Association Analysis of Heat Shock Protein 70 Gene Polymorphisms in Schizophrenia

2009 ◽  
Vol 24 (S1) ◽  
pp. 1-1
Author(s):  
C.-U. Pae
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein 70 ◽  
Odds Ratio ◽  
Gene Polymorphisms ◽  
P Value ◽  
Hsp70 Gene ◽  
Sliding Windows ◽  
Haplotypic Association ◽  
Shock Proteins ◽  
Pyrosequencing Method

Objectives:This study investigated the association between an enlarged set of SNPs at Heat shock proteins (HSPs) 70 gene and schizophrenia.Methods:Two hundred and ninety four patients with schizophrenia and 287 controls were enrolled in the study. Genotypings of 5 SNPs of HSP70 were performed using pyrosequencing method.Results:Significant association was detected at rs2075799 (allele A, Chi suare =8.03, d.f.=1 p=0.0046), but not at rs2227956 (p=0.28), rs1043618 (p=0.88), rs562047 (p=0.47) or rs539689 (p=0.32). in fact, the rs2075799*G/A genotype was more represented in patients with schizophrenia than in controls (Chi-sq=8.23, d.f.=1, p=0.0041). Haplotype based associations were also detected (global p value 0.000003); the T-A-C-C-G haplotype was more prevalent among the patients (odds ratio, OR 5.95). Sliding windows analysis revealed a major contribution from rs2227956 and rs2075799 (global-p value 0.0075), with T-A haplotype significantly associated with schizophrenia. There was no evidence of an association between the clinical variables and schizophrenia across the genotypes.Conclusion:Our results raise the possibility that HSP70 gene (i.e., haplotypes of rs2075799) might be implicated in the development of schizophrenia, although limited by rare haplotypic association with the disease. Hence further studies from different ethnics should be performed to confirm these results.

Heat-shock protein 70-1 and HLA class II gene polymorphisms associated with celiac disease susceptibility in Navarra (Spain)

2001 ◽  
Vol 62 (8) ◽  
pp. 821-825 ◽  
Author(s):  
Marı́a A Ramos-Arroyo ◽  
Esperanza Feijoó ◽  
Félix Sánchez-Valverde ◽  
Erkuden Aranburu ◽  
Nieves Irisarri ◽  
...  
Keyword(s):  
Celiac Disease ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Gene Polymorphisms ◽  
Disease Susceptibility ◽  
Class Ii ◽  
Hla Class Ii

scholarly journals Expression of heat shock protein 70 is insufficient to extend Drosophila melanogaster longevity

2019 ◽  
Author(s):  
Chengfeng Xiao ◽  
Danna Hull ◽  
Shuang Qiu ◽  
Joanna Yeung ◽  
Jie Zheng ◽  
...  
Keyword(s):  
Heat Treatment ◽  
Drosophila Melanogaster ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Stress Resistance ◽  
Heat Shock Protein 70 ◽  
Biological Effect ◽  
Hsp70 Expression ◽  
Gene Encoding ◽  
Shock Proteins

AbstractIt has been known for over 20 years that Drosophila melanogaster flies with twelve additional copies of the hsp70 gene encoding the 70 kDa heat shock protein lives longer after a non-lethal heat treatment. Since the heat treatment also induces the expression of additional heat shock proteins, the biological effect can be due either to HSP70 acting alone or in combination. This study used the UAS/GAL4 system to determine whether hsp70 is sufficient to affect the longevity and the resistance to thermal, oxidative or desiccation stresses of the whole organism. We observed that HSP70 expression in the nervous system or muscles has no effect on longevity or stress resistance but ubiquitous expression reduces the life span of males. We also observed that the down-regulation of Hsp70 using RNAi did not affect longevity.

The gene for the heat-shock protein 70 of Euplotes focardii, an Antarctic psychrophilic ciliate

2004 ◽  
Vol 16 (1) ◽  
pp. 23-28 ◽  
Author(s):  
ANTONIETTA LA TERZA ◽  
CRISTINA MICELI ◽  
PIERANGELO LUPORINI
Keyword(s):  
Thermal Stress ◽  
Heat Shock ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Regulatory Region ◽  
Regulatory Elements ◽  
Specific Response ◽  
Hsp70 Gene ◽  
Sequence Motifs ◽  
Coding Region

In the Antarctic ciliate, Euplotes focardii, the heat-shock protein 70 (Hsp70) gene does not show any appreciable activation by a thermal stress. Yet, it is activated to appreciable transcriptional levels by oxidative and chemical stresses, thus implying that it evolved a mechanism of selective, stress-specific response. A basic step in investigating this mechanism is the determination of the complete nucleotide sequence of the E. focardii Hsp70 gene. This gene contains a coding region specific for an Hsp70 protein that carries unique amino acid substitutions of potential significance for cold adaptation, and a 5' regulatory region that includes sequence motifs denoting two distinct types of stress-inducible promoters, known as “Heat Shock Elements” (HSE) and “Stress Response Elements” (StRE). From the study of the interactions of these regulatory elements with their specific transactivator factors we expect to shed light on the adaptive modifications that prevent the Hsp70 gene of E. focardii from responding to thermal stress while being responsive to other stresses.

Heat shock protein 70 gene polymorphisms’ influence on the electrophysiology of long QT syndrome

2015 ◽  
Vol 45 (2) ◽  
pp. 119-130 ◽  
Author(s):  
Altaf Ali ◽  
Sameera F. Qureshi ◽  
Veronica Medikare ◽  
Ananthapur Venkateshwari ◽  
Narsimhan Calambur ◽  
...  
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Long Qt Syndrome ◽  
Heat Shock Protein 70 ◽  
Gene Polymorphisms ◽  
Long Qt ◽  
Qt Syndrome

scholarly journals Heat Shock Protein 70 Family in Response to Multiple Abiotic Stresses in the Silkworm

Insects ◽  
2021 ◽  
Vol 12 (10) ◽  
pp. 928
Author(s):  
Shou-Min Fang ◽  
Qian Zhang ◽  
Yu-Li Zhang ◽  
Gui-Zheng Zhang ◽  
Ze Zhang ◽  
...  
Keyword(s):  
Heat Shock ◽  
Heat Shock Protein ◽  
Abiotic Stresses ◽  
Heat Shock Protein 70 ◽  
Thermal Stresses ◽  
Fat Body ◽  
Whole Genome ◽  
Silkworm Larvae ◽  
Shock Proteins ◽  
Heat Shock Cognates

The 70 kDa heat shock proteins play important roles in protecting organisms against environmental stresses, which are divided into stress-inducible forms (HSP70s) and heat shock cognates (HSC70s). In this study, heat shock protein 70 family was identified in the whole genome of the silkworm. Based on the known nomenclature and phylogenetic analysis, four HSP70s and five HSC70s were classified. Relatively, heat shock cognates were more conservative and were constitutively expressed in various tissues of the silkworm larvae. Under thermal (37 °C and 42 °C) and cold (2 °C) stresses, the expressions of HSP70–1, HSP70–2, and HSP70–3 were up-regulated, and the highest induction reached 4147.3, 607.1, and 1987.3 times, respectively. Interestingly, HSC70–1, HSC70–4, and HSC70–5 also showed slight induced expressions in the fat body and/or midgut under thermal stresses. In addition, the expression of HSP70–1 was induced by dichlorvos and phoxim insecticides, while most HSC70 genes were inhibited. The results suggested that stress-inducible forms play more important roles in adaptation to various stresses than HSC70s.

scholarly journals BAG3 Is a Modular, Scaffolding Protein that physically Links Heat Shock Protein 70 (Hsp70) to the Small Heat Shock Proteins

2017 ◽  
Vol 429 (1) ◽  
pp. 128-141 ◽  
Author(s):  
Jennifer N. Rauch ◽  
Eric Tse ◽  
Rebecca Freilich ◽  
Sue-Ann Mok ◽  
Leah N. Makley ◽  
...  
Keyword(s):  
Heat Shock ◽  
Heat Shock Proteins ◽  
Heat Shock Protein ◽  
Heat Shock Protein 70 ◽  
Small Heat Shock Proteins ◽  
Scaffolding Protein ◽  
Shock Proteins

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

Sign in / Sign up

Export Citation Format

Share Document