scholarly journals First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia

Plant Disease ◽  
2021 ◽  
Author(s):  
Saritha Raman Kavalappara ◽  
Hayley Milner ◽  
Alton N. Sparks ◽  
Cecilia McGregor ◽  
William M. Wintermantel ◽  
...  
Keyword(s):  
United States ◽  
Coat Protein ◽  
Cucurbita Pepo ◽  
Disease Incidence ◽  
Rna Isolation ◽  
Mixed Infections ◽  
Imperial Valley ◽  
Dnase Treatment ◽  
Southern Georgia ◽  
Cucurbit Chlorotic Yellows Virus

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

scholarly journals First Report of Cucurbit Chlorotic Yellows Virus affecting Watermelon in USA

Plant Disease ◽  
2021 ◽  
Author(s):  
A. Abdul Kader Jailani ◽  
Fanny Iriarte ◽  
Robert Hochmuth ◽  
Sylvia M. Willis ◽  
Mark W. Warren ◽  
...  
Keyword(s):  
Mixed Infection ◽  
Citrullus Lanatus ◽  
Disease Incidence ◽  
Pcr Amplification ◽  
Accession Number ◽  
Rt Pcr ◽  
Imperial Valley ◽  
First Report ◽  
The U.S ◽  
Cucurbit Chlorotic Yellows Virus

Watermelon (Citrullus lanatus) is a high nutrient crop, high in vitamins and very popular in the U.S and globally. The crop was harvested from 101,800 acres with a value of $560 million in the U.S (USDA-NASS, 2020). California, Florida, Georgia and Texas are the four-leading watermelon-producing states in the U.S. During the fall season of 2020, plants in two North Florida watermelon fields, one in Levy County (~20 acres) and one in Suwannee County (~80 acres) with varieties Talca and Troubadour, respectively, exhibited viral-like symptoms. The fields had 100% disease incidence that led to fruit quality issues and yield losses of 80% and above. Symptoms observed in the watermelon samples included leaf crumpling, yellowing and curling, and vein yellowing similar to that of single/and or mixed infection of cucurbit leaf crumple virus (CuLCrV; genus: Begomovirus, family: Geminiviridae), cucurbit yellow stunting disorder virus (CYSDV; genus: Crinivirus, family: Closteroviridae) and squash vein yellowing virus (SqVYV; genus: Ipomovirus, family: Potyviridae), although the vine decline symptoms often associated with SqVYV infection of watermelon were not observed. All three viruses are vectored by whiteflies and previously described in Florida (Akad et al., 2008; Polston et al., 2008; Adkins et al., 2009). To confirm the presence of these viruses, RNA was isolated from 20 symptomatic samples using the RNeasy Plant Mini Kit (Qiagen, USA) as per protocol. This was followed by RT-PCR (NEB, USA) using gene-specific primers described for CuLCrV, CYSDV and SqVYV (Adkins et al., 2009). Amplicons of expected sizes were obtained for all the viruses with the infection of CuLCrV in 17/20, CYSDV in 16/20, and SqVYV in 8/20 samples. In addition, the presence of cucurbit chlorotic yellows virus (CCYV; genus: Crinivirus, family: Closteroviridae) in mixed infection was confirmed in 4/20 samples (3 leaves and 1 fruit) by RT-PCR with primers specific to the CCYV coat protein (CP), heat shock protein 70 homolog (HSP70h) and RNA dependent RNA polymerase (RdRp) designed based on the available CCYV sequences (Sup Table. 1). The RT-PCR amplification was performed using a symptomatic watermelon sample and the amplicons of RdRp, HSP70h and CP were directly sequenced by Sanger method, and the sequences of the amplicons were deposited in GenBank under the accession number: MW527462 (RdRp, 952 bp), MW527461 (HSP70h, 583 bp) and MW527460 (CP, 852 bp). BLASTn analysis demonstrated that the sequences exhibited an identity of 99% to 100% (RdRp and HSP70h, 100%; and CP, 99%) with the corresponding regions of the CCYV isolate Shanghai from China (accession number: KY400636 and KY400633). The presence of CCYV was further confirmed in the watermelon samples by ELISA (Loewe, Germany) using crude sap extracted from the RT-PCR-positive, symptomatic watermelon samples. CCYV was first identified in Kumamoto, Japan in 2004 on melon plants (Gyoutoku et al. 2009). The CCYV was previously reported on melon from Imperial Valley, California (Wintermantel et al., 2019), and more recently on squash in Tifton, Georgia (Kavalappara et al., 2021) and cantaloupe in Cameron, Texas (Hernandez et al., 2021). To our knowledge, this is the first report of CCYV on field watermelon production in the U.S. Continued monitoring of the CCYV in spring and fall watermelon crop, and cucurbit volunteers and weeds will be critical toward understanding the spread of this virus and its potential risk to watermelon in Florida and other regions of the U.S.

scholarly journals A Survey of Genetic Variation in Streptomyces Isolates Causing Potato Common Scab in the United States

2006 ◽  
Vol 96 (12) ◽  
pp. 1363-1371 ◽  
Author(s):  
Leslie A. Wanner
Keyword(s):  
United States ◽  
Genetic Variation ◽  
Common Scab ◽  
Disease Incidence ◽  
The United States ◽  
Rrna Gene ◽  
Population Genetic Study ◽  
Variable Regions ◽  
Genus Streptomyces ◽  
Characteristic Features

Common scab is a serious disease of potatoes and other root and tuber crops, affecting crop quality and market value. The disease is caused by gram positive soil bacteria in the genus Streptomyces. Disease incidence and severity vary in different locations and years; this is due in part to variation in the environment (weather) and genetic variation in potato cultivars. Little information is available on the contribution of genetic variation by the pathogen. To examine genetic diversity in different locations within the United States, streptomycetes were isolated from lesions on field-grown potatoes from six states. Isolates were classified into species based on sequence of variable regions in the 16s rRNA gene. The presence of genes associated with the recently described S. turgidiscabies pathogenicity island (PAI) was also determined. About half of the isolates belonged to S. scabies or S. europaeiscabiei based on 16s rDNA sequence, and had characteristic features of the PAI. They were found in all six states, and were pathogenic on potato and radish. The remaining isolates included pathogens and nonpathogens. They were varied in appearance, and represent several species, including one pathogenic species not previously reported. Some pathogenic isolates lacked one or more genes characteristic of the PAI, although all had genes for biosynthesis of the pathogenicity determinant thaxtomin. In this relatively small survey, regional differences in scab-causing streptomycetes were seen. This report furnishes tools and baseline data for population genetic study of scab-causing streptomycetes in the United States.

scholarly journals Field Evaluations of Leaf Spot Resistance and Yield in Peanut Genotypes in the United States and Bolivia

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 263-268 ◽  
Author(s):  
S. K. Gremillion ◽  
A. K. Culbreath ◽  
D. W. Gorbet ◽  
B. G. Mullinix ◽  
R. N. Pittman ◽  
...  
Keyword(s):  
United States ◽  
Disease Resistance ◽  
Leaf Spot ◽  
Field Experiments ◽  
Disease Incidence ◽  
The United States ◽  
Yield Potential ◽  
Cercospora Arachidicola ◽  
Breeding Lines ◽  
Progress Curve

Field experiments were conducted in 2002 to 2006 to characterize yield potential and disease resistance in the Bolivian landrace peanut (Arachis hypogaea) cv. Bayo Grande, and breeding lines developed from crosses of Bayo Grande and U.S. cv. Florida MDR-98. Diseases of interest included early leaf spot, caused by the fungus Cercospora arachidicola, and late leaf spot, caused by the fungus Cercosporidium personatum. Bayo Grande, MDR-98, and three breeding lines, along with U.S. cvs. C-99R and Georgia Green, were included in split-plot field experiments in six locations across the United States and Bolivia. Whole-plot treatments consisted of two tebuconazole applications and a nontreated control. Genotypes were the subplot treatments. Area under the disease progress curve (AUDPC) for percent defoliation due to leaf spot was lower for Bayo Grande and all breeding lines than for Georgia Green at all U.S. locations across years. AUDPC for disease incidence from one U.S. location indicated similar results. Severity of leaf spot epidemics and relative effects of the genotypes were less consistent in the Bolivian experiments. In Bolivia, there were no indications of greater levels of disease resistance in any of the breeding lines than in Bayo Grande. In the United States, yields of Bayo Grande and the breeding lines were greater than those of the other genotypes in 1 of 2 years. In Bolivia, low disease intensity resulted in the highest yields in Georgia Green, while high disease intensity resulted in comparable yields among the breeding lines, MDR-98, and C-99R. Leaf spot suppression by tebuconazole was greater in Bolivia than in the United States. This result indicates a possible higher level of fungicide resistance in the U.S. population of leaf spot pathogens. Overall, data from this study suggest that Bayo Grande and the breeding lines may be desirable germplasm for U.S. and Bolivian breeding programs or production.

Changing Trends in Age and Sex Distributions of Lyme Disease—United States, 1992-2016

2021 ◽  
pp. 003335492110267
Author(s):  
Kiersten J. Kugeler ◽  
Paul S. Mead ◽  
Amy M. Schwartz ◽  
Alison F. Hinckley
Keyword(s):  
United States ◽  
Lyme Disease ◽  
Disease Incidence ◽  
Age Distribution ◽  
Relative Size ◽  
The United States ◽  
Male Predominance ◽  
Age Related ◽  
Over Time ◽  
Age And Sex

Lyme disease is the most common vector-borne disease in the United States and is characterized by a bimodal age distribution and male predominance. We examined trends in reported cases during a 25-year period to describe changes in the populations most affected by Lyme disease in the United States. We examined demographic characteristics of people with confirmed cases of Lyme disease reported to the Centers for Disease Control and Prevention during 1992-2016 through the National Notifiable Diseases Surveillance System. We grouped cases into 5-year periods (1992-1996, 1997-2001, 2002-2006, 2007-2011, 2012-2016). We calculated the average annual incidence by age and sex and used incidence rate ratios (IRRs) to describe changes in Lyme disease incidence by age and sex over time. We converted patient age at time of illness into patient birth year to ascertain disease patterns according to birth cohorts. The incidence of Lyme disease in the United States doubled from 1992-1996 to 2012-2016 (IRR = 1.74; 95% CI, 1.70-1.78) and increased disproportionately among males; IRRs were 39%-89% higher among males than among females for most age groups. During the study period, children aged 5-9 years were most frequently and consistently affected. In contrast, the average age of adults with Lyme disease increased over time; of all adults, people born during 1950-1964 were the most affected by Lyme disease. Our findings suggest that age-related behaviors and susceptibilities may drive infections among children, and the shifting peak among adults likely reflects a probability proportional to the relative size of the baby boom population. These findings can inform targeted and efficient public health education and intervention efforts.

Prevalence and Molecular Characterization Coat Protein Gene of Tobacco streak virus Causing Peanut Stem Necrosis Disease in Coastal and Rayalaseema Districts of Andhra Pradesh, South-India

2021 ◽  
Author(s):  
K. Saratbabu ◽  
K. Vemana ◽  
A.K. Patibanda ◽  
B. Sreekanth ◽  
V. Srinivasa Rao
Keyword(s):  
Coat Protein ◽  
Molecular Characterization ◽  
Andhra Pradesh ◽  
Disease Incidence ◽  
Tobacco Streak Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Streak Virus ◽  
Rt Pcr ◽  
Cp Gene ◽  
Stem Necrosis

Background: Peanut stem necrosis disease (PSND) caused by Tobacco streak virus (TSV) is a major constraint for groundnut production in Andhra Pradesh (A.P.). However, studies on prevalence and spread of the disease confined to only few districts of A.P. with this background current study focused on incidence and spread of the disease in entire state of A.P. Further an isolate of TSV occurring in A.P. characterized on the basis of genetic features by comparing with other TSV isolates originated from different hosts and locations from world.Methods: Roving survey was conducted during kharif 2017-18 in groundnut growing districts of Andhra Pradesh (A.P.) for peanut stem necrosis disease incidence. Groundnut plants showing PSND symptoms were collected and tested with direct antigen coating enzyme linked immunosorbent assay (DAC-ELISA). Groundnut samples found positive by ELISA once again tested by reverse transcription polymerase chain reaction (RT-PCR). The representative TSV-GN-INDVP groundnut isolate from Prakasham district was maintained on cowpea seedlings by standard sap inoculation method in glasshouse for further molecular characterization. The Phylogenetic tree for coat protein (CP) gene was constructed using aligned sequences with 1000 bootstrap replicates following neighbor-joining phylogeny.Result: Thirty-eight (52.7%) of seventy-two groundnut samples collected from different locations in A.P were given positive reaction to TSV by DAC-ELISA. For the first time, PSND incidence observed in coastal districts (Krishna, Guntur, Sri Pottisriramulu Nellore, Prakasham) of A.P. Maximum PSND incidence recorded from Bathalapalli (22.2%) and the minimum incidence in Mulakalacheruvu (4.1%). The coat protein (CP) gene of TSV-GN-INDVP groundnut isolate was amplified by RT-PCR and it shared maximum per cent nucleotide identity (97.51-98.62%) with TSV isolates from groundnut and other different crops reported in India. All Indian isolates cluster together irrespective of crop and location based on the phylogenetic analysis.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

scholarly journals First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in California

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
S. N. Wegulo ◽  
S. T. Koike ◽  
M. Vilchez ◽  
P. Santos
Keyword(s):  
United States ◽  
Downy Mildew ◽  
Disease Incidence ◽  
Leaf Tissue ◽  
The United States ◽  
Plant Diseases ◽  
Single Type ◽  
First Report ◽  
Commercial Grower ◽  
Impatiens Walleriana

During February 2004, diseased double impatiens (Impatiens walleriana) plants were received from a commercial grower in southern California. The upper surfaces of symptomatic leaves were pale yellow with no distinct lesions. Diseased leaves later wilted, and severely affected leaves abscised from the stem. At the nursery, only double impatiens plants in the Fiesta series were infected, and some cultivars were more heavily infected than others. Disease incidence in cv. Sparkler Hot pink was nearly 100%. The interior of infected leaves was colonized by coenocytic mycelium. A conspicuous white growth was observed only on the underside of leaves. Sporangiophores were hyaline, thin walled, emergent from stomata, and had slightly swollen bases. Sporangiophore branching was distinctly monopodial. Smaller sporangiophore branches were arranged at right angles to the supporting branches, and tips of branches measured 8 to 14 μm long. Sporangia were ovoid and hyaline with a single pore on the distal ends. Distal ends of sporangia were predominantly flat but occasionally had a slight papilla. Short pedicels were present on the attached ends. Sporangia measured 19.4 to 22.2 (-25.0) μm × 13.9 to 16.7 (-19.4) μm. Oospores were not observed in leaf tissue. On the basis of symptoms and morphology of the organism, the pathogen was identified as Plasmopara obducens J. Schröt. Pathogenicity tests were done on double type cvs. Fiesta, Tioga Red, and Tioga Cherry Red and on single type cvs. Cajun Watermelon and Accent Lilac. Plants were spray inoculated with sporangiospore suspensions (1 × 104 sporangiospores per milliliter), incubated for 24 h in a dew chamber (18 to 20°C), and then maintained in a greenhouse (22 to 24°C). Symptoms and signs of downy mildew developed after 12 days only on inoculated cv. Fiesta plants, and the pathogen morphology matched that of the originally observed pathogen. Nontreated control plants did not develop downy mildew. To our knowledge, this is the first report of downy mildew on impatiens in California. P. obducens is one of two causal agents of downy mildew of impatiens (2,4). The other pathogen, Bremiella sphaerosperma, has dichotomous sporangiophore branching and causes lesions with well-defined margins (2,4). In the United States, the disease has been recorded in the eastern and northeastern states and in Indiana, Minnesota, Mississippi, Montana, and Wisconsin (3). In Canada, the disease has been recorded in Manitoba and Quebec (1). References: (1) I. L. Conners. An Annotated Index of Plant Diseases in Canada and Fungi Recorded on Plants in Alaska, Canada, and Greenland. Research Branch, Canada Department of Agriculture, Publication 1251, 1967. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, 1989. (4) G. W. Wilson. Bull. Torrey Bot. Club 34:387, 1907.

scholarly journals Disease Prevalence, Disease Incidence, and Mortality in the United States and in England

Demography ◽  
2010 ◽  
Vol 47 (S) ◽  
pp. S211-S231 ◽  
Author(s):  
James Banks ◽  
Alastair Muriel ◽  
James P. Smith
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Disease Prevalence ◽  
Incidence And Mortality

Survey for Yellow Mosaic Disease Occurring on Blackgram [Vigna mungo (L.) Hepper] and Weed Hosts in Four Major Blackgram Growing Districts of Andhra Pradesh and Characterization of Associated Viruses using Coat Protein Gene

2021 ◽  
Author(s):  
Vallabhaneni Tilak Chowdary ◽  
V. Manoj Kumar ◽  
P. Kishore Varma ◽  
B. Sreekanth ◽  
V. Srinivasa Rao
Keyword(s):  
Coat Protein ◽  
Andhra Pradesh ◽  
Disease Incidence ◽  
Pcr Amplification ◽  
Mosaic Disease ◽  
Yellow Mosaic Virus ◽  
Ageratum Conyzoides ◽  
Yellow Mosaic Disease ◽  
Weed Plants ◽  
Weed Hosts

Background: Yellow mosaic disease (YMD) caused by Yellow mosaic virus is one of the major constraints in the pulse production in Andhra Pradesh (A.P.) due to fast evolution of strains, like Mungbean yellow mosaic India virus (MYMIV). Keeping this in view, a survey was undertaken in the major blackgram growing districts of A.P. to know the YMD incidence in blackgram and weed hosts and were characterized based on genetic features by comparing with other YMV isolates from different hosts and locations across the world. Methods: Roving survey was conducted during rabi 2019-20 in major blackgram growing districts of A.P. viz., Krishna, Guntur, West Godavari and Prakasam districts for YMD incidence. Blackgram plants showing characteristic symptoms were collected as representative samples from each mandal along with the suspected weed plants and were subjected to amplification using coat protein (CP) specific primers followed by molecular characterization. Phylogenetic tree for coat protein (CP) gene was constructed using aligned sequences with 1000 bootstrap replicates following neighbor-joining phylogeny. Result: Out of the four districts surveyed, the highest disease incidence was recorded at Machavaram village of Prakasam district (43.22%), whereas least disease incidence was recorded at Chinaganjam village of Praksam district (2.4%). Six weeds viz., Ageratum conyzoides, Amaranthus viridis, Parthenium hysterophporus, Vigna trilobata, Abelmoscus moschatus, Desmodium laxiflorum have showed positive result in PCR amplification with MYMIV specific coat protein primers. Four isolates from blackgram samples and two from weed plants shared 94.85 to 99.58% nucleotide identity among themselves.

Sign in / Sign up

Export Citation Format

Share Document