scholarly journals Identifikasi Isolat Rizobakteri Indigenos Potensial Sebagai Agens Biokontrol Ganoderma boninense

2021 ◽  
pp. 57-63
Author(s):  
Yulmira Yanti ◽  
Nurbailis Nurbailis ◽  
Imam Rifai
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Oil Palm ◽  
Control Plant ◽  
Rrna Gene ◽  
Ganoderma Boninense ◽  
Microbacterium Paraoxydans ◽  
And Control ◽  
The 16S Rrna Gene

Rhizobacteria was group of bacteria that colonize roots, affect growth and control plant pathogensBased on the results of previous studies, 6 isolates have the best ability to control G. boninense in oil palm seedlings. To determine the ability of these isolates, characterization needs to be done. This study aims to identify the molecular isolates of selected rhizobacteria indigenous that act as biocontrol agents G. boninense. Molecular identification of selected rhizobacteria isolates using the 16S rRNA gene. The results showed that All RBI isolates were identified as different species of Bacillus paramycoides strain MCCC (RZ1A 2.1), Microbacterium paraoxydans strain CF36 (RZ2B 1.1), Bacillus albus strain MCCC 1A02146 (RZ2C 2.1), Bacillus cereus strain JCM 2152 (RZ2E 2.1), Serratia marcescens strain NBRC 102204 (RZ2E 1.2), Bacillus cereus ATCC 14579 (RZ1E 2.1).

scholarly journals FILOGENI MOLEKULER ISOLAT BAKTERI F0-0-3-1 DARI MEDIA PEMELIHARAAN ROTIFER

2020 ◽  
Vol 8 (2) ◽  
pp. 73
Author(s):  
Oktavianus Dalenoh ◽  
Stenly Wullur ◽  
Elvy L Ginting ◽  
Veibe Warouw ◽  
Detty N Rumampuk ◽  
...  
Keyword(s):  
16S Rrna ◽  
Molecular Phylogeny ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Molecular Analysis ◽  
Bacterial Species ◽  
Rrna Gene ◽  
Neighbor Joining ◽  
Sequence Quality ◽  
The 16S Rrna Gene

The aim of this study was to construct molecular phylogeny of bacteria suspected to involve in decomposing the fishery waste as diet for rotifer culture. The bacteria were isolated from culture of rotifer and propagated for molecular analysis. Genomic DNA of the bacteria was extracted using DNeasy Blood and Tissue Kit (Qiagen). The 16S rRNA gene was amplified using primer pairs i.e. 8F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCCT GTTACGACTT) and sequenced. The sequences were analyzed using Sequence Scanner and MEGA 7, and BLASTed on the NCBI website (www.ncbi.nml.nih.gov). Molecular phylogeny of the isolate was constructed using Neighbor Joining Tree method. Isolate bacteria F0-0-3-1 from culture of rotifer fed with fish waste diet was successfully propagated for molecular analysis. 16S rRNA gene of the isolate bacteria was successfully amplified and showed a DNA band at 1400 bp. Nucleotides sequence quality of the 16S rRNA gene i.,e QV+20 and CRL were 995 and 941 nucletides. BLAST result of the 16S rRNA gene showed 98.87% percent identity of the isolate bacteria F0- 0-3-1 with bacterial species in the genus Bacillus i.e. Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Molecular phylogeny analysis showed that the three species was in the same clade.Keywords: Phylogeny, molecular, bacteria, rotifer, 16S rRNA gene Penelitian ini bertujuan untuk mengkonstruksi filogeni molekuler bakteri yang diduga terlibat dalam proses penguraian limbah perikanan sebagai pakan untuk kultur rotifer. Isolat bakteri yang diperoleh dari kultur rotifer tersebut, dibiakkan dan DNA genomnya diekstrak menggunakan DNeasy Blood and Tissue Kit (Qiagen). Gen 16S rRNA isolat bakteri tersebut, diamplifikasi menggunakan primer 8F (AGAGTTTGATCCTGGCTCAG) dan 1492R (GGTTACCCT GTTACGACTT) selanjutnya, disekuens dan urutan nukleotida hasil sekuens dianalisis menggunakan program Sequence Scanner dan MEGA 7. Analisis homologi sekuens dilakukan dengan program BLAST nucleotide blast, pada situs NCBI (www.ncbi.nml.nih.gov) dan dilanjutkan dengan konstruksi filogeni molekuler menggunakan metode Neigbor Joining Tree. Isolat bakteri F0-0-3-1 berhasil disolasi dari kultur rotifer yang diberi pakan limbah ikan. Hasil amplifikasi Gen 16S rRNA isolat bakteri F0-0-3-1 terdeteksi dalam bentuk pita DNA pada posisi sekitar 1400 bp. Kualitas nukleotida gen 16S rRNA hasil sekuens menunjukan nilai QV 995 dan CRL 941. Hasil BLAST sekuens gen 16S rRNA isolat bakteri F0-0-3-1 pada database menunjukkan kemiripan 98% dengan spesies Bacillus wiedmanni. Hasil kontruksi filogeni menggunakan metode Neighbor Joining Tree menunjukan posisi isolat bakteri F0-0-3-1 berada pada clade yang sama dengan Bacillus weidmanni, Bacillus cereus dan Bacillus proteolyticus. Kata kunci: Filogeni, molekuler, bakteri, rotifer, Gen 16S rRNA

scholarly journals ISOLASI BAKTERI ENDOFIT SIMBION DARI SPONS Stylissa sp. DAN UJI AKTIVITAS ANTIBAKTERI SERTA IDENTIFIKASI SECARA MOLEKULER MENGGUNAKAN GEN 16S rRNA

PHARMACON ◽  
2021 ◽  
Vol 10 (1) ◽  
pp. 649
Author(s):  
Engjinia Frenny Kandio ◽  
Adithya Yudistira ◽  
John M.R. Runtuwene
Keyword(s):  
Staphylococcus Aureus ◽  
Antibacterial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Bacillus Cereus ◽  
Bioactive Compounds ◽  
Molecular Identification ◽  
Rrna Gene ◽  
Filter Feeder ◽  
The 16S Rrna Gene

ABSTRACTSponges are porous animals that are filter feeders and they become a habitat for microorganisms to nest in their bodies. The result of the symbiosis between sponges and microorganisms, especially in bacteria is the ability of the sponge to produce bioactive compounds. One of the potentials derived from these bioactive compounds is antibacterial. This study aims to isolate and test the antibacterial activity of the endophytic symbiont bacteria Stylissa sp., as well as to carry out molecular identification using the 16S rRNA gene of symbiont bacteria isolates that show the greatest antibacterial power. Three isolates of endophytic symbiont bacteria were successfully obtained through the purification stage. Each isolate was coded E1, E2, and E3. With the average inhibition zone against Escherichia coli bacteria, E1 (7.26 mm) is in the moderate category, E2 (5.42 mm) is in the moderate category and E3 (0.96 mm) is in the weak category. While the antibacterial power against Staphylococcus aureus bacteria, E1 (10.26 mm) in the moderate category, E2 (2.10 mm) in the moderate category, and E3 (0.17 mm) in the weak category. The endophytic bacteria that have the greatest antibacterial power is in isolate E1 which is based on molecular analysis using the 16S rRNA gene identified as Bacillus cereus bacteria. Keywords: Stylissa sp. Sponge, endophytic symbiont bacteria, antibacterial activity,                                          molecular identification, 16S rRNA Gene   ABSTRAKSpons adalah hewan berpori yang bersifat filter feeder sehingga menjadi habitat bagi mikroorganisme untuk bersarang di dalam tubuhnya. Hasil dari simbiosis antara spons dan mikroorganisme dalam hal ini bakteri yaitu kemampuan spons dalam menghasilkan senyawa bioaktif. Salah satu potensi yang berasal dari senyawa bioaktif tersebut adalah antibakteri. Penelitian ini bertujuan untuk mengisolasi dan melakukan pengujian aktivitas antibakteri dari bakteri simbion endofit spons Stylissa sp., serta melakukan identifikasi secara molekuler menggunakan gen 16S rRNA terhadap isolat bakteri simbion yang menunjukkan daya antibakteri terbesar. Sebanyak 3 isolat bakteri simbion endofit berhasil diperoleh melalui tahap purifikasi. Masing-masing isolat diberi kode E1, E2, dan E3. Dengan rata-rata zona hambat terhadap bakteri Escherchia coli yaitu, E1 (7,26 mm) termasuk kategori sedang, E2 (5,42 mm) termasuk kategori sedang, E3 (0,96 mm) dengan kategori lemah. Sedagkan daya antibakteri terhadap bakteri Staphylococcus aureus yaitu, E1 (10,26 mm) dengan kategori sedang, E2 (2,10 mm) termasuk kategori sedang, dan E3 (0,17 mm) pada kategori lemah. Bakteri endofit yang memiliki daya antibakteri terbesar yaitu isolat E1 yang berdasarkan analisis secara molekuler dengan menggunakan gen 16S rRNA teridentifikasi sebagai Bacillus cereus. Kata kunci: Spons Stylissa sp., bakteri simbion endofit, aktivitas antibakteri, identifikasi molekuler, gen 16S  rRNA.

scholarly journals Phyllobacterium loti sp. nov. isolated from nodules of Lotus corniculatus

2014 ◽  
Vol 64 (Pt_3) ◽  
pp. 781-786 ◽  
Author(s):  
Maximo Sánchez ◽  
Martha-Helena Ramírez-Bahena ◽  
Alvaro Peix ◽  
María J. Lorite ◽  
Juan Sanjuán ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Sequence Similarity ◽  
Carbon Sources ◽  
Lotus Corniculatus ◽  
Culture Conditions ◽  
Rrna Gene ◽  
Content Type ◽  
Link Type ◽  
The 16S Rrna Gene

Strain S658T was isolated from a Lotus corniculatus nodule in a soil sample obtained in Uruguay. Phylogenetic analysis of the 16S rRNA gene and atpD gene showed that this strain clustered within the genus Phyllobacterium . The closest related species was, in both cases, Phyllobacterium trifolii PETP02T with 99.8 % sequence similarity in the 16S rRNA gene and 96.1 % in the atpD gene. The 16S rRNA gene contains an insert at the beginning of the sequence that has no similarities with other inserts present in the same gene in described rhizobial species. Ubiquinone Q-10 was the only quinone detected. Strain S658T differed from its closest relatives through its growth in diverse culture conditions and in the assimilation of several carbon sources. It was not able to reproduce nodules in Lotus corniculatus. The results of DNA–DNA hybridization, phenotypic tests and fatty acid analyses confirmed that this strain should be classified as a representative of a novel species of the genus Phyllobacterium , for which the name Phyllobacterium loti sp. nov. is proposed. The type strain is S658T( = LMG 27289T = CECT 8230T).

scholarly journals Diagnosis of Fulminant Pneumonia Caused by Legionella pneumophila Serogroup 8 with the Sequence Analysis of the 16S rRNA Gene

2011 ◽  
Vol 225 (1) ◽  
pp. 65-69 ◽  
Author(s):  
Toshinori Kawanami ◽  
Kazuhiro Yatera ◽  
Kazumasa Fukuda ◽  
Kei Yamasaki ◽  
Masamizu Kunimoto ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Legionella Pneumophila ◽  
Rrna Gene ◽  
The 16S Rrna Gene

scholarly journals The Western Progression of Lyme Disease: Infectious and NonclonalBorrelia burgdorferi Sensu LatoPopulations in Grand Forks County, North Dakota

2014 ◽  
Vol 81 (1) ◽  
pp. 48-58 ◽  
Author(s):  
Brandee L. Stone ◽  
Nathan M. Russart ◽  
Robert A. Gaultney ◽  
Angela M. Floden ◽  
Jefferson A. Vaughan ◽  
...  
Keyword(s):  
Lyme Disease ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
North Dakota ◽  
Intergenic Spacer ◽  
Rrna Gene ◽  
Content Type ◽  
Intergenic Spacer Region ◽  
Grand Forks ◽  
The 16S Rrna Gene

ABSTRACTScant attention has been paid to Lyme disease,Borrelia burgdorferi,Ixodes scapularis, or reservoirs in eastern North Dakota despite the fact that it borders high-risk counties in Minnesota. Recent reports ofB. burgdorferiandI. scapularisin North Dakota, however, prompted a more detailed examination. Spirochetes cultured from the hearts of five rodents trapped in Grand Forks County, ND, were identified asB. burgdorferi sensu latothrough sequence analyses of the 16S rRNA gene, the 16S rRNA gene-ileTintergenic spacer region,flaB,ospA,ospC, andp66. OspC typing revealed the presence of groups A, B, E, F, L, and I. Two rodents were concurrently carrying multiple OspC types. Multilocus sequence typing suggested the eastern North Dakota strains are most closely related to those found in neighboring regions of the upper Midwest and Canada. BALB/c mice were infected withB. burgdorferiisolate M3 (OspC group B) by needle inoculation or tick bite. Tibiotarsal joints and ear pinnae were culture positive, andB. burgdorferiM3 was detected by quantitative PCR (qPCR) in the tibiotarsal joints, hearts, and ear pinnae of infected mice. Uninfected larvalI. scapularisticks were able to acquireB. burgdorferiM3 from infected mice; M3 was maintained inI. scapularisduring the molt from larva to nymph; and further, M3 was transmitted from infectedI. scapularisnymphs to naive mice, as evidenced by cultures and qPCR analyses. These results demonstrate that isolate M3 is capable of disseminated infection by both artificial and natural routes of infection. This study confirms the presence of unique (nonclonal) and infectiousB. burgdorferipopulations in eastern North Dakota.

Sign in / Sign up

Export Citation Format

Share Document