scholarly journals ISOLASI BAKTERI ENDOFIT SIMBION DARI SPONS Stylissa sp. DAN UJI AKTIVITAS ANTIBAKTERI SERTA IDENTIFIKASI SECARA MOLEKULER MENGGUNAKAN GEN 16S rRNA

PHARMACON ◽  
2021 ◽  
Vol 10 (1) ◽  
pp. 649
Author(s):  
Engjinia Frenny Kandio ◽  
Adithya Yudistira ◽  
John M.R. Runtuwene
Keyword(s):  
Staphylococcus Aureus ◽  
Antibacterial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Bioactive Compounds ◽  
Molecular Identification ◽  
Rrna Gene ◽  
Filter Feeder ◽  
The 16S Rrna Gene

ABSTRACTSponges are porous animals that are filter feeders and they become a habitat for microorganisms to nest in their bodies. The result of the symbiosis between sponges and microorganisms, especially in bacteria is the ability of the sponge to produce bioactive compounds. One of the potentials derived from these bioactive compounds is antibacterial. This study aims to isolate and test the antibacterial activity of the endophytic symbiont bacteria Stylissa sp., as well as to carry out molecular identification using the 16S rRNA gene of symbiont bacteria isolates that show the greatest antibacterial power. Three isolates of endophytic symbiont bacteria were successfully obtained through the purification stage. Each isolate was coded E1, E2, and E3. With the average inhibition zone against Escherichia coli bacteria, E1 (7.26 mm) is in the moderate category, E2 (5.42 mm) is in the moderate category and E3 (0.96 mm) is in the weak category. While the antibacterial power against Staphylococcus aureus bacteria, E1 (10.26 mm) in the moderate category, E2 (2.10 mm) in the moderate category, and E3 (0.17 mm) in the weak category. The endophytic bacteria that have the greatest antibacterial power is in isolate E1 which is based on molecular analysis using the 16S rRNA gene identified as Bacillus cereus bacteria. Keywords: Stylissa sp. Sponge, endophytic symbiont bacteria, antibacterial activity,                                          molecular identification, 16S rRNA Gene   ABSTRAKSpons adalah hewan berpori yang bersifat filter feeder sehingga menjadi habitat bagi mikroorganisme untuk bersarang di dalam tubuhnya. Hasil dari simbiosis antara spons dan mikroorganisme dalam hal ini bakteri yaitu kemampuan spons dalam menghasilkan senyawa bioaktif. Salah satu potensi yang berasal dari senyawa bioaktif tersebut adalah antibakteri. Penelitian ini bertujuan untuk mengisolasi dan melakukan pengujian aktivitas antibakteri dari bakteri simbion endofit spons Stylissa sp., serta melakukan identifikasi secara molekuler menggunakan gen 16S rRNA terhadap isolat bakteri simbion yang menunjukkan daya antibakteri terbesar. Sebanyak 3 isolat bakteri simbion endofit berhasil diperoleh melalui tahap purifikasi. Masing-masing isolat diberi kode E1, E2, dan E3. Dengan rata-rata zona hambat terhadap bakteri Escherchia coli yaitu, E1 (7,26 mm) termasuk kategori sedang, E2 (5,42 mm) termasuk kategori sedang, E3 (0,96 mm) dengan kategori lemah. Sedagkan daya antibakteri terhadap bakteri Staphylococcus aureus yaitu, E1 (10,26 mm) dengan kategori sedang, E2 (2,10 mm) termasuk kategori sedang, dan E3 (0,17 mm) pada kategori lemah. Bakteri endofit yang memiliki daya antibakteri terbesar yaitu isolat E1 yang berdasarkan analisis secara molekuler dengan menggunakan gen 16S rRNA teridentifikasi sebagai Bacillus cereus. Kata kunci: Spons Stylissa sp., bakteri simbion endofit, aktivitas antibakteri, identifikasi molekuler, gen 16S  rRNA.

scholarly journals THE 16S rRNA GENE MARKER-BASED MOLECULAR IDENTIFICATION OF CULTURABLE COLIFORM BACTERIA ISOLATED FROM FORAMINIFERA CALCARINA DERIVED FROM PRAMUKA ISLAND WATERS, THE SERIBU ISLAND DISTRICT, JAKARTA PROVINCE

2020 ◽  
Vol 13 (1) ◽  
pp. 10-18
Author(s):  
Mochamad Untung Kurnia - Agung ◽  
Agus Tri Askar ◽  
Yuli Andriani ◽  
Lintang Permatasari Yuliadi
Keyword(s):  
Coral Reef ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Identification ◽  
Bay Of Bengal ◽  
Coliform Bacteria ◽  
Gene Marker ◽  
Rrna Gene ◽  
Gene Markers ◽  
The 16S Rrna Gene

Contamination of coliform bacteria in benthic foraminifera has been reported due to pollution of organic wastes in the aquatic environment around coral reef ecosystems and this event was known to interfere the process of foraminifera shell formation which in turn resulted the disruption of the role of foraminifera in the process of formation of coral reef bottom sediments. The aim of this research is to identify the isolates of culturable coliform bacteria that contaminate foraminifera Calcarina species isolated from the waters of the Pramuka Island, the Seribu Island district, Jakarta Province using the 16S rRNA gene markers. Foraminifera sampling was carried out in the waters of Pramuka Island, the Seribu Island district, Jakarta Province in 5 (five) stations, while the process of bacterial isolation and molecular identification were carried out at the Laboratory of Microbiology and Molecular Biotechnology (MICROMOL), Faculty of Fisheries and Marine Sciences (FPIK), University Padjadjaran. Molecular identification was carried out using the Polymerase Chain Reaction (PCR) method based on the 16S rRNA gene markers. Sequencing is done by sending PCR results to 1st Base, sequencing service company, in Singapore and then, the aligning of sequencing results with databases in genBank was done using  the Basic Local Alignment Search Tool (BLASTTM) program available on the National Center for Biotechnology Information (NCBI) website. The results of 16S rRNA gene amplification from the five isolates produced amplicons of ± 1400 bp length with concentrations ranging from 157.5 µg / mL-230 µg / mL and with a purity ratio ranging from 1.477-1.769. While the results of BLAST and phylogenetic analysis showed that the five isolates were closely related to the isolate Eschericia coli strain inspire99 (Acc No. JQ315935.1), which was isolated from the waters of the Bay of Bengal, India. These results also indicate the existence of ecological connectivity between the waters of the Bay of Bengal in India and the waters of Pramuka Island in Indonesia.

scholarly journals Molecular identification of bacteria isolated from culture medium of rotifer fed on fishery waste diet

2020 ◽  
Vol 21 (6) ◽  
Author(s):  
Stenly Wullur ◽  
HATOPAN NAPITUPULU ◽  
LETHA LOISE WANTANIA ◽  
ELVY LIKE GINTING ◽  
VEIBE WAROUW ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Identification ◽  
Culture Medium ◽  
16S Rrna Genes ◽  
Rrna Genes ◽  
Rrna Gene ◽  
Seawater Salinity ◽  
Identification Of Bacteria ◽  
The 16S Rrna Gene

Abstract. Wullur S, Napitupulu H, Wantania LL, Ginting EL, Warouw V, Tallei TE, Rumengan IFM. 2020. Molecular identification of bacteria isolated from culture medium of rotifer fed on fishery waste diet. Biodiversitas 21: 2735-2740. The aim of this study was 16S-rRNA sequences based molecular identification of bacteria isolated from culture medium of rotifer fed with fishery waste diet (FWD). We cultured rotifer Brachionus rotundiformis in sterilized seawater (salinity 25 ppt) using FWD, following the procedure in Patent No. P00201609066. Bacteria from the culture were collected, homogenized, diluted 10 to 1000 fold, spread on agar plates and incubated at 370C for 24 to 48 hours. Representative colonies of the bacteria according to their morphologies were isolated for further characterization. Genomic DNA of the isolates were extracted, and the 16S rRNA gene of the isolates were amplified. Polymerase Chain Reaction (PCR) product of each isolate was sequenced and queried against the NCBI GenBank database. Six different isolates based on size, color, elevation, margin, and colony were observed during 24-48 hours incubation at 370C. The 16S rRNA genes of the six isolates were successfully amplified and produced DNA band at 1300-1500 bp, with quality value equal to or greater than 20 (QV20+) of each entire sequence around 941-1253 bases. Basic Local Alignment Search Tool (BLAST) queries in the NCBI GenBank and EzBioCloud database using the 16S-rRNA gene sequences showed that the six isolates belong to four different genera, i.e: Bacillus, Staphylococcus, Vibrio, and Alteromonas.

scholarly journals Asaia sp., an Unusual Spoilage Organism of Fruit-Flavored Bottled Water

2002 ◽  
Vol 68 (8) ◽  
pp. 4130-4131 ◽  
Author(s):  
John E. Moore ◽  
Mark McCalmont ◽  
Jiru Xu ◽  
B. Cherie Millar ◽  
Neville Heaney
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Identification ◽  
Bacterial Overgrowth ◽  
Pcr Amplification ◽  
Acetic Acid Bacteria ◽  
Bottled Water ◽  
Rrna Gene ◽  
Identification Techniques ◽  
The 16S Rrna Gene

ABSTRACT A gram-negative bacillus was isolated from a batch of fruit-flavored bottled water, which had spoiled as a result of bacterial overgrowth (>106 CFU/ml). The spoilage organism was extremely difficult to identify phenotypically and was poorly identified as Pasturella sp. (78.7% identification profile) employing the API 20NE identification scheme, which gave the profile 5040000. Molecular identification through PCR amplification of a partial region of the 16S rRNA gene followed by direct automated sequencing of the PCR amplicon allowed identification of the organism. Due to the sequence identity (100%) between the spoilage organism and a reference strain in GenBank, the spoilage isolate was considered to be an Asaia sp., a recently described genus and member of the acetic acid bacteria. This is the first report of Asaia sp. causing spoilage of a foodstuff and highlights the benefits of molecular identification techniques based on 16S rRNA gene sequences in the identification of unusual spoilage organisms.

scholarly journals FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

2020 ◽  
Vol 8 (2) ◽  
pp. 73
Author(s):  
Oktavianus Dalenoh ◽  
Stenly Wullur ◽  
Elvy L Ginting ◽  
Veibe Warouw ◽  
Detty N Rumampuk ◽  
...  
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Molecular Analysis ◽  
Bacterial Species ◽  
Rrna Gene ◽  
Neighbor Joining ◽  
Sequence Quality ◽  
The 16S Rrna Gene

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

scholarly journals Molecular identification of bacteria isolated from culture medium of the gold-lipped pearl oyster Pinctada maxima larvae

2020 ◽  
Vol 21 (11) ◽  
Author(s):  
Stenly Wullur ◽  
HATOPAN NAPITUPULU ◽  
ELVY LIKE GINTING ◽  
NOLDY GUSTAF FRANS MAMANGKEY ◽  
LETHA LOUISIANAWANTANIA ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Identification ◽  
Culture Medium ◽  
Pearl Oyster ◽  
Rrna Genes ◽  
Rrna Gene ◽  
Identification Of Bacteria ◽  
Pinctada Maxima ◽  
The 16S Rrna Gene

Abstract. Wullur S, Napitupulu H, Wantania LL, Ginting EL, Mamangkey NGF, Smolak R, Ogello E. 2020. Molecular identification of bacteria isolated from culture medium of the gold-lipped pearl oyster Pinctada maxima larvae. Biodiversitas 21: 5291-5297.  This study was conducted for the molecular identification of bacteria species isolated from culture medium of the gold-lipped pearl oyster, Pinctada maxima larvae. The pearl oysters were cultured using live-microalgae (Isochrysis sp) and fish waste diet (FWD) as food sources.  Bacteria were isolated from the oyster larvae and identified based on the 16S rRNA gene sequence. The isolated bacteria were grown on agar plates and incubated at 37°C for 24 to 48 hours. Representative colonies of the bacteria were selected and cultured for molecular analysis.  The 16S rRNA genes of the bacteria were amplified and the sequences were matched with the NCBI GenBank database. Seven different colonies were observed based on morphological characters. Similarity test by conducting the Basic Local Alignment Search Tool (BLAST) in the NCBI GenBank database, using the 16S rRNA gene sequences showed that the seven isolates colonies possess high similarity to five bacteria species i.e. Pseudomonas pachastrellae, Vibrio alginolyticus, Bacillus filamentosus, Bacillus cereus and Idiomarina fontislapidosi belonging to four different genera i.e. Bacillus, Staphylococcus, Vibrio, and Alteromonas.

scholarly journals Molecular identification of a new isolate of actinobacteria ATIS61 and characterization of the protease activities

2021 ◽  
Vol 22 (3) ◽  
Author(s):  
FADHLIAH AMFAR ◽  
Lenni Fitri ◽  
SUHARTONO SUHARTONO
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Molecular Identification ◽  
Protease Activity ◽  
Rrna Gene ◽  
16S Rrna Gene Analysis ◽  
Peptide Bonds ◽  
Activity Test ◽  
The 16S Rrna Gene

Abstract. Amfar F, Fitri L, Suhartono. 2021. Molecular identification of a new isolate of actinobacteria ATIS61 and characterization of the protease activities. Biodiversitas 22: 1564-1569. Protease is an enzyme that catalyzes the hydrolysis of peptide bonds in protein. Actinobacteria are one of bacterial groups that is able to produce protease. Actinobacteria are Gram-positive bacteria and mostly aerobic. This study aimed to identify protease-producing actinobacteria ATIS61 isolate using 16S rRNA gene and to characterize the protease activity. This study was experimental research, consisted of amplification and sequencing of the 16S rRNA gene, and protease activity test. The 16S rRNA gene analysis showed that ATIS61 isolate was closely related to Nocardia sp. strain 335427 with a 99.88% similarity and the result of phylogenetic tree construction was related to Nocardia farcinica strain ARS8 with Bootstrap 94%. Protease activity test showed the highest activity was on the eighth day of incubation at 0.115 U/mL. Protease activity based on temperature showed the highest activity at 40°C of 0.156 U/mL and the stability of protease towards temperature was stable at 40°C and 50°C. Protease activity showed that the highest protease activity was at pH 8 of 0.096 U/mL and the highest protease stability was also at pH 8. The addition of HgCl2 showed that it could inhibit protease activity with a value of 0.059 U/mL.

scholarly journals Identifikasi Isolat Rizobakteri Indigenos Potensial Sebagai Agens Biokontrol Ganoderma boninense

2021 ◽  
pp. 57-63
Author(s):  
Yulmira Yanti ◽  
Nurbailis Nurbailis ◽  
Imam Rifai
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Oil Palm ◽  
Control Plant ◽  
Rrna Gene ◽  
Ganoderma Boninense ◽  
Microbacterium Paraoxydans ◽  
And Control ◽  
The 16S Rrna Gene

Rhizobacteria was group of bacteria that colonize roots, affect growth and control plant pathogensBased on the results of previous studies, 6 isolates have the best ability to control G. boninense in oil palm seedlings. To determine the ability of these isolates, characterization needs to be done. This study aims to identify the molecular isolates of selected rhizobacteria indigenous that act as biocontrol agents G. boninense. Molecular identification of selected rhizobacteria isolates using the 16S rRNA gene. The results showed that All RBI isolates were identified as different species of Bacillus paramycoides strain MCCC (RZ1A 2.1), Microbacterium paraoxydans strain CF36 (RZ2B 1.1), Bacillus albus strain MCCC 1A02146 (RZ2C 2.1), Bacillus cereus strain JCM 2152 (RZ2E 2.1), Serratia marcescens strain NBRC 102204 (RZ2E 1.2), Bacillus cereus ATCC 14579 (RZ1E 2.1).

scholarly journals Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

2014 ◽  
Vol 64 (Pt_3) ◽  
pp. 781-786 ◽  
Author(s):  
Maximo Sánchez ◽  
Martha-Helena Ramírez-Bahena ◽  
Alvaro Peix ◽  
María J. Lorite ◽  
Juan Sanjuán ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Sequence Similarity ◽  
Carbon Sources ◽  
Lotus Corniculatus ◽  
Culture Conditions ◽  
Rrna Gene ◽  
Content Type ◽  
Link Type ◽  
The 16S Rrna Gene

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium . The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium , for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T).

Sign in / Sign up

Export Citation Format

Share Document