Hypsugo stubbei sp. nov., a novel cryptic bat species of the genus Hypsugo (Vespertilionidae, Chiroptera, Mammalia) from Mongolia. Results of the Mongolian-German Biological Expeditions Since 1962, No. 347.

The occurrence of two members of the genus Hypsugo, namely H. alaschanicus and H. savii caucasicus, have been reported for Mongolia in the literature. Due to various taxonomic reassignments within and between genera, the number of records for the genus Hypsugo in Mongolia is quite scarce and sometimes not resolved at species or subspecies level. Despite recognition of the two above-mentioned species, recent reports based on genetic analyses describe only new and further records of H. alaschanicus. Thus, it exists a large uncertainty regarding the occurrence and distribution of H. savii caucasicus in Mongolia. Here, our efforts in gaining a deeper understanding towards the occurrence and distribution of Hypsugo species in Mongolia are described. A combination of genetic and morphological analyses of collected material from Hypsugo specimens revealed the existence of a genetically largely distant Hypsugo clade. Therefore, a new and cryptic Hypsugo species is proposed which is named after Prof. Dr. Michael Stubbe for his continuous, long-standing and significant contributions into the biological exploration of Mongolia. Hypsugo stubbei sp. nov. differs by at least 8.4 % and 9 % to the closest Western Palearctic distributed H. cf. darwinii and H. savii as well as at least 11.3 % to the Easter Palearctic (including Mongolia) distributed H. alaschanicus based on the first 798 nucleotides of the gene encoding the mitochondrial ND1 (subunit one of NADH dehydrogenase). Neither a close proximity species based on the gene encoding the mitochondrial COI (cytochrome oxidase subunit one) could be found in publicly accessible nucleotide databases. While the cryptic H. stubbei sp. nov. reveals no obvious cranial and morphological differences, few external characteristics are dissimilar to both H. alaschanicus and H. savii (caucasicus). Currently, Hypsugo stubbei sp. nov. was found at four different locations in Mongolia. Among the 11 specimens captured, six facilitated a genetic assignment. Based on the current scarce data records, the species seems to occur mainly in the far west of Mongolia inhabiting semi-deserts and steppes up to high mountain areas. An overlapping distribution with H. alaschanicus cannot be excluded based on the limited data currently available.

Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

Morphological and Genetic Diversity of Two Forms of Muksun Coregonus muksun (Salmonidae) of the Khatanga River Basin as a Key for Understanding the Phylogenetic Relationships between Muksun and Whitefish C. lavaretus

Morphological analysis of muksun Coregonus muksun of the Khatanga River basin revealed that along with its typical high-density-rakered form, individuals of the low-density-rakered form also live in this region. Analysis of the genetic polymorphism of three marker regions of mitochondrial (ND1 and COI fragments) and nuclear (ITS1) DNA indicates the polyphyletic origin of these forms. The revealed low level of genetic differentiation of muksun and whitefish C. lavaretus, along with the available data on the absence of clear diagnostic species characteristics, suggest that they belong to the same biological species C. lavaretus.

A new species of the genus Larutia (Squamata: Scincidae) from Gunung Penrissen, Sarawak, Borneo

We collected a specimen of a scincid lizard of Larutia Böhme, 1981 from the edge of a primary forest on Gunung Penrissen, Kuching Division, Sarawak, Malaysian Borneo. The single specimen of the new species differs from all other known congeners by the molecular divergence in the mitochondrial ND1 gene and morphological characters including small adult body size (SVL 84 mm); 22 longitudinal scale rows around midbody; first pair of chinshields contacting second infralabial; second pair of chinshields separated from infralabials by an elongated scale; two subdigital lamellae on second toe; and body without yellow or pale bands or spots. It is the ninth species described in the genus and the second species of Larutia in Borneo.

Contribution of mitochondrial ND1 3394T>C mutation to the phenotypic manifestation of Leber’s hereditary optic neuropathy

Mitochondrial DNA (mtDNA) mutations have been associated with Leber’s hereditary optic neuropathy (LHON) and their pathophysiology remains poorly understood. In this study, we investigated the pathophysiology of a LHON susceptibility allele (m.3394T>C, p.30Y>H) in the Mitochondrial (MT)-ND1 gene. The incidence of m.3394T>C mutation was 2.7% in the cohort of 1741 probands with LHON. Extremely low penetrances of LHON were observed in 26 pedigrees carrying only m.3394T>C mutation, while 21 families bearing m.3394T>C, together with m.11778G>A or m.14484T>C mutation, exhibited higher penetrance of LHON than those in families carrying single mtDNA mutation(s). The m.3394T>C mutation disrupted the specific electrostatic interactions between Y30 of p.MT-ND1 with the sidechain of E4 and backbone carbonyl group of M1 of NDUFA1 (NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1) of complex I, thereby altering the structure and function of complex I. We demonstrated that these cybrids bearing only m.3394T>C mutation caused mild mitochondrial dysfunctions and those harboring both m.3394T>C and m.11778G>A mutations exhibited greater mitochondrial dysfunctions than cybrids carrying only m.11778G>A mutation. In particular, the m.3394T>C mutation altered the stability of p.MT-ND1 and complex I assembly. Furthermore, the m.3394T>C mutation decreased the activities of mitochondrial complexes I, diminished mitochondrial ATP levels and membrane potential and increased the production of reactive oxygen species in the cybrids. These m.3394T>C mutation-induced alterations aggravated mitochondrial dysfunctions associated with the m.11778G>A mutation. These resultant biochemical defects contributed to higher penetrance of LHON in these families carrying both mtDNA mutations. Our findings provide new insights into the pathophysiology of LHON arising from the synergy between mitochondrial ND1 and ND4 mutations.

Unrealized diversity in an urban rainforest: A new species of Lygosoma (Squamata: Scincidae) from western Sarawak, Malaysia (Borneo)

We collected two specimens of an undescribed species of Lygosoma from pitfall traps in an urban rainforest in Kuching and from the base of a forested hill in western Sarawak, East Malaysia. The new species is diagnosable from all south-east Asian congeners by morphological characters, and most closely resembles Lygosoma herberti from the Thai-Malay Peninsula. The new species shows substantial molecular divergence from its closest relatives in two protein-coding genes, one mitochondrial (ND1) and one nuclear (R35) that we sequenced for several south-east Asian congeners. We describe the new species on the basis of this distinct morphology and genetic divergence. It is the third species of Lygosoma known from Borneo, and highlights the continuing rise in lizard species diversity on the island. In addition, the discovery of this species from a small urban rainforest underscores the importance of preserving intact rainforest areas of any size in maintaining species diversity.