Molecular Epidemiology of Hepatitis B Virus (HBV) Genotypes Prevalent in KP

Hepatitis B virus (HBV) infection is a major public health dilemma affecting about 2 billion of world population and more than 350 million people are chronic HBV carriers including Pakistan with an estimated prevalence rate of 3%. HBV can be categorized into 10 genotypes (A-H) clarified by more than 8% of sequence divergence based on the whole genome. Although Pakistan is highly endemic to HBV no large scale study of HBV genotypes based on sequence analysis has been reported yet so the ongoing research study was aimed to explore the existing patterns of HBV genotypes based on sequencing method and phylogenetic analysis of HBV S gene distributed in Khyber Pakhtukhwa (KP)which isone of the third most populated province of Pakistan. A total of 3000 chronically HBV positive samples were collected from 7 most populous districts of KP and were analyzed by ICT followed by qualitative PCR for confirmation. Type-specific PCR or restriction fragment length polymorphism (RFLP) and random sequencing of the partial Sgene were carried out for HBV genotypes characterization. We obtained a 100 of, S gene nucleotide sequences out of which 28 nucleotide sequences demonstrating the whole diversity of the sequenced types were further used for phylogenetic study using Mega 6 software. Active infection of HBV was confirmed in all patients through qualitative PCR and three genotypes A, C, and D were confirmed by type specific PCR and RFLP. The most prevalent genotype detected was genotype D 68.3% followed by genotype A 22.6% and genotype C 8.53%. Phylogenetic analysis of the obtained sequences based on HBV S gene revealed that some of our HBV sequences clustered with some local isolates showing close homology with them while other clustered together with some foreign isolates with a high bootstrap value. However, one isolate didn’t match or show any similarity with any of HBV strain available in online repositories that point towards a great divergence and a distinctive origin of the strain.

ADAMTS9-AS2 and CADM2 expression and association with the prognosis in esophageal squamous cell carcinoma

Background: We investigated whether ADAMTS9-AS2 and CADM2 were related to esophageal squamous cell carcinoma (ESCC). Methodology: ESCC microarray datasets and reverse transcriptase qualitative PCR were used to analyze ADAMTS9-AS2 and CADM2 expression. Results: The GSE120356 and GSE33810 datasets identified ADAMTS9-AS2 and CADM2 as the candidates and ADAMTS9-AS2 and CADM2 expression was downregulated in ESCC. ADAMTS9-AS2 and CADM2 were positively correlated with ESCC. ADAMTS9-AS2 and CADM2 expression could discriminate ESCC from normal tissue. Five-year overall survival was shorter in underexpressed ADAMTS9-AS2 patients, and CADM2 expression level was related to 5-year overall survival. ADAMTS9-AS2 and CADM2 expression were independent prognosis indicators in ESCC patients. Conclusion: Our findings shed new light on the clinical significance of ADAMTS9-AS2 and CADM2 in ESCC carcinogenesis.

Evaluation and Significance of CD25 Expression in Hematopoietic Stem/Progenitor Cell Fraction of Bone Marrow Cells in Chronic Myelogenous Leukemia Patients

Introduction: Tyrosine kinase inhibitors (TKIs) have dramatically improved the prognosis of chronic myelogenous leukemia (CML). The treatment with TKIs maintain the depth of response; however, the life-long use of TKI has also been associated with late complications such as cardiovascular events and huge financial burden impairing their quality of life. To overcome these issues, investigators have been attempting to discontinue TKIs after durable molecular remission. However, the optimal timing to stop TKIs remains to be elucidated. We previously demonstrated that CD25 was highly expressed in murine and human CML-leukemia initiating cells (LICs) (Kobayashi CI et al., Blood, 2014). In this study we tried to clarify whether the proportion of CD25-positive cells in hematopoietic stem/progenitor cell fraction of bone marrow cells in CML patients treated with TKIs is associated with their molecular response and could serve as a novel surrogate marker to select patients who are likely to obtain durable treatment-free remission after stopping TKIs. Methods: Bone marrow samples were obtained from the patients with CML in chronic phase who were treated solely with TKIs at Keio University Hospital (Tokyo, Japan). This study was approved by the institutional ethical committee and informed consent was obtained from each patient. Both quantitative and qualitative PCR of BCR-ABL1 was performed using bone marrow mononuclear cells (BMMNCs). The proportion of CD25-positive cells in bone marrow hematopoietic stem/progenitor cell (HSPC; CD34+CD38-) fraction (%CD25+) was evaluated by flow cytometry. The response to TKIs at the time of analysis was determined according to as follows: complete cytogenetic remission (CCyR) defined as Philadelphia chromosome undetectable and quantitative PCR copy numbers >731 among BMMNCs; major molecular remission (MMR) as quantitative PCR copy numbers ≤731, and complete molecular remission (CMR) as undetectable BCR-ABL1 by quantitative and qualitative PCR. Results: Bone marrow samples obtained from 109 patients were evaluated (median age, 52 years; male/female, 76/33). Analysis was performed prior to TKI exposure in 26 patients and under TKI therapy in 64 patients (imatinib, 22; dasatinib, 33; nilotinib, 9). Remaining 19 patients were treatment free because they were enrolled into a clinical trial of TKI discontinuation. At diagnosis (n=26), %CD25+ were significantly correlated with hemoglobin level and platelet count (Table). The %CD25+ was significantly lower in patients with post TKI exposure than those at diagnosis without TKIs (p<0.00001). In nine patients with available samples before and after TKI therapy, the %CD25+ at diagnosis was significantly higher than after TKI therapy (Mean 34.7%, SD 24.8% vs. Mean 4.96%, SD 4.17%, p<0.01, Fig.a). In addition, %CD25+ was significantly correlated with copy number of BCR/ABL1 (P<0.001, Fig.b). Conclusion: We confirmed that the expression of CD25 in HSPC fraction of CML patients was significantly correlated with the disease status, and may be useful as a LIC minimal residual disease marker. Disclosures Kasahara: Chugai: Research Funding. Sakurai:Bristol-Myers Squibb K.K.: Speakers Bureau. Kikuchi:Celgene: Speakers Bureau; Takeda: Speakers Bureau; Ono: Speakers Bureau. Shimizu:Bristol-Myers Squibb K.K: Honoraria. Mori:Astella Pharma: Honoraria; Kyowa Hakko Kirin: Honoraria; Novartis Pharma: Research Funding; MSD: Research Funding; MSD: Honoraria; Janssen: Honoraria; SHIONOGI: Honoraria; Taisho Toyama Pharmaceutical Co: Honoraria; Celgene: Honoraria; Ono: Honoraria; Eisai: Honoraria; Novartis Pharma: Honoraria; Shire Japan: Honoraria; CHUGAI: Honoraria; Asahi Kasei: Research Funding; Japan Blood Products Organization: Honoraria; Pfizer: Honoraria. Okamoto:Pfizer Inc.: Honoraria, Research Funding; Chugai Pharmaceutical Co., Ltd.: Research Funding; Eisai Co.,Ltd.: Research Funding; Kyowa Hakko Kirin Co.: Research Funding; Bristol-Myers Squibb K.K.: Honoraria, Research Funding; Teijin Pharma Limited: Research Funding; Otsuka Pharmaceutical Co., Ltd.: Honoraria, Research Funding; Toyama Chemical Co., Ltd.: Research Funding; Alexion Pharmaceuticals, Inc.:: Research Funding; Nippon Shinyaku Co., Ltd: Research Funding; Shionogi & Co., Ltd.: Research Funding; Astellas Pharma Inc.: Research Funding; Asahi Kasei Pharma Corp.:: Research Funding; Sumitomo Dainippon Pharma Co., Ltd.: Research Funding; JCR Pharmaceuticals Co., Ltd.: Research Funding.

Active Cytomegalovirus Infection in Critically Ill Immunocompeten Patients Admitted in the ICU. A Molecular Diagnosis Approach

Background: Active Cytomegalovirus (CMV) infection has long been related to immunocompromised conditions such as malignancy, HIV-AIDS, longterm use of corticosteroids and organ transplantation. Nowadays, several studies showed that active CMV infection also frequently found in formerly immunocompetent patients during critically ill condition. Alteration of immune system in critically ill condition might become the most possible reason enderlying this adverse event.Aim: To document the prevalence of active CMV infection in critically ill immunocompetent patient admitted to ICU and to find out the difference of the disease severity between group of patients with and without active CMV infection.Method: This was a cross sectional study. Study conducted from April 1st - June 30th 2013. Subjects were patient aged ≥14 years, hospitalized in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients who had history of malignancy, HIV-AIDS, use of corticosteroids and organ transplatation were excluded from the study. Disease severity was calculated using APACHE II score in the first 24 hours of ICU admission. EDTA sample for qualitative PCR examination (procedure as described elsewhere) collected after 4 days of ICU admission. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Datas were analyzed using bivariate analysis.Result: Active CMV infection was detected in 16 out of 50 subjects. Mean score of disease severity in all subjects (based on APACHE II scoring system) was 11.8±6.43. Mean score of disease severity in group with active CMV infection was higher than group without active CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510).Conclusion: The prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in the ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Degree of disease severity might influence the occurance of CMV infection. Qualitative PCR testing was an aqurate tool for diagnosing active CMV infection.

Application of InDel markers based on the chloroplast genome sequences for authentication and traceability of tartary and common buckwheat

A reliable, qualitative PCR-based detection method for the traceability and authentication of common and Tartary buckwheat was developed. Five InDel markers developed from chloroplast genome variation between the two species were applied for 96 buckwheat accessions and all accessions were easily differentiated as Tartary and common buckwheat using these markers. We also determined the sample detection limit by PCR and qPCR as 0.001 and 0.02 ng/µl, respectively. InDel markers could detect the mixture of two species flour up to 10% contamination. InDel markers were also applied to processed foods such as noodles and tea, and we found that species-specific PCR bands could be used to identify buckwheat even after processing. Hence, these InDel markers are simple with higher specificity and sensitivity and are reliable for the authentication of buckwheat processed foods.