3′). A 1,437-bp fragment (GenBank Accession No. EU797177) was obtained, sequenced, and compared with the published sequences, showing 98% nt identity with the US1 strain and less than 86% with the other strains of PepMV. The highest sequence identity in all the studied regions of the PepMV-Can1 isolate was with the US1 strain of PepMV. To our knowledge, this is not only the first report of an isolate of the US1 strain in the Canary Islands (Spain), but also the first report of the presence of this genotype in a different location than its original report (North America). References: (1) I. Hanssen et al. Eur. J. Plant Pathol. 121:131, 2008. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) R. A. R. Van der Vlugt et al. Plant Dis. 84:103, 2000.

Sign in / Sign up

Export Citation Format

Share Document