scholarly journals Citrus viroid V: Occurrence, Host Range, Diagnosis, and Identification of New Variants

2008 ◽  
Vol 98 (11) ◽  
pp. 1199-1204 ◽  
Author(s):  
P. Serra ◽  
M. Eiras ◽  
S. M. Bani-Hashemian ◽  
N. Murcia ◽  
E. W. Kitajima ◽  
...  
Keyword(s):  
Sweet Orange ◽  
Blot Hybridization ◽  
The United States ◽  
Northern Blot Hybridization ◽  
Sultanate Of Oman ◽  
Sweet Lime ◽  
The Family ◽  
Commercial Species ◽  
Polymerase Chain ◽  
Amplification Host

The recently described Citrus viroid V (CVd-V) has been proposed as a new species of the genus Apscaviroid within the family Pospiviroidae. Analysis of 64 samples from different citrus-growing areas has shown that CVd-V is present in the United States, Spain, Nepal, and the Sultanate of Oman. CVd-V found in six sweet orange sources from the Sultanate of Oman was identical to the reference CVd-V variant, whereas three new variants with sequence identities of 98.6% (CVd-VCA), 97.3% (CVd-VST), and 94.9% (CVd-VNE) were identified in sources from California, Spain, and Nepal, respectively. These results suggest that this viroid has not emerged recently and that it is relatively widespread. Transmission assays to sweet orange, mandarin, and mandarin hybrids, clementine, satsuma, lemon, sour orange, Tahiti lime, Palestine sweet lime, calamondin, bergamot, and kumquat have shown that all these citrus species and citrus relatives are hosts for CVd-V. Several indexing approaches, including slot blot, northern blot hybridization, and reverse transcription-polymerase chain reaction, have been evaluated for detecting CVd-V, either using Etrog citron as an amplification host or directly from commercial species and cultivars.

scholarly journals Detection and Differentiation of Bovine Group A Rotavirus Serotypes using Polymerase Chain Reaction-Generated Probes to the VP7 Gene

1992 ◽  
Vol 4 (2) ◽  
pp. 148-158 ◽  
Author(s):  
Anil V. Parwani ◽  
Blair I. Rosen ◽  
Jorge Flores ◽  
Malcolm A. McCrae ◽  
Mario Gorziglia ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Blot Hybridization ◽  
Northern Blot Hybridization ◽  
Chain Reaction ◽  
Diarrhea Virus ◽  
Bovine Rotavirus ◽  
Group A ◽  
Polymerase Chain ◽  
Vp7 Gene ◽  
Hybridization Assays

Dot and Northern blot hybridization assays were developed to detect and differentiate group A bovine rotavirus serotypes using radiolabeled serotype 6 (Nebraska calf diarrhea virus [NCDV] and United Kingdom [UK] strains) or serotype 10 (Cracker [Cr] strain) VP7 gene probes. Partial length VP7-specific cDNA encompassing areas of major sequence diversity were generated by the polymerase chain reaction (PCR) using either cloned VP7 genes (NCDV and UK strains) or reverse transcribed mRNA (Cr strain) as templates. Radiolabeled probes prepared from the PCR-generated cDNA were tested at various stringency conditions to optimize the hybridization assays. At high stringency conditions (52 C, 50% formamide, 5 x standard saline citrate), the NCDV, UK, and Cr probes serotypically differentiated bovine rotavirus isolates in RNA samples prepared from cell culture-propagated viruses or in fecal specimens from infected gnotobiotic calves. The sensitivity and specificity of NCDV and Cr VP7 probes were characterized in dot blot hybridization assays, and the probes were estimated to detect at least 1 ng of viral RNA. The serotyping results obtained using VP7 probes were similar to those obtained using serologic assays. Further development of these assays may provide a useful means for the rapid detection and differentiation of bovine rotavirus serotypes in fecal samples from calves in the field.

Transcript levels for a mung bean cysteine protease during early seedling growth

1997 ◽  
Vol 7 (4) ◽  
pp. 359-372 ◽  
Author(s):  
Kangmoon Lee ◽  
Zhouwen Liu ◽  
Anna Tan-Wilson ◽  
Karl Wilson
Keyword(s):  
Mung Bean ◽  
Protease Activity ◽  
Blot Hybridization ◽  
Northern Blot Hybridization ◽  
Specific Primers ◽  
System A ◽  
Early Seedling ◽  
Polymerase Chain ◽  
Normal Increase ◽  
Putative Translation Product

AbstractcDNAs for the major cysteine endopeptidase (CEpase) of mung bean (Vigna radiata [L.] Wilczek) seedling cotyledons have been cloned using gene-specific primers with the polymerase chain reaction (PCR) in a 3'-RACE system. A cDNA clone for CEpase, pKL042, that is 1221 bp long excluding the poly A tail was isolated. It appears to contain the entire coding sequence for a 362-residue-long polypeptide. The N-terminal sequence for the mature CEpase begins at position 128 of the putative translation product, suggesting removal of an N-terminal hydrophobic signal peptide and additional sequences to produce the mature protease. Northern blot hybridization with CEpase cDNA pKL042 as probe indicates that CEpase transcript is not detectable in the cotyledons or the embryonic axis of dry seeds, but is first detectable in the day 1 cotyledons and in the day 3 axis. The level of CEpase mRNA in both cotyledons and axis increases as growth proceeds. A decline of protease activity, however, is observed after day 3 in the cotyledons, even though the level of protease transcripts continues to increase until day 8. Detachment of the axis from the cotyledons before day 3 results in the prevention of the normal increase in both protease activity and CEpase mRNA.

scholarly journals Transgenic Wheat Harboring an RNAi Element Confers Dual Resistance Against Synergistically Interacting Wheat Streak Mosaic Virus and Triticum Mosaic Virus

2020 ◽  
Vol 33 (1) ◽  
pp. 108-122 ◽  
Author(s):  
Satyanarayana Tatineni ◽  
Shirley Sato ◽  
Natalya Nersesian ◽  
Jeff Alexander ◽  
Truyen Quach ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
The United States ◽  
Transgenic Wheat ◽  
Wheat Streak Mosaic Virus ◽  
Effective Control ◽  
Northern Blot Hybridization ◽  
Replicase Gene ◽  
Yield Losses ◽  
Resistance Phenotype

Wheat streak mosaic virus (WSMV) and triticum mosaic virus (TriMV) are economically important viruses of wheat (Triticum aestivum L.), causing significant yield losses in the Great Plains region of the United States. These two viruses are transmitted by wheat curl mites, which often leads to mixed infections with synergistic interaction in grower fields that exacerbates yield losses. Development of dual-resistant wheat lines would provide effective control of these two viruses. In this study, a genetic resistance strategy employing an RNA interference (RNAi) approach was implemented by assembling a hairpin element composed of a 202-bp (404-bp in total) stem sequence of the NIb (replicase) gene from each of WSMV and TriMV in tandem and of an intron sequence in the loop. The derived RNAi element was cloned into a binary vector and was used to transform spring wheat genotype CB037. Phenotyping of T1 lineages across eight independent transgenic events for resistance revealed that i) two of the transgenic events provided resistance to WSMV and TriMV, ii) four events provided resistance to either WSMV or TriMV, and iii) no resistance was found in two other events. T2 populations derived from the two events classified as dual-resistant were subsequently monitored for stability of the resistance phenotype through the T4 generation. The resistance phenotype in these events was temperature-dependent, with a complete dual resistance at temperatures ≥25°C and an increasingly susceptible response at temperatures below 25°C. Northern blot hybridization of total RNA from transgenic wheat revealed that virus-specific small RNAs (vsRNAs) accumulated progressively with an increase in temperature, with no detectable levels of vsRNA accumulation at 20°C. Thus, the resistance phenotype of wheat harboring an RNAi element was correlated with accumulation of vsRNAs, and the generation of vsRNAs can be used as a molecular marker for the prediction of resistant phenotypes of transgenic plants at a specific temperature.

scholarly journals Specific Detection of Shedding and Latency of Bovine Herpesvirus 1 and 5 using a Nested Polymerase Chain Reaction

1997 ◽  
Vol 9 (4) ◽  
pp. 387-394 ◽  
Author(s):  
Scott E. Ashbaugh ◽  
Karin E. Thompson ◽  
Ellen B. Belknap ◽  
Patricia C. Schultheiss ◽  
Shafiqul Chowdhury ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Blot Hybridization ◽  
The United States ◽  
Trigeminal Ganglia ◽  
Chain Reaction ◽  
Nested Polymerase Chain Reaction ◽  
Bovine Herpesvirus 1 ◽  
Nasal Secretions ◽  
Herpesvirus 1 ◽  
Polymerase Chain

A sensitive method for simultaneously detecting and discriminating between bovine herpesviruses types 1 and 5 (BHV-1 and BHV-5) was developed using a nested polymerase chain reaction (PCR) technique. Following amplification using type-common primers derived from gC sequences, amplification using type-specific nesting primers produced different-sized bands specific to the corresponding types, as demonstrated by blot hybridization. Less than 0.1 plaque-forming units (PFU) of each virus and 75 fg or less of viral DNA were routinely detected. The PCR technique amplified correct product from 4 BHV-5 isolates and from 48 BHV-1 isolates, all from the United States, and did not amplify heterologous herpesviruses. The PCR technique was more sensitive than virus isolation in detection of BHV-1 or BHV-5 in nasal secretions from experimentally and naturally infected calves, and it detected BHV-1 or BHV-5 in trigeminal ganglia from these calves.

scholarly journals Grapevine red blotch-associated virus Is Widespread in the United States

2014 ◽  
Vol 104 (11) ◽  
pp. 1232-1240 ◽  
Author(s):  
B. Krenz ◽  
J. R. Thompson ◽  
H. L. McLane ◽  
M. Fuchs ◽  
K. L. Perry
Keyword(s):  
United States ◽  
Phylogenetic Analyses ◽  
The United States ◽  
Dna Viruses ◽  
Whole Genomes ◽  
The Family ◽  
Polymerase Chain ◽  
Highly Correlated ◽  
Clade 1 ◽  
Full Length Genome

Grapevine red blotch disease has been recognized since 2008 as affecting North American grape production. The presence of the newly described Grapevine red blotch-associated virus (GRBaV) is highly correlated with the disease. To more effectively detect and monitor the presence of the virus, a sample processing strategy and multiplex polymerase chain reaction assay were developed. A total of 42 of 113 vine samples collected in or received from seven of the United States were shown to harbor the virus, demonstrating the virus is widely distributed across North America. Phylogenetic analyses of a viral replication-associated protein (Rep) gene fragment from the 42 isolates of GRBaV demonstrated distinct clades of the virus (1 and 2), with clade 1 showing the greatest variability. The full-length genome of six virus isolates was sequenced, and phylogenetic analyses of 14 whole genomes recapitulated results seen for the Rep gene. A comparison of GRBaV genomes revealed evidence of recombination underlying some of the variation seen among GRBaV genomes within clade 1. Phylogenetic analyses of coat and replicase-associated protein sequences among single-stranded DNA viruses showed GRBaV to group within the family Geminiviridae. This grouping is distinct from members of the families Nanoviridae and Circoviridae, with limited significant affinities to both recognized genera and novel plant-infecting, gemini-like viruses.

Total RNA Extraction from Saccharomyces cerevisiae Using Hot Acid Phenol

2021 ◽  
Vol 2021 (12) ◽  
pp. pdb.prot101691
Author(s):  
Michael R. Green ◽  
Joseph Sambrook
Keyword(s):  
Blot Hybridization ◽  
Rna Extraction ◽  
Sodium Dodecyl ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Low Salt ◽  
Rigid Cell Wall ◽  
Polymerase Chain

Isolation of RNA from yeast is complicated by the need to first break the thick, rigid cell wall. The protocol provided here uses a cycle of heating and freezing of cells in the presence of phenol and the detergent sodium dodecyl sulfate (SDS). The extraction is performed in the presence of low salt so that, following separation of the aqueous and phenol phases by centrifugation, DNA can be collected from the interface while RNA remains in the aqueous phase. This protocol should yield ∼50–250 µg of RNA from 10 mL of culture. The RNA isolated using this approach is suitable for most follow-up applications such as northern blot hybridization, reverse transcriptase-polymerase chain reaction (RT-PCR), and cDNA construction.

scholarly journals Profiling Viral Infections in Grapevine Using a Randomly Primed Reverse Transcription-Polymerase Chain Reaction/Macroarray Multiplex Platform

2014 ◽  
Vol 104 (2) ◽  
pp. 211-219 ◽  
Author(s):  
J. R. Thompson ◽  
Marc Fuchs ◽  
Heather McLane ◽  
Fevziye Celebi-Toprak ◽  
Kael F. Fischer ◽  
...  
Keyword(s):  
Internal Control ◽  
Viral Infections ◽  
The United States ◽  
Rapid Diagnostics ◽  
Multiplex Detection ◽  
Virus Infections ◽  
Nylon Membrane ◽  
Certification Programs ◽  
The Family ◽  
Polymerase Chain

Crop-specific diagnostics to simultaneously detect a large number of pathogens provides an invaluable platform for the screening of vegetative material prior to its propagation. Here we report the use of what is to-date the largest published example of a crop-specific macroarray for the detection of 38 of the most prevalent or emergent viruses to infect grapevine. The reusable array consists of 1,578 virus-specific 60 to 70mer oligonucleotide probes and 19 plant and internal control probes spotted onto an 18 × 7 cm nylon membrane. In a survey of 99 grapevines from the United States and Europe, virus infections were detected in 46 selections of Vitis vinifera, V. labrusca, and interspecific hybrids. The majority of infected vines (30) was singly infected, while 16 were mixed-infected with viruses from two or more families. Representatives of the four main virus families Betaflexiviridae, Closteroviridae, Secoviridae, and Tymoviridae present in grapevines were found alone and in combination, with a notable bias in representation by members of the family Tymoviridae. This work demonstrates the utility of the macroarray platform for the multiplex detection of viruses in a single crop, its potential for characterizing grapevine virus associations, and usefulness for rapid diagnostics of introduced material in quarantine centers or in certification programs.

scholarly journals First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease ◽  
2004 ◽  
Vol 88 (5) ◽  
pp. 575-575 ◽  
Author(s):  
R. R. Martin ◽  
I. E. Tzanetakis ◽  
J. E. Barnes ◽  
J. F. Elmhirst
Keyword(s):  
British Columbia ◽  
Chenopodium Quinoa ◽  
The United States ◽  
Ringspot Virus ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
The Family ◽  
Polymerase Chain

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Breaking Free

2017 ◽  
Author(s):  
Deirdre David
Keyword(s):  
United States ◽  
The United States ◽  
The Novel ◽  
Male Homosexuality ◽  
Domestic Life ◽  
The Family

In the mid- to late 1950s, Pamela emerged as a critically acclaimed novelist, particularly after the family returned to London. In perhaps her best-known novel, The Unspeakable Skipton, she explores the life of a paranoid writer who sponges on English visitors to Bruges. The novel was hailed for its wit and sensitive depiction of the life of a writer. She also published a fine study of a London vicar martyred in marriage to a vain and selfish wife: The Humbler Creation is remarkable for its incisive and empathetic depiction of male despair. The Last Resort sealed her distinction as a brilliant novelist of domestic life in its frank depiction of male homosexuality. While continuing to publish fiction, Pamela maintained her reputation as a deft reviewer. In 1954, she and Charles travelled to the United States—the first of many trips that were to follow.

Sign in / Sign up

Export Citation Format

Share Document