A field study of rugose leaf curl virus infection in stoloniferous Trifolium species

A field study was made of rugose leaf curl virus (RLCV) infection in four stoloniferous clovers ; New Zealand White and Irrigation White, cultivars of Trifolium repens, and two species from Africa, T. semipilosum and T. burchellianum. Half of the plants used were inoculated in the greenhouse, and, of these, 20 per cent showed symptoms of RLCV when they were planted in the field. The plants were grown in two field experiments on different sites at the Queensland Agricultural College, Lawes. The disease vector Austroagallia torrida was generally present over site 1 in larger numbers than over site 2. Pre-inoculated plants maintained a higher level of infection throughout the experiment. Over 40 per cent of plants not pre-inoculated developed the disease symptoms in the field, but the level of infection was consistently higher at site 1. T. semipilosum showed higher rates of infection than other species, but this species has greater drought resistance, and drought stress tended to mask symptom expression in the other species. Of 733 plants that showed infection during the experiment, 530 wholly or partially recovered from the disease, and, of these, only 38 became re-infected later in the experiment. The high percentage of recovery of infected plants, and the low percentage of re-infection of these recovered plants in the field supports earlier greenhouse studies, and suggests a possible reason for the low incidence of RLCV in old established stoloniferous clover pastures in southern Queensland.

Download Full-text

Characterization of a Synergistic Interaction Between Two Cucurbit-Infecting Begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus

Phytopathology ◽

10.1094/phyto-06-10-0159 ◽

2011 ◽

Vol 101 (2) ◽

pp. 281-289 ◽

Cited By ~ 30

Author(s):

Tali Sufrin-Ringwald ◽

Moshe Lapidot

Keyword(s):

Eastern Mediterranean ◽

Dual Infection ◽

Synergistic Interaction ◽

Bipartite Begomoviruses ◽

Disease Symptoms ◽

Squash Leaf Curl Virus ◽

Effect On Yield ◽

Leaf Curl Virus ◽

Watermelon Chlorotic Stunt Virus ◽

Leaf Curl

Squash leaf curl virus (SLCV) and Watermelon chlorotic stunt virus (WmCSV) are cucurbit-infecting bipartite begomoviruses. Both viruses are found in the eastern Mediterranean basin but the effects of dual infection of both viruses on melon (Cucumis melo L.) have not been described. ‘Arava’ melon plants were inoculated in the greenhouse, using whiteflies, with either SLCV, WmCSV, or both. Control plants were exposed to nonviruliferous whiteflies or not exposed at all. Following inoculation, plants were transplanted to a 50-mesh insect-proof nethouse and grown until fruit maturity. The experiment was performed in two melon-growing seasons: spring, transplant in May and harvest in July; and summer, transplant in August and harvest in October. Following inoculation, SLCV-infected melon plants showed mild symptoms that disappeared with time, and there was no effect on plant height. WmCSV-infected plants developed disease symptoms that became more obvious with time, and plants were somewhat shorter than control plants in the spring but not in the summer. SLCV had no effect on yield, regardless of season. WmCSV had no statistically significant effect on yield in the spring but, in the summer, reduced yield by 22%, on average. Dual-inoculated plants showed a synergistic interaction between the two viruses. They developed disease symptoms that were more pronounced than WmCSV alone, with plants being shorter than control plants by 20 to 25% regardless of season. Moreover, the yield of dual-inoculated plants was reduced on average by 21% in the spring and 54% in the summer, and fruit appearance was adversely affected. Dual inoculation did not affect WmCSV DNA level but SLCV DNA level was increased several-fold by the presence of WmCSV.

Download Full-text

A field study of competition and interaction between Lemna minor and Lemna trisulca

Canadian Journal of Botany ◽

10.1139/b89-373 ◽

1989 ◽

Vol 67 (10) ◽

pp. 2904-2911 ◽

Cited By ~ 9

Author(s):

Alexander L. McIlraith ◽

Gordon G. C. Robinson ◽

Jennifer M. Shay

Keyword(s):

Life History ◽

Field Study ◽

Key Words ◽

Field Experiments ◽

Lemna Minor ◽

Survey Methods ◽

The Other ◽

Transplant Experiment ◽

Replacement Series ◽

Vegetative Biomass

Field experiments and survey methods were used to assess competition and interaction between Lemna minor L. and Lemna trisulca L. at Delta Marsh, Manitoba. Sites were dominated by one or the other species or codominated by both. Replacement series experiments predicted codominance of L. minor and L. trisulca in an unshaded eutrophic site but predicted L. minor dominance when run for a longer time. Similar experiments conducted in a shaded eutrophic site predicted L. minor dominance. Addition series experiments showed that intraspecific and interspecific competition occurred in the unshaded site. In a eutrophic unshaded ditch, high densities of L. minor suppressed L. trisulca. In a eutrophic shaded site, high densities of L. minor and green algae inhibited L. trisulca, and in a sunny, less eutrophic site high density of each species inhibited the other. In a transplant experiment, L. minor biomass in shaded enclosures approached that found naturally in two shaded sites. Lemna trisulca persisted when shaded. Vegetative biomass trends in an unshaded eutrophic marsh ditch indicated spring and fall L. trisulca dominance and summer L. minor dominance. Shaded eutrophic sites were dominated by L. minor, whereas a less eutrophic site was dominated by L. trisulca. A model is developed to explain dominance patterns, and seasonal life-history responses are considered. Key words: Lemna, duckweed, competition, interaction, resources, light, nutrients.

Download Full-text

Prevention by soil mulching of the spread of tomato yellow leaf curl virus transmitted by Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae) in Israel

Bulletin of Entomological Research ◽

10.1017/s0007485300009445 ◽

1978 ◽

Vol 68 (3) ◽

pp. 465-470 ◽

Cited By ~ 37

Author(s):

S. Cohen ◽

Venezia Melamed-Madjar

Keyword(s):

Bemisia Tabaci ◽

Field Experiments ◽

Combined Treatment ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Azinphos Methyl ◽

Leaf Curl Virus ◽

Leaf Curl

AbstractTomato yellow leaf curl virus (TYLCV), which is transmitted by Bemisia tabaci (Gennadius), is a very destructive disease of tomato i Israel. Soil mulching with yellow polyethylene sheets delayed the spread of the disease for at least 20 days. In laboratory and field experiments, B. tabaci was found to be more attracted to yellow polyethylene than to straw or to aluminum- or blue-coloured polyethylene. A combined treatment of mulching with yellow polyethylene sheets and 1% sprays of azinphos-methyl starting 20 days after germination was the most effective in preventing the spread of TYLCV.

Download Full-text

A Novel Source of Resistance to Tomato Yellow Leaf Curl Virus Exhibiting a Symptomless Reaction to Viral Infection

Journal of the American Society for Horticultural Science ◽

10.21273/jashs.123.6.1004 ◽

1998 ◽

Vol 123 (6) ◽

pp. 1004-1007 ◽

Cited By ~ 81

Author(s):

M. Friedmann ◽

M. Lapidot ◽

S. Cohen ◽

M. Pilowsky

Keyword(s):

Natural Infection ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Susceptible Parent ◽

Partial Dominance ◽

Disease Symptoms ◽

Leaf Curl Virus ◽

Very High ◽

Different Levels ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), transmitted by the tobacco whitefy (Bemisia tabaci Genn.), can be devastating to tomato (Lycopersicon esculentum L.) crops in tropical and subtropical regions. The development of resistant cultivars is the best option for control of TYLCV. However, all the available resistant commercial cultivars tested at the Volcani Center, when inoculated with TYLCV, developed different levels of disease symptoms. In this study, we report the development of a breeding line, TY172, which is a symptomless carrier of TYLCV. Line TY172, whether infected in the greenhouse with viruliferous whiteflies, or when grown in the field under natural infection, showed no symptoms of the disease. Viral DNA was detected in infected TY172 plants, albeit at much lower levels than a susceptible infected control. In addition, grafting experiments using infected susceptible scions grafted onto TY172 stocks, showed that even when exposed continuously to very high levels of virus, line TY172 did not develop disease symptoms, nor did it accumulate high levels of the virus. When TY172 was crossed with susceptible lines, the hybrids exhibited milder symptoms and lower viral content than the susceptible parent, yet higher than that of TY172, suggesting a partial dominance for the TY172 resistance. Upon inoculation of F2 populations, the amount of symptomless individuals appeared in a ratio of≈7:64. This suggests that at least three genes may account for the resistance.

Download Full-text

Effect of okra plant resistance on transmission rate of okra enation leaf curl virus by its vector whitefly, Bemisia tabaci

Journal of Applied and Natural Science ◽

10.31018/jans.v13isi.2778 ◽

2021 ◽

Vol 13 (SI) ◽

pp. 63-68

Author(s):

E. Pasupathi ◽

M. Murugan ◽

C. Chinniah ◽

J. Ramalingam ◽

G. Karthikeyan ◽

...

Keyword(s):

Bemisia Tabaci ◽

Plant Resistance ◽

Transmission Rate ◽

Resistance Mechanisms ◽

Plant Viruses ◽

Symptom Expression ◽

Virus Symptom ◽

Leaf Curl Virus ◽

Effect Of Age ◽

Leaf Curl

The present study aimed to investigate the effect of age of the okra plants that showed varying whitefly resistance responses on the transmission rate of okra enation leaf curl virus (OELCV) by its vector whitefly Bemisia tabaci. The OELCV infected whitefly adults were collected from whitefly colonies and were challenged on the test okra accessions (Upl mona 2, Co 1, Arka anamika and AE 64) of differential ages which were individually caged (7, 10 and 15 d after germination) with glass chimney and the number of such whiteflies used were at the rate of 2, 4, 6, 8, 10, 12, 14 and 20 adults per plant. Observations were made on the virus symptom expression 30 d after challenge. The efficiency of transmission was determined. The efficiency of transmission of OELCV was the highest (maximum T and P*, 0.80, 1.00 and 0.08, 0.10) when 7 d old seedlings were inoculated (Arka anamika and AE 64 respectively) and transmission had decreased as the age of seedlings increased. The estimated transmission rate for single whitefly (P*) increased with an increase in the number of whiteflies used per plant. Okra plant resistance to B. tabaci significantly changed the transmission rates of OELCV on okra. Understanding the resistance mechanisms of the okra accessions and interactions between plant viruses and their insect host can pave the way for novel approaches to protect plants from virus infection.

Download Full-text

Biopesticides for Management of Bemisia tabaci MEAM1 (Hemiptera: Aleyrodidae) and Tomato Yellow Leaf Curl Virus

Journal of Economic Entomology ◽

10.1093/jee/toaa131 ◽

2020 ◽

Vol 113 (5) ◽

pp. 2310-2318

Author(s):

Hugh A Smith

Keyword(s):

Bemisia Tabaci ◽

Field Experiments ◽

Gulf Coast ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Central Florida ◽

Treatment Interval ◽

Research And Education ◽

Leaf Curl Virus ◽

Leaf Curl

Abstract The sweetpotato whitefly, Bemisia tabaci MEAM1 Gennadius, is a global pest of tomato, transmitting Tomato yellow leaf curl virus (TYLCV). Management of B. tabaci is challenging in part because of its ability to develop resistance to insecticides. Biopesticides include materials that control B. tabaci via mechanisms that do not select for resistance. Field experiments were conducted in the spring and fall of 2016 and 2017 at the University of Florida’s Gulf Coast Research and Education Center in west central Florida to compare biopesticides to conventional insecticides for management of B. tabaci and TYLCV. Insecticide rotations were designed in part around the concept that conventional insecticide programs should group modes of action according to 5-wk treatment intervals, corresponding to an estimated 5-wk generation time for the pest. In 2016, when tomato was treated during the first 5-wk treatment interval with either biopesticides or neonicotinoid insecticides, insecticidal soap contributed to a reduction in whitefly egg numbers and percentage TYLCV that was comparable to results achieved with dinotefuran. In contrast, egg numbers and virus incidence in plants treated with kaolin clay tended to be numerically higher than the untreated control. In spring 2017, comparisons of biopesticides and conventional ovicides/nymphicides during the second 5-wk treatment interval showed that biopesticides can provide comparable reduction in nymph numbers to conventional insecticides. While data from these trials confirm that biopesticides can reduce numbers of whitefly eggs and nymphs, they indicate that season-long programs of the biopesticides evaluated may not reduce transmission of TYLCV below economically acceptable levels.

Download Full-text

Effect of combined and single infections of mosaic and leaf curl viruses on okra (Hibiscus esculentus) growth and yield

The Journal of Agricultural Science ◽

10.1017/s0021859600085865 ◽

1989 ◽

Vol 112 (3) ◽

pp. 413-418 ◽

Cited By ~ 4

Author(s):

G. I. Atiri ◽

B. Ibidapo

Keyword(s):

Field Experiments ◽

Yield Loss ◽

Fruit Weight ◽

Growth And Yield ◽

Mixed Infections ◽

Percentage Yield ◽

Hibiscus Esculentus ◽

Low Performance ◽

Leaf Curl Virus ◽

Leaf Curl

SummaryIn field experiments, infections by okra mosaic virus (OMV) and okra leaf curl virus (OLCV) reduced trie growth of okra more than when the plants were infected singly by either virus. The critical growth component responsible for low performance was leaf area in OLCV-infected plants and chlorophyll content in OMV-infected plants. However, the two viruses had a synergistic effect in mixed infection.Expressed as percentage yield loss, mixed infections significantly reduced edible fresh fruit weight more than single infections in all okra cultivars. In single infections, OLCV caused higher yield loss than OMV. Since both viruses cause more damage in mixed infections, it may be preferable to breed for combined resistance, particularly if the genes for resistance are linked.

Download Full-text

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan

Plant Disease ◽

10.1094/pdis-05-13-0554-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1746-1746 ◽

Cited By ~ 8

Author(s):

Y. H. Cheng ◽

T. C. Deng ◽

C. C. Chen ◽

C. H. Chiang ◽

C. A. Chang

Keyword(s):

Rolling Circle Amplification ◽

Pcr Primers ◽

Passion Fruit ◽

The Other ◽

Passiflora Edulis ◽

Rolling Circle ◽

First Report ◽

Immature Fruit ◽

Leaf Curl Virus ◽

Leaf Curl

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) ‘Tainung No. 1’ is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5′TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3′/5′CGCAGTTT CTGGAGGATATTAAG3′/5′TCGCATGCCACTTCCTCAGT3′) were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

Download Full-text

First Report of Tomato leaf curl New Delhi virus Infecting Tomato in Bangladesh

Plant Disease ◽

10.1094/pd-89-1011c ◽

2005 ◽

Vol 89 (9) ◽

pp. 1011-1011 ◽

Cited By ~ 14

Author(s):

M. N. Maruthi ◽

A. R. Rekha ◽

A. Cork ◽

J. Colvin ◽

S. N. Alam ◽

...

Keyword(s):

Tomato Leaf ◽

New Delhi ◽

Disease Symptoms ◽

Viral Genomes ◽

Virus Diversity ◽

Important Cash Crop ◽

Tomato Leaf Curl ◽

Leaf Curl Virus ◽

Viral Sequences ◽

Leaf Curl

Tomato is an important cash crop for resource-poor farmers and accounts for 20% of the 2 million t of vegetables grown annually in Bangladesh. Tomato cultivation is affected by Tomato leaf curl virus (ToLCV), which can cause as much as 100% yield loss. Plants exhibiting typical ToLCV disease symptoms of yellowing, severe leaf curling, and stunting were collected at Jessore, Bangladesh during September 2003. The putative virus was transmitted from tomato to tomato by the whitefly Bemisia tabaci. In two separate experiments, 100% transmission was achieved by using 10 viruliferous B. tabaci adults for each of the 20 test plants that was confirmed by comparing the symptoms on test and virus source plants. Total DNAs were extracted from the symptomatic leaves, and the putative viral genomes were amplified by polymerase chain reaction by using the Deng A and B primers (1). Sequences generated from these primers were used to design virus-specific primers that were used to obtain complete viral sequences. Full-length DNA-A (2,740 nt; GenBank Accession No. AJ875157) and DNA-B (2,688 nt; GenBank Accession No. AJ875158) sequences of a bipartite Tomato leaf curl New Delhi virus from Jessore (ToLCNDV-[Jes]) were obtained, which were most similar to the corresponding sequences of ToLCNDV-(Lucknow) (GenBank Accession No. Y16421) at 95.7% and Tomato leaf curl Gujarat virus-(Varanasi) (Gen-Bank Accession No. AY190291) at 90.6% nt identities, respectively. DNA-A sequences had only 73.2% nt identity with the previously reported monopartite Tomato leaf curl Bangladesh virus (GenBank Accession No. AF188481) (2), confirming the occurrence of mono- and bipartite bego-moviruses in Bangladesh. The virus diversity poses a challenge for ToLCVD management in Bangladesh. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) S. K. Green et al. Plant Dis. 85:1286, 2001.

Download Full-text