Intron–hairpin RNA Derived from Replication Associated Protein C1 Gene Confers Immunity to Tomato Yellow Leaf Curl Virus Infection in Transgenic Tomato Plants

2006 ◽  
Vol 15 (3) ◽  
pp. 291-304 ◽  
Author(s):  
Alejandro Fuentes ◽  
Pedro L. Ramos ◽  
Elvira Fiallo ◽  
Danay Callard ◽  
Yadira Sánchez ◽  
...  
Keyword(s):  
Virus Infection ◽  
Tomato Yellow Leaf ◽  
Transgenic Tomato ◽  
Yellow Leaf ◽  
Hairpin Rna ◽  
Tomato Plants ◽  
Transgenic Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Transgenic Tomato Plants Expressing the Tomato Yellow Leaf Curl Virus Capsid Protein are Resistant to the Virus

1994 ◽  
Vol 12 (5) ◽  
pp. 500-504 ◽  
Author(s):  
Talya Kunik ◽  
Raffi Salomon ◽  
Daniel Zamir ◽  
Nir Navot ◽  
Muhammad Zeidan ◽  
...  
Keyword(s):  
Capsid Protein ◽  
Tomato Yellow Leaf ◽  
Transgenic Tomato ◽  
Yellow Leaf ◽  
Virus Capsid ◽  
Tomato Plants ◽  
Transgenic Tomato Plants ◽  
Leaf Curl Virus ◽  
Virus Capsid Protein ◽  
Leaf Curl

scholarly journals The tomato yellow leaf curl virus C4 protein alters the expression of plant developmental genes correlating to leaf upward cupping phenotype in tomato

2021 ◽  
Author(s):  
Chellappan Padmanabhan ◽  
Yi Zheng ◽  
Md Shamimuzzaman ◽  
Jennifer R. Wilson ◽  
Zhangjun Fei ◽  
...  
Keyword(s):  
Transcriptome Analysis ◽  
Tomato Yellow Leaf ◽  
Transgenic Tomato ◽  
Disease Symptom ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Transgenic Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

AbstractTomato yellow leaf curl virus (TYLCV), a monopartite begomovirus in the family Geminiviridae, is efficiently transmitted by the whitefly, Bemisia tabaci, and causes serious economic losses to tomato crops around the world. TYLCV-infected tomato plants develop distinctive symptoms of yellowing and leaf upper cupping. In recent years, excellent progress has been made in the characterization of TYLCV C4 protein function as a pathogenetic determinant in experimental plants, including Nicotiana benthamiana and Arabidopsis thaliana. However, molecular mechanism leading to disease symptom development in natural host plant tomato has yet to be characterized. The aim of the current study was to generate transgenic tomato plants expressing the TYLCV C4 gene and evaluate differential gene expression through comparative transcriptome analysis between the transgenic C4 plants and the transgenic green fluorescent protein (Gfp) gene control plants. Transgenic tomato plants expressing the TYLCV C4 developed phenotypes, including leaf upward cupping and yellowing that are similar the disease symptom expressed on tomato plants infected with TYLCV. In a total of 241 differentially expressed genes identified in the transcriptome analysis, a series of plant development-related genes, including transcription factors, glutaredoxins, protein kinases, R-genes and microRNA target genes, were significantly altered. These results provide further evidence to support the important function of the C4 protein in begomovirus pathogenicity. These transgenic tomato plants could serve as basic genetic materials for further characterization of plant receptors that are interacting with the TYLCV C4.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Immunity to tomato yellow leaf curl virus in transgenic tomato is associated with accumulation of transgene small RNA

2015 ◽  
Vol 160 (11) ◽  
pp. 2727-2739 ◽  
Author(s):  
Diana Leibman ◽  
Shanmugam Prakash ◽  
Dalia Wolf ◽  
Aaron Zelcer ◽  
Ghandi Anfoka ◽  
...  
Keyword(s):  
Small Rna ◽  
Tomato Yellow Leaf ◽  
Transgenic Tomato ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Effect of Tomato Yellow Leaf Curl Virus Infection on Some Growth Indicators of Pepper Hybrids Grown Under Plastic House Conditions in Lattakia Governorate, Syria

2021 ◽  
Vol 39 (4) ◽  
pp. 309-316
Author(s):  
Reem Hamdan ◽  
◽  
Imad Ismail ◽  
Insaf Akel ◽  
◽  
...  
Keyword(s):  
Virus Infection ◽  
Surface Area ◽  
Leaf Surface ◽  
Growth Parameters ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Leaf Surface Area ◽  
Leaf Curl Virus ◽  
Growth Indicators ◽  
Leaf Curl

Hamdan, R.S., I.D. Ismail and I. Akel. 2021. Effect of Tomato Yellow Leaf Curl Virus Infection on Some Growth Indicators of Pepper Hybrids Grown Under Plastic House Conditions in Lattakia Governorate, Syria. Arab Journal of Plant Protection, 39(4): 309-316. https://doi.org/10.22268/AJPP-39.4.309316 This study aimed to evaluate the effect of Tomato yellow leaf curl virus (TYLCV) infection on some growth parameters of several pepper hybrids grown under protected cultivation along the Syrian coast. Four pepper hybrids (Capsicum annum) were tested, two hot (Lahab, Sirad) and two sweet (Nevada, Dallas) peppers. The research was carried out during the 2020-2021 growing season in a plastic house at the Agriculture Scientific Research Center in Lattakia, using a randomized complete block design, with 8 treatments, three replicates and 5 plants per replicate. The results obtained showed that the sweet pepper hybrids (Nevada, Dallas) were more sensitive to infection with Tomato yellow leaf curl virus than the hot pepper hybrids (Lahab, Sirad), without significant differences among them. The pepper hybrid Nevada did not show any apparent symptoms, and the effect of the virus on some growth parameters (number flowers, flower setting, and the leaf surface area) was evident in comparison with other hybrids, but the differences were not significant. The Dallas, Sirad and Lahab pepper hybrids showed visible symptoms in response to infection with infection rate of 93.33%, 80% and 80%, respectively. The effect of virus infection on the growth parameters of these hybrids was variable. The reduction in the flowers number of Nevada, Dallas, Cirad and Lahab after 45 days of infection was 33%, 31.10%, 10.23% and 5.07%, respectively, and also with a reduction in the number of flowers setting of 77.39%, 20.87%, 23.33% and 66.68%, respectively. The same was true for the leaf surface area, where reduction rate for the Nevada, Dallas, Sirad and Lahab hybrids 30 days after infection was 48.17%, 53.06%, 16.45% and 36.6%, respectively. Keywords: Tomato yellow leaf curl virus, pepper hybrids, growth parameter, host resistance, protected agriculture.

Sign in / Sign up

Export Citation Format

Share Document