scholarly journals Transgenic Wheat Harboring an RNAi Element Confers Dual Resistance Against Synergistically Interacting Wheat Streak Mosaic Virus and Triticum Mosaic Virus

2020 ◽  
Vol 33 (1) ◽  
pp. 108-122 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Shirley Sato ◽  
Natalya Nersesian ◽  
Jeff Alexander ◽  
Truyen Quach ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
The United States ◽  
Transgenic Wheat ◽  
Wheat Streak Mosaic Virus ◽  
Effective Control ◽  
Northern Blot Hybridization ◽  
Replicase Gene ◽  
Yield Losses ◽  
Resistance Phenotype

Wheat streak mosaic virus (WSMV) and triticum mosaic virus (TriMV) are economically important viruses of wheat (Triticum aestivum L.), causing significant yield losses in the Great Plains region of the United States. These two viruses are transmitted by wheat curl mites, which often leads to mixed infections with synergistic interaction in grower fields that exacerbates yield losses. Development of dual-resistant wheat lines would provide effective control of these two viruses. In this study, a genetic resistance strategy employing an RNA interference (RNAi) approach was implemented by assembling a hairpin element composed of a 202-bp (404-bp in total) stem sequence of the NIb (replicase) gene from each of WSMV and TriMV in tandem and of an intron sequence in the loop. The derived RNAi element was cloned into a binary vector and was used to transform spring wheat genotype CB037. Phenotyping of T1 lineages across eight independent transgenic events for resistance revealed that i) two of the transgenic events provided resistance to WSMV and TriMV, ii) four events provided resistance to either WSMV or TriMV, and iii) no resistance was found in two other events. T2 populations derived from the two events classified as dual-resistant were subsequently monitored for stability of the resistance phenotype through the T4 generation. The resistance phenotype in these events was temperature-dependent, with a complete dual resistance at temperatures ≥25°C and an increasingly susceptible response at temperatures below 25°C. Northern blot hybridization of total RNA from transgenic wheat revealed that virus-specific small RNAs (vsRNAs) accumulated progressively with an increase in temperature, with no detectable levels of vsRNA accumulation at 20°C. Thus, the resistance phenotype of wheat harboring an RNAi element was correlated with accumulation of vsRNAs, and the generation of vsRNAs can be used as a molecular marker for the prediction of resistant phenotypes of transgenic plants at a specific temperature.

scholarly journals First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 422-422 ◽  
Author(s):  
M. Mijit ◽  
S. F. Li ◽  
S. Zhang ◽  
Z. X. Zhang
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
Ficus Carica ◽  
Pcr Analysis ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

scholarly journals Satellite Remote Sensing of Wheat Infected by Wheat streak mosaic virus

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 4-12 ◽  
Author(s):  
M. Mirik ◽  
D. C. Jones ◽  
J. A. Price ◽  
F. Workneh ◽  
R. J. Ansley ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Disease Incidence ◽  
Ground Truth ◽  
The United States ◽  
Wheat Streak Mosaic Virus ◽  
United States Department ◽  
Department Of Agriculture ◽  
Commission Errors ◽  
Tm Image ◽  
Omission Errors

The prevalence of wheat streak mosaic, caused by Wheat streak mosaic virus, was assessed using Landsat 5 Thematic Mapper (TM) images in two counties of the Texas Panhandle during the 2005–2006 and 2007–2008 crop years. In both crop years, wheat streak mosaic was widely distributed in the counties studied. Healthy and diseased wheat were separated on the images using the maximum likelihood classifier. The overall classification accuracies were between 89.47 and 99.07% for disease detection when compared to “ground truth” field observations. Omission errors (i.e., pixels incorrectly excluded from a particular class and assigned to other classes) varied between 0 and 12.50%. Commission errors (i.e., pixels incorrectly assigned to a particular class that actually belong to other classes) ranged from 0 to 23.81%. There were substantial differences between planted wheat acreage reported by the United States Department of Agriculture-National Agricultural Statistics Service (USDA-NASS) and that detected by image analyses. However, harvested wheat acreage reported by USDA-NASS and that detected by image classifications were closely matched. These results indicate that the TM image can be used to accurately detect and quantify incidence of wheat streak mosaic over large areas. This method appears to be one of the best currently available for identification and mapping disease incidence over large and remote areas by offering a repeatable, inexpensive, and synoptic strategy during the course of a growing season.

scholarly journals New Sources of Temperature-Sensitive Resistance to Wheat streak mosaic virus in Wheat

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1051-1056 ◽  
Author(s):  
Dallas L. Seifers ◽  
Steve Haber ◽  
T. J. Martin ◽  
Guorong Zhang
Keyword(s):  
Mosaic Virus ◽  
Relative Effectiveness ◽  
Wheat Streak Mosaic Virus ◽  
Temperature Sensitive ◽  
Yield Losses ◽  
Sources Of Resistance ◽  
Small Grains ◽  
Virus Isolates ◽  
Better Than

Expressing temperature-sensitive resistance (TSR) protects wheat against yield losses from infection with Wheat streak mosaic virus (WSMV). In examining how 2,429 wheat accessions from the National Small Grains Collection responded to inoculation with the Sid81 isolate of WSMV, 20 candidate TSR sources were discovered. To differentiate their relative effectiveness, accession responses over 21 days to inoculation with GH95, Sid81, and PV57 virus isolates in regimes of 18 and 20°C were observed. At 18°C, all 20 candidate TSR sources were uniformly or nearly uniformly asymptomatic 21 days after inoculation with the PV57 isolate, resistance indistinguishable from resistant checks KS96HW10-3 and RonL. By contrast, the Sid81 isolate induced symptoms in low but significant proportions of plants of two candidates, and the GH95 isolate in high proportions for four candidates and low but significant proportions for two others. In the more stringent 20°C regime, the uniform or near-uniform induction of symptoms in response to inoculation with GH95 failed to differentiate among the 20 candidate TSR sources and two resistant checks, while PV57 and Sid81 identified several candidates that performed similarly to KS96HW10-3 and significantly better than RonL. By identifying new sources of resistance, this study contributes to the control of WSMV.

scholarly journals Impacts of Crop Variety and Time of Inoculation on the Susceptibility and Tolerance of Winter Wheat to Wheat streak mosaic virus

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1060-1065 ◽  
Author(s):  
Z. Miller ◽  
F. Menalled ◽  
D. Ito ◽  
M. Moffet ◽  
M. Burrows
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Great Plains ◽  
Disease Risk ◽  
Wheat Yield ◽  
Wheat Streak Mosaic Virus ◽  
Northern Great Plains ◽  
Yield Losses ◽  
South Central ◽  
The Impact

Plant genotype, age, size, and environmental factors can modify susceptibility and tolerance to disease. Understanding the individual and combined impacts of these factors is needed to define improved disease management strategies. In the case of Wheat streak mosaic virus (WSMV) in winter wheat, yield losses and plant susceptibility have been found to be greatest when the crop is exposed to the virus in the fall in the central and southern Great Plains. However, the seasonal dynamics of disease risk may be different in the northern Great Plains, a region characterized by a relatively cooler fall conditions, because temperature is known to modify plant–virus interactions. In a 2-year field study conducted in south-central Montana, we compared the impact of fall and spring WSMV inoculations on the susceptibility, tolerance, yield, and grain quality of 10 winter wheat varieties. Contrary to previous studies, resistance and yields were lower in the spring than in the fall inoculation. In all, 5 to 7% of fall-inoculated wheat plants were infected with WSMV and yields were often similar to uninoculated controls. Spring inoculation resulted in 45 to 57% infection and yields that were 15 to 32% lower than controls. Although all varieties were similarly susceptible to WSMV, variations in tolerance (i.e., yield losses following exposure to the virus) were observed. These results support observations that disease risk and impacts differ across the Great Plains. Possible mechanisms include variation in climate and in the genetic composition of winter wheat and WSMV across the region.

Reactions of winter wheat, spring wheat, and barley cultivars to mechanical inoculation with wheat streak mosaic virus

2021 ◽  
Author(s):  
Uta McKelvy ◽  
Monica Brelsford ◽  
Jamie Sherman ◽  
Mary Burrows
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Spring Wheat ◽  
Wheat Streak Mosaic Virus ◽  
Yield Response ◽  
Breeding Line ◽  
Wheat Cultivars ◽  
Yield Losses ◽  
Breeding Lines ◽  
Barley Cultivars

Wheat streak mosaic virus (WSMV) causes sporadic epidemics in Montana which can threaten profitability of the state’s small grains production. One challenge for WSMV management in Montana is that most commercially available wheat and barley cultivars are susceptible to WSMV or their performance under WSMV pressure is unknown. In a three-year field study from 2017 to 2019 winter wheat, spring wheat, and barley cultivars were evaluated for their susceptibility to WSMV and yield performance under WSMV pressure. Plants were mechanically inoculated and WSMV incidence was assessed using DAS-ELISA. There was effective resistance to WSMV in breeding line CO12D922, which had consistently low WSMV incidence, highlighting promising efforts in the development of WSMV-resistant winter wheat cultivars. Moderate WSMV incidence and minor yield losses were observed from WSMV infection of commercial winter wheat ‘Brawl CL Plus’ and MSU breeding line MTV1681. Spring wheat cultivars in this study had high WSMV incidence of up to 100 % in ‘Duclair,’ ‘Egan,’ and ‘McNeal.’ High WSMV incidence was associated with severe yield losses as high as 85 % for Duclair and ‘WB9879CL’ in 2019, demonstrating a high degree of susceptibility to WSMV inoculation. Barley cultivars had considerably lower WSMV incidence compared to spring and winter wheat. Grain yield response to WSMV inoculation was variable between barley cultivars. The study provided an experimental basis for cultivar recommendations for high WSMV pressure environments and identified breeding lines and cultivars with potential resistance traits of interest to breeding programs that aim to develop WSMV-resistant cultivars.

scholarly journals Temperature-Sensitive Resistance to Wheat streak mosaic virus in CO960333 and KS06HW79 Wheat

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 983-987 ◽  
Author(s):  
D. L. Seifers ◽  
T. J. Martin ◽  
S. Haber
Keyword(s):  
Mosaic Virus ◽  
Dna Marker ◽  
Field Trials ◽  
Wheat Breeding ◽  
Wheat Streak Mosaic Virus ◽  
Temperature Sensitive ◽  
Yield Losses ◽  
Breeding Programs ◽  
Sequence Characterized Amplified Region ◽  
Temperature Regimes

Temperature-sensitive resistance (TSR) that can protect against losses to Wheat streak mosaic virus (WSMV) has been described in elite wheat germplasm. A TSR identified in the advanced breeding line CO960333 and its derivative KS06HW79 was examined in growth-chamber tests conducted under constant temperature regimes of 18, 21, and 24°C against an array of WSMV isolates. At 18°C, all tested isolates systemically infected the pedigree parents, while the progeny line CO960333 remained free of symptoms; at 24°C, all lines were susceptible. At the intermediate temperature of 21°C, the TSR of KS06HW79 was effective in contrast to the TSRs of KS03HW12 and ‘RonL’. In field trials conducted in 2011 and 2012, the TSR expressed in KS06HW79 conferred complete protection against yield losses from inoculation with the Sidney 81 isolate of WSMV, while the TSR of RonL conferred similar protection in 2012 but allowed small losses in 2011. The resistance expressed by KS06HW79 is likely not due to the Wsm1 gene because it did not contain the tightly linked J15 sequence-characterized amplified region (SCAR) DNA marker. These findings suggest that KS06HW79 could be an additional TSR source of value to wheat-breeding programs seeking to control losses from WSMV.

scholarly journals Effects of Single and Double Infections of Winter Wheat by Triticum mosaic virus and Wheat streak mosaic virus on Yield Determinants

Plant Disease ◽  
2012 ◽  
Vol 96 (6) ◽  
pp. 859-864 ◽  
Author(s):  
E. Byamukama ◽  
S. Tatineni ◽  
G. L. Hein ◽  
R. A. Graybosch ◽  
P. S. Baenziger ◽  
...  
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Total Nitrogen ◽  
The United States ◽  
Wheat Streak Mosaic Virus ◽  
Root Weight ◽  
Virus Infections ◽  
Double Infection ◽  
Shoot Weight ◽  
Spad Readings

Triticum mosaic virus (TriMV) is a recently discovered virus infecting wheat (Triticum aestivum) in the Great Plains region of the United States. It is transmitted by wheat curl mites (Aceria tosichella) which also transmit Wheat streak mosaic virus (WSMV) and Wheat mosaic virus. In a greenhouse study, winter wheat ‘Millennium’ (WSMV susceptible) and ‘Mace’ (WSMV resistant) were mechanically inoculated with TriMV, WSMV, TriMV+WSMV, or sterile water at the two-leaf growth stage. At 28 days after inoculation, final chlorophyll meter (soil plant analysis development [SPAD]) readings, area under the SPAD progress curve (AUSPC), the number of tillers per plant, shoot and root weight, and total nitrogen and carbon content were determined. In Millennium, all measured variables were significantly reduced by single or double virus infections, with the greatest reductions occurring in the double-infection treatment. In Mace, only final SPAD readings, AUSPC, and total nitrogen were significantly reduced by single or double virus infections. There was a significant (P ≤ 0.05), positive linear relationship between SPAD readings and shoot weight in Millennium but not in Mace. The relationship between total nitrogen and shoot weight was positive, linear, and significant in both cultivars. The results from this study indicate that Mace, a WSMV-resistant cultivar, is also resistant to TriMV, and double infection of winter wheat by TriMV and WSMV exacerbates symptom expression and loss of biomass in susceptible cultivars.

scholarly journals Citrus viroid V: Occurrence, Host Range, Diagnosis, and Identification of New Variants

2008 ◽  
Vol 98 (11) ◽  
pp. 1199-1204 ◽  
Author(s):  
P. Serra ◽  
M. Eiras ◽  
S. M. Bani-Hashemian ◽  
N. Murcia ◽  
E. W. Kitajima ◽  
...  
Keyword(s):  
Sweet Orange ◽  
Blot Hybridization ◽  
The United States ◽  
Northern Blot Hybridization ◽  
Sultanate Of Oman ◽  
Sweet Lime ◽  
The Family ◽  
Commercial Species ◽  
Polymerase Chain ◽  
Amplification Host

The recently described Citrus viroid V (CVd-V) has been proposed as a new species of the genus Apscaviroid within the family Pospiviroidae. Analysis of 64 samples from different citrus-growing areas has shown that CVd-V is present in the United States, Spain, Nepal, and the Sultanate of Oman. CVd-V found in six sweet orange sources from the Sultanate of Oman was identical to the reference CVd-V variant, whereas three new variants with sequence identities of 98.6% (CVd-VCA), 97.3% (CVd-VST), and 94.9% (CVd-VNE) were identified in sources from California, Spain, and Nepal, respectively. These results suggest that this viroid has not emerged recently and that it is relatively widespread. Transmission assays to sweet orange, mandarin, and mandarin hybrids, clementine, satsuma, lemon, sour orange, Tahiti lime, Palestine sweet lime, calamondin, bergamot, and kumquat have shown that all these citrus species and citrus relatives are hosts for CVd-V. Several indexing approaches, including slot blot, northern blot hybridization, and reverse transcription-polymerase chain reaction, have been evaluated for detecting CVd-V, either using Etrog citron as an amplification host or directly from commercial species and cultivars.

scholarly journals Wheat and Barley Susceptibility and Tolerance to Multiple Isolates of Wheat streak mosaic virus

Plant Disease ◽  
2015 ◽  
Vol 99 (10) ◽  
pp. 1383-1389 ◽  
Author(s):  
Erik Lehnhoff ◽  
Zachariah Miller ◽  
Fabian Menalled ◽  
Dai Ito ◽  
Mary Burrows
Keyword(s):  
Winter Wheat ◽  
Mosaic Virus ◽  
Great Plains ◽  
Spring Wheat ◽  
Virus Disease ◽  
Wheat Yield ◽  
Wheat Streak Mosaic Virus ◽  
Yield Losses ◽  
Wheat Varieties ◽  
Cultivar Screening

One of the greatest virus disease threats to wheat production in the Great Plains of the USA is Wheat streak mosaic virus (WSMV). Breeding programs have developed wheat varieties that are resistant or tolerant to WSMV infection, but these characteristics are climate dependent, and may also vary by WSMV isolate. We tested 10 spring and nine winter wheat (Triticum aestivum) varieties and two barley (Hordeum vulgare) varieties for resistance and tolerance to one WSMV isolate over four years. In spring wheat and barley, there were year by cultivar interactions in terms of resistance and tolerance. However, in winter wheat, yield losses due to WSMV were relatively consistent across years and varieties. Additionally, we tested the impacts of three WSMV isolates individually and in a mixture on twelve, two, and twelve varieties of spring wheat, barley, and winter wheat, respectively. Resistance and tolerance varied by isolate and cultivar, but there were no isolate by cultivar interactions. For spring wheat and barley, yield impacts were greater for two of the three single isolates than for the isolate mixture, whereas in winter wheat, the isolate mixture caused greater yield losses than the individual isolates. Overall, the results indicate that resistance and tolerance phenotypes were influenced by environmental conditions and by WSMV isolate or combination of isolates, suggesting that cultivar screening should be conducted over multiple years and with multiple virus isolates.

Sign in / Sign up

Export Citation Format

Share Document