First Report of Cladobotryum mycophilum Causing Cobweb on Cultivated King Oyster Mushroom in Spain

In 2010, symptoms of cobweb were observed on cultivated king oyster mushroom (Pleurotus eryngii) in Castilla-La Mancha (Spain) affecting 16% of the blocks of substrate cultivated. Cobweb appeared at the end of the crop cycle, first as small, white patches on the casing soil, subsequently spreading to the nearest king oyster mushroom by means of a fine gray-white mycelium, and eventually sporulating to produce masses of dry spores. The mycelium can quickly cover pinheads, stalks, pileus, and gills, eventually resulting in decomposition of the entire fruit body. Infected tissues of P. eryngii were plated onto potato dextrose agar (PDA) and the parasitic fungus was isolated. Fungal colonies consisted of abundant and cottony aerial mycelium spreading rapidly on PDA and red pigment spreading in the agar. Conidiogenous cells were 24 to 35 μm long, 3.5 to 5 μm wide basally, and tapered slightly to the tip. Conidia were cylindrical to narrowly ellipsoidal, 17 to 25 (-28) × 8 to 10 μm, and zero to three septate. Total DNA was extracted and the internal transcribed spacer (ITS) region of rDNA was amplified for one isolate using ITS1F/ITS4 primers (1,3). The amplicon was sequenced (GenBank Accession No. JF505112). BLAST analysis showed 100% similarity of the obtained ITS sequence with two sequences of Cladobotryum mycophilum (teleomorph Hypomyces odoratus) (GenBank Accession Nos. Y17096 and Y17095) (2). Pathogenicity tests were performed using 24 blocks containing sterilized, spawned, and incubated P. eryngii substrate (3.6 kg, 352 cm2 in area). The blocks were placed in a mushroom-growing room and cased with a 40-mm layer of a casing soil (0.7 liter block–1) made with mineral soil + Sphagnum peat 4:1 (vol/vol). Five days after casing, a conidial suspension (7 × 103 conidia ml–1) of one isolate of C. mycophilum was sprayed (5 ml per block) onto the surface of the casing layer at a rate of 106 conidia m–2. Twenty-two blocks were sprayed with sterile distilled water as a control. A temperature of 17 to 18°C and 85 to 90% relative humidity were maintained throughout cropping. The first cobweb symptoms developed 23 days after inoculation and C. mycophilum was consistently reisolated from nine (37.5%) of the inoculated blocks. Noninoculated blocks remained healthy. In a second test, conidial suspensions (3.4 × 105 conidia ml–1) of one isolate of C. mycophilum were inoculated onto 20 P. eryngii fruit bodies. Ten fruit bodies were inoculated externally while the other 10 fruit bodies were cut in half and inoculated internally with 50 μl of conidial suspension per fruit body. Sterilized distilled water was used as a control. All fruit bodies were then incubated at 22°C in a moist chamber. Assays were conducted twice and the results were recorded after 7 days. C. mycophilum grew on 85% of the internally inoculated fruit bodies and on 40% of those inoculated superficially, while the control mushrooms remained symptomless. To our knowledge, this is the first report of C. mycophilum causing cobweb in king oyster mushroom in Spain. This finding will have a potentially significant impact on button mushroom farms where cobweb is one of the most common diseases. References: (1) M. Gardes and T. D. Bruns. Mol. Ecol. 2:113, 1993. (2) G. J. McKay et al. Appl. Environ. Microbiol. 65:606, 1999. (3) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China

Plant Disease ◽

10.1094/pdis-02-12-0166-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 283-283

Author(s):

C. J. You ◽

C. M. Tian ◽

Y. M. Liang ◽

X. B. Dong ◽

C. Tsui

Keyword(s):

Pinus Sylvestris ◽

Early Stage ◽

Aerial Mycelium ◽

Its Region ◽

Distilled Water ◽

Academic Press ◽

Conidial Suspension ◽

Pitch Canker ◽

Canker Disease ◽

First Report

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 μm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 μm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 μl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Cobweb on White Button Mushroom (Agaricus bisporus) in Spain Caused by Cladobotryum mycophilum

Plant Disease ◽

10.1094/pdis-02-12-0120-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1067-1067 ◽

Cited By ~ 8

Author(s):

F. J. Gea ◽

M. J. Navarro ◽

J. Carrasco ◽

A. J. González ◽

L. M. Suz

Keyword(s):

Agaricus Bisporus ◽

Causal Agent ◽

Control Treatment ◽

Parasitic Fungus ◽

Conidial Suspension ◽

Fruiting Bodies ◽

Button Mushroom ◽

First Report ◽

White Button Mushroom ◽

La Mancha

Between 2008 and 2011, symptoms of cobweb were observed in commercial white button mushroom (Agaricus bisporus) crops in Castilla-La Mancha (Spain). Typical symptoms started as white, cobweb-like mycelial growth over the surface of the casing soils and fruiting bodies. Later, the mycelium changed to a grayish white, dense powder and the affected fruiting bodies turned pale yellow or reddish brown before rotting. Two types of cap spotting were observed, dark brown spots with a poorly defined edge and light brown spots. The first symptoms were commonly seen in the second or third break (flush) of mushrooms. Infected tissues of A. bisporus were plated onto potato dextrose agar (PDA) and a parasitic fungus was isolated. Fungal colonies consisted of abundant, cottony, aerial mycelium spreading rapidly over the PDA, and red pigment spreading into the agar. The cultures lacked a camphor odor. Conidiogenous cells were 24 to 45 μm long, 3 to 6 μm wide basally, and tapered slightly to the tip. Conidia were cylindrical to narrowly ellipsoidal, 15 to 28 × 8 to 11 μm, and zero- to three-septate. Total DNA was extracted and the internal transcribed spacer (ITS) region of rDNA amplified for one mycelial isolate using ITS1F/ITS4 primers (2,4). The amplicon was sequenced (GenBank Accession No. JQ004732). BLAST analysis showed highest similarity (99 and 100%) of the ITS sequence to four ITS sequences of Cladobotryum mycophilum (teleomorph Hypomyces odoratus) (GenBank Accession Nos. AB527074, JF505112, Y17095, and Y17096) (1,3) among other sequences of the same species. Two pathogenicity trials (A and B) were performed in mushroom-growing rooms, with 24 blocks in each assay containing pasteurized, spawned, and incubated A. bisporus substrate (10 kg, 0.15 m2). The blocks were cased with a 35-mm layer of a peat-based casing soil (5.5 liter/block). Nine days after casing, a conidial suspension (7.5 × 103 conidia/ml) of one isolate of C. mycophilum was sprayed (20 ml/block) onto the surface of the casing layer of 12 blocks at 106 conidia/m2. Twelve blocks were sprayed with sterile distilled water as a control treatment. Blocks were maintained at 17.5°C and 90% relative humidity. The first cobweb symptoms developed 25 days after inoculation, between the second and third breaks in trial A; and after 11 days, between the first and second breaks in trial B. C. mycophilum was consistently reisolated from eight inoculated blocks (67%) in trial A, and 11 inoculated blocks (92%) in trial B. The total area of the crop affected by cobweb was 30% in inoculated blocks in trial A and 45% in trial B. The noninoculated blocks remained healthy. Compared with the noninoculated control blocks, a 10.7% decrease in yield of mushrooms was observed in trial A and 9.1% in trial B. Previously, C. dendroides was the only known causal agent of cobweb in Spain. To our knowledge, this is the first report of C. mycophilum causing cobweb in white button mushroom in Spain, although the disease and causal agent were previously reported on cultivated king oyster mushroom (Pleurotus eryngii) in Spain (3). References: (3) C.-G. Back et al. J. Gen. Plant Pathol. 76:232, 2010. (1) M. Gardes and T. D. Bruns. Mol. Ecol. 2:113, 1993. (4) F. J. Gea et al. Plant Dis. 95:1030, 2011. (2) T. J. White et al. PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Pepper Fruit Rot Caused by Fusarium concentricum in China

Plant Disease ◽

10.1094/pdis-03-13-0325-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1657-1657 ◽

Cited By ~ 6

Author(s):

J. H. Wang ◽

Z. H. Feng ◽

Z. Han ◽

S. Q. Song ◽

S. H. Lin ◽

...

Keyword(s):

Fusarium Species ◽

Fruit Rot ◽

Post Inoculation ◽

Distilled Water ◽

Conidial Suspension ◽

Average Growth ◽

First Report ◽

Control Fruit ◽

Pepper Fruit ◽

Fruit Samples

Pepper (Capsicum annuum L.) is an important vegetable crop worldwide. Some Fusarium species can cause pepper fruit rot, leading to significant yield losses of pepper production and, for some Fusarium species, potential risk of mycotoxin contamination. A total of 106 diseased pepper fruit samples were collected from various pepper cultivars from seven provinces (Gansu, Hainan, Heilongjiang, Hunan, Shandong, Shanghai, and Zhejiang) in China during the 2012 growing season, where pepper production occurs on approximately 25,000 ha. Pepper fruit rot symptom incidence ranged from 5 to 20% in individual fields. Symptomatic fruit tissue was surface-sterilized in 0.1% HgCl2 for 1 min, dipped in 70% ethanol for 30 s, then rinsed in sterilized distilled water three times, dried, and plated in 90 mm diameter petri dishes containing potato dextrose agar (PDA). After incubation for 5 days at 28°C in the dark, putative Fusarium colonies were purified by single-sporing. Forty-three Fusarium strains were isolated and identified to species as described previously (1,2). Morphological characteristics of one strain were identical to those of F. concentricum. Aerial mycelium was reddish-white with an average growth rate of 4.2 to 4.3 mm/day at 25°C in the dark on PDA. Pigments in the agar were formed in alternating red and orange concentric rings. Microconidia were 0- to 1-septate, mostly 0-septate, and oval, obovoid to allantoid. Macroconidia were relatively slender with no significant curvature, 3- to 5-septate, with a beaked apical cell and a foot-shaped basal cell. To confirm the species identity, the partial TEF gene sequence (646 bp) was amplified and sequenced (GenBank Accession No. KC816735). A BLASTn search with TEF gene sequences in NCBI and the Fusarium ID databases revealed 99.7 and 100% sequence identity, respectively, to known TEF sequences of F. concentricum. Thus, both morphological and molecular criteria supported identification of the strain as F. concentricum. This strain was deposited as Accession MUCL 54697 (http://bccm.belspo.be/about/mucl.php). Pathogenicity of the strain was confirmed by inoculating 10 wounded, mature pepper fruits that had been harvested 70 days after planting the cultivar Zhongjiao-5 with a conidial suspension (1 × 106 spores/ml), as described previously (3). A control treatment consisted of inoculating 10 pepper fruits of the same cultivar with sterilized distilled water. The fruit were incubated at 25°C in a moist chamber, and the experiment was repeated independently in triplicate. Initially, green to dark brown lesions were observed on the outer surface of inoculated fruit. Typical soft-rot symptoms and lesions were observed on the inner wall when the fruit were cut open 10 days post-inoculation. Some infected seeds in the fruits were grayish-black and covered by mycelium, similar to the original fruit symptoms observed at the sampling sites. The control fruit remained healthy after 10 days of incubation. The same fungus was isolated from the inoculated infected fruit using the method described above, but no fungal growth was observed from the control fruit. To our knowledge, this is the first report of F. concentricum causing a pepper fruit rot. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (2) K. O'Donnell et al. Proc. Nat. Acad. Sci. USA 95:2044, 1998. (3) Y. Yang et al. 2011. Int. J. Food Microbiol. 151:150, 2011.

Download Full-text

First Report of Anthracnose of Papaya (Carica papaya L.) Caused by Colletotrichum siamense in China

Plant Disease ◽

10.1094/pdis-10-20-2154-pdn ◽

2021 ◽

Author(s):

Yujie Zhang ◽

Wenxiu Sun ◽

Ping Ning ◽

Tangxun Guo ◽

SuiPing Huang ◽

...

Keyword(s):

Carica Papaya ◽

Disease Incidence ◽

Aerial Mycelium ◽

Postharvest Disease ◽

Distilled Water ◽

First Report ◽

Surface Samples ◽

Initial Symptoms ◽

Colletotrichum Siamense ◽

Pathogenicity Tests

Papaya (Carica papaya L.) is a rosaceous plant widely grown in China, which is economically important. Anthracnose caused by Colletotrichum sp. is an important postharvest disease, which severely affects the quality of papaya fruits (Liu et al., 2019). During April 2020, some mature papaya fruits with typical anthracnose symptoms were observed in Fusui, Nanning, Guangxi, China with an average of 30% disease incidence (DI) and over 60% DI in some orchards. Initial symptoms of these papayas appeared as watery lesions, which turned dark brown, sunken, with a conidial mass appearing on the lesions under humid and warm conditions. The disease severity varied among fruits, with some showing tiny light brown spots, and some ripe fruits presenting brownish, rounded, necrotic and depressed lesions over part of their surface. Samples from two papaya plantations (107.54°E, 22.38°N) were collected, and brought to the laboratory. Symptomatic diseased tissues were cut into 5 × 5 mm pieces, surface sterilized with 2% (v/v) sodium hypochlorite for 1 minute, and rinsed three times with sterilized water. The pieces were then placed on potato dextrose agar (PDA). After incubation at 25°C in the dark for one week, colonies with uniform morphology were obtained. The aerial mycelium on PDA was white on top side, and concentric rings of salmon acervuli on the underside. A gelatinous layer of spores was observed on part of PDA plates after 7 days at 28°C. The conidia were elliptical, aseptate and hyaline (Zhang et al., 2020). The length and width of 60 conidia were measured for each of the two representative isolates, MG2-1 and MG3-1, and these averaged 13.10 × 5.11 μm and 14.45 × 5.95 μm. DNA was extracted from mycelia of these two isolates with the DNA secure Plant Kit (TIANGEN, Biotech, China). The internal transcribed spacer (ITS), partial actin (ACT), calmodulin (CAL), chitin synthase (CHS), β-tubulin 2 (TUB2) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) regions were amplified by PCR and sequenced. The sequences were deposited into GenBank with accessions MT904003, MT904004, and MT898650 to MT898659. BLASTN analyses against the GenBank database showed that they all had over 99% identity to the type strain of Colletotrichum siamense isolate ICMP 18642 (GenBank accession numbers JX010278, GQ856775, JX009709, GQ856730, JX010410, JX010019) (Weir et al., 2012). A phylogenetic tree based on the combined ITS, ACT, CAL, CHS, TUB2 and GAPDH sequences using the Neighbor-joining algorithm also showed that the isolates were C. siamense. Pathogenicity tests were conducted on 24 mature, healthy and surface-sterilized papaya fruits. On 12 papaya fruits, three well separated wounded sites were made for inoculation, and for each wounded site, six adjacent pinhole wounds were made in a 5-mm-diameter circular area using a sterilized needle. A 10 µl aliquot of 1 × 106 conidia/ml suspension of each of the isolates (MG2-1 and MG3-1) was inoculated into each wound. For each isolate, there were six replicate fruits. The control fruits were inoculated with sterile distilled water. The same inoculation was applied to 12 non-wound papaya fruits. Fruits were then placed in boxes which were first washed with 75% alcohol and lined with autoclaved filter paper moistened with sterilized distilled water to maintain high humidity. The boxes were then sealed and incubated at 28°C. After 10 days, all the inoculated fruits showed symptoms, while the fruits that were mock inoculated were without symptoms. Koch's postulates were fulfilled by re-isolation of C. siamense from diseased fruits. To our knowledge, this is the first report of C. siamense causing anthracnose of papaya in China. This finding will enable better control of anthracnose disease caused by C. siamense on papaya.

Download Full-text

First Report of Fusarium solani Causing Root Rot on Coptis chinensis in Southwestern China

Plant Disease ◽

10.1094/pdis-02-14-0164-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1273-1273 ◽

Cited By ~ 2

Author(s):

X.-M. Luo ◽

J.-L. Li ◽

J.-Y. Dong ◽

A.-P. Sui ◽

M.-L. Sheng ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Southwestern China ◽

Molecular Characteristics ◽

Distilled Water ◽

Conidial Suspension ◽

Storage Roots ◽

Coptis Chinensis ◽

Causal Organism ◽

First Report

China is the world's largest producer country of coptis (Coptis chinensis), the rhizomes of which are used in traditional Chinese medicine. Since 2008, however, root rot symptoms, including severe necrosis and wilting, have been observed on coptis plants in Chongqing, southwestern China. Of the plants examined from March 2011 to May 2013 in 27 fields, 15 to 30% were covered with black necrotic lesions. The leaves of infected plants showed wilt, necrotic lesions, drying, and death. The fibrous roots, storage roots, and rhizomes exhibited brown discoloration and progressive necrosis that caused mortality of the infected plants. Infected plants were analyzed to identify the causal organism. Discoloration of the internal vascular and cortical tissues of the rhizomes and taproots was also evident. Symptomatic taproots of the diseased coptis were surface sterilized in 1% sodium hypochlorite for 2 min, rinsed in sterile distilled water for 2 min, and then air-dried in sterilized atmosphere/laminar flow. Small pieces of disinfested tissue (0.3 cm in length) were transferred to petri dishes containing potato dextrose agar (PDA) supplemented with 125 μg ml–1 streptomycin sulfate and 100 μg ml–1 ampicillin, and incubated for 5 days at 25°C with a 12-h photoperiod. Four distinct species of fungal isolates (HL1 to 4) derived from single spores were isolated from 30 plants with root rot symptoms collected from the study sites. To verify the pathogenicity of individual isolates, healthy coptis plants were inoculated by dipping roots into a conidial suspension (106 conidia/ml) for 30 min (15 plants per isolate), as described previously (1). Inoculated plants were potted in a mixture of sterilized quartz sand-vermiculite-perlite (4:2:1, v/v) and incubated at 25/18°C and 85 to 90% relative humidity (day/night) in a growth chamber with a daily 16-h photoperiod of fluorescent light. Plants dipped in sterile distilled water were used as controls. After 15 days, symptoms similar to those observed in the field were observed on all plants (n = 15) that were inoculated with HL1, but symptoms were not observed on plants inoculated with HL2, HL3, and HL4, nor on control plants. HL1 was re-isolated from symptomatic plants but not from any other plants. Morphological characterization of HL1 was performed by microscopic examination. The septate hyphae, blunt microconidia (2 to 3 septa) in the foot cell and slightly curved microconidia in the apical cell, and chlamydospores were consistent with descriptions of Fusarium solani (2). The pathogen was confirmed to be F. solani by amplification and sequencing of the ribosomal DNA internal transcribed spacer (rDNA-ITS) using the universal primer pair ITS4 and ITS5. Sequencing of the PCR product revealed a 99 to 100% similarity with the ITS sequences of F. solani in GenBank (JQ724444.1 and EU273504.1). Phylogenetic analysis (MEGA 5.1) using the neighbor-joining algorithm placed the HL1 isolate in a well-supported cluster (97% bootstrap value based on 1,000 replicates) with JQ724444.1 and EU273504.1. The pathogen was thus identified as F. solani based on its morphological and molecular characteristics. To our knowledge, this is the first report of root rot of coptis caused by F. solani in the world. References: (1) K. Dobinson et al. Can. J. Plant Pathol. 18:55, 1996. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, 2006.

Download Full-text

First Report of Diaporthe hongkongensis Causing Fruit rot on Peach (Prunus persica) in China

Plant Disease ◽

10.1094/pdis-07-20-1505-pdn ◽

2021 ◽

Author(s):

Zhou Zhang ◽

Zheng Bing Zhang ◽

Yuan Tai Huang ◽

FeiXiang Wang ◽

Wei Hua Hu ◽

...

Keyword(s):

Prunus Persica ◽

Fruit Rot ◽

Hunan Province ◽

Post Inoculation ◽

Distilled Water ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Representative Isolate ◽

Rot Disease

Peach [Prunus persica (L.) Batsch] is an important deciduous fruit tree in the family Rosaceae and is a widely grown fruit in China (Verde et al., 2013). In July and August 2018, a fruit rot disease was observed in a few peach orchards in Zhuzhou city, the Hunan Province of China. Approximately 30% of the fruit in more than 400 trees was affected. Symptoms displayed were brown necrotic spots that expanded, coalesced, and lead to fruit being rotten. Symptomatic tissues excised from the margins of lesions were surface sterilized in 70% ethanol for 10 s, 0.1% HgCl2 for 2 min, rinsed with sterile distilled water three times, and incubated on potato dextrose agar (PDA) at 26°C in the dark. Fungal colonies with similar morphology developed, and eight fungal colonies were isolated for further identification. Colonies grown on PDA were grayish-white with white aerial mycelium. After an incubation period of approximately 3 weeks, pycnidia developed and produced α-conidia and β-conidia. The α-conidia were one-celled, hyaline, fusiform, and ranged in size from 6.0 to 8.4 × 2.1 to 3.1 μm, whereas the β-conidia were filiform, hamate, and 15.0 to 27.0 × 0.8 to 1.6 μm. For molecular identification, total genomic DNA was extracted from the mycelium of a representative isolate HT-1 and the internal transcribed spacer region (ITS), β-tubulin gene (TUB), translation elongation factor 1-α gene (TEF1), calmodulin (CAL), and histone H3 gene (HIS) were amplified and sequenced (Meng et al. 2018). The ITS, TUB, TEF1, CAL and HIS sequences (GenBank accession nos. MT740484, MT749776, MT749778, MT749777, and MT749779, respectively) were obtained and in analysis by BLAST against sequences in NCBI GenBank, showed 99.37 to 100% identity with D. hongkongensis or D. lithocarpus (the synonym of D. hongkongensis) (Gao et al., 2016) (GenBank accession nos. MG832540.1 for ITS, LT601561.1 for TUB, KJ490551.1 for HIS, KY433566.1 for TEF1, and MK442962.1 for CAL). Pathogenicity tests were performed on peach fruits by inoculation of mycelial plugs and conidial suspensions. In one set, 0.5 mm diameter mycelial discs, which were obtained from an actively growing representative isolate of the fungus on PDA, were placed individually on the surface of each fruit. Sterile agar plugs were used as controls. In another set, each of the fruits was inoculated by application of 1 ml conidial suspension (105 conidia/ml) by a spray bottle. Control assays were carried out with sterile distilled water. All treatments were maintained in humid chambers at 26°C with a 12-h photoperiod. The inoculation tests were conducted twice, with each one having three fruits as replications. Six days post-inoculation, symptoms of fruit rot were observed on inoculated fruits, whereas no symptoms developed on fruits treated with agar plugs and sterile water. The fungus was re-isolated and identified to be D. hongkongensis by morphological and molecular methods, thus fulfilling Koch’s Postulates. This fungus has been reported to cause fruit rot on kiwifruit (Li et al. 2016) and is also known to cause peach tree dieback in China (Dissanayake et al. 2017). However, to our knowledge, this is the first report of D. hongkongensis causing peach fruit rot disease in China. The identification of the pathogen will provide important information for growers to manage this disease.

Download Full-text

First Report of Curvularia aeria on Etlingera linguiformis from Nagaland, India

Plant Disease ◽

10.1094/pdis-01-14-0060-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1580-1580 ◽

Cited By ~ 2

Author(s):

C. Kithan ◽

L. Daiho

Keyword(s):

Leaf Surface ◽

Agricultural Research ◽

Disease Incidence ◽

Indian Agricultural Research Institute ◽

Mountain Range ◽

Pathogenicity Test ◽

Distilled Water ◽

Conidial Suspension ◽

First Report ◽

Initial Symptoms

Etlingera linguiformis (Roxb.) R.M.Sm. of Zingiberaceae family is an important indigenous medicinal and aromatic plant of Nagaland, India, that grows well in warm climates with loamy soil rich in humus (1). The plant rhizome has medicinal benefits in treating sore throats, stomachache, rheumatism, and respiratory complaints, while its essential oil is used in perfumery. A severe disease incidence of leaf blight was observed on the foliar portion of E. linguiformis at the Patkai mountain range of northeast India in September 2012. Initial symptoms of the disease are small brown water soaked flecks appearing on the upper leaf surface with diameter ranging from 0.5 to 3 cm, which later coalesced to form dark brown lesions with a well-defined border. Lesions often merged to form large necrotic areas, covering more than 90% of the leaf surface, which contributed to plant death. The disease significantly reduces the number of functional leaves. As disease progresses, stems and rhizomes were also affected, reducing quality and yield. The diseased leaf tissues were surface sterilized with 0.2% sodium hypochlorite for 2 min followed by rinsing in sterile distilled water and transferred into potato dextrose agar (PDA) medium. After 3 days, the growing tips of the mycelium were transferred to PDA slants and incubated at 25 ± 2°C until conidia formation. Fungal colonies on PDA were dark gray to dark brown, usually zonate; stromata regularly and abundantly formed in culture. Conidia were straight to curved, ellipsoidal, 3-septate, rarely 4-septate, middle cells broad and darker than other two end cells, middle septum not median, smooth, 18 to 32 × 8 to 16 μm (mean 25.15 × 12.10 μm). Conidiophores were terminal and lateral on hyphae and stromata, simple or branched, straight or flexuous, often geniculate, septate, pale brown to brown, smooth, and up to 800 μm thick (2,3). Pathogen identification was performed by the Indian Type Culture Collection, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi (ITCC Accession No. 7895.10). Further molecular identity of the pathogen was confirmed as Curvularia aeria by PCR amplification and sequencing of the internal transcribed spacer (ITS) regions of the ribosomal DNA by using primers ITS4 and ITS5 (4). The sequence was submitted to GenBank (Accession No. MTCC11875). BLAST analysis of the fungal sequence showed 100% nucleotide similarity with Cochliobolus lunatus and Curvularia aeria. Pathogenicity tests were performed by spraying with an aqueous conidial suspension (1 × 106 conidia /ml) on leaves of three healthy Etlingera plants. Three plants sprayed with sterile distilled water served as controls. The first foliar lesions developed on leaves 7 days after inoculation and after 10 to 12 days, 80% of the leaves were severely infected. Control plants remained healthy. The inoculated leaves developed similar blight symptoms to those observed on naturally infected leaves. C. aeria was re-isolated from the inoculated leaves, thus fulfilling Koch's postulates. The pathogenicity test was repeated twice. To our knowledge, this is the first report of the presence of C. aeria on E. linguiformis. References: (1) M. H. Arafat et al. Pharm. J. 16:33, 2013. (2) M. B. Ellis. Dematiaceous Hyphomycetes. CMI, Kew, Surrey, UK, 1971. (3) K. J. Martin and P. T. Rygiewicz. BMC Microbiol. 5:28, 2005. (4) C. V. Suberamanian. Proc. Indian Acad. Sci. 38:27, 1955.

Download Full-text

First report of Fusarium incarnatum causing spikelet rot on rice in China

Plant Disease ◽

10.1094/pdis-12-20-2660-pdn ◽

2021 ◽

Author(s):

Ling Wang ◽

S. L. Ge ◽

Kehan Zhao ◽

huang Shiwen

Keyword(s):

Natural Science ◽

Disease Incidence ◽

Science And Technology ◽

Agricultural Science ◽

Zhejiang Province ◽

Maturity Stage ◽

Post Inoculation ◽

Distilled Water ◽

Conidial Suspension ◽

First Report

Rice (Oryza sativa L.) is the most important and widely grown crop, covering about 29.9 million ha of total cultivation area in China. In the last decade, spikelet rot disease on rice became much more frequent in the middle and lower reaches of the Yangtze River, China. Fusarium proliferatum (Matsush.) Nirenberg ex Gerlach & Nirenberg was reported to be a causal agent of spikelet rot on rice in Hangzhou, Zhejiang province (Huang et al. 2012). In September 2019, a survey was conducted to understand the etiology of the disease in the main rice growing regions of Jinshan District of Shanghai. Symptomatic panicles exhibiting reddish or brown discoloration on the glumes were collected from different rice fields, where disease incidence was estimated to be between 20 to 80%. Diseased glumes were cut into small sections (5 × 5 mm) from the boundary of necrotic and healthy tissues, surface-sterilized with 75% ethanol for 30 s and 3% sodium hypochlorite for 90 s, rinsed twice with sterile distilled water, then placed onto 1/5 strength potato dextrose agar (PDA). After 3 to 5 days of incubation at 28°C in the dark, fungal growth with Fusarium-like colonies were transferred to PDA and purified by the single-spore isolation method. A total of 12 isolates were obtained and colonies showed loosely floccose, white mycelium and pale-yellow pigmentation on PDA. Microconidia were ovoid mostly with 0 to 1 septum, and measured 4.2 to 16.6 × 2.5 to 4.1 μm (n = 50). After 5-7 days of inoculation on carnation leaf agar (CLA), macroconidia produced usually had 3 to 5 septa, slightly curved at the apex, ranging from 15.7 to 39.1 × 3.3 to 5.0 μm (n = 50). Chlamydospores were produced in hyphae, most often solitary in short chains or in clumps, ellipsoidal or subglobose with thick and roughened walls. Molecular identification was performed on the representative isolates (JS3, JS9, and JS21). The rDNA internal transcribed spacer (ITS), translation elongation factor (TEF-1α) and β-tubulin (β-TUB) genes were amplified and sequenced using the paired primers ITS1/ITS4 (White et al. 1990), EF1/EF2 (O’Donnell et al. 1998) and T1/T22 (O’Donnell and Cigelnik 1997), respectively. The obtained sequences were deposited in GenBank under accession numbers MT889972 to MT889974 (ITS), MT895844 to MT895846 (TEF-1α), and MT895841 to MT895843 (β-TUB), respectively. BLASTn search of the sequences revealed 99 to 100% identity with ITS (MF356578), TEF-1α (HM770725) and β-TUB (GQ915444) of Fusarium incarnatum isolates. FUSARIUM-ID (Geiser et al. 2004) analysis showed 99 to 100% similarity with sequences of the F. incarnatum-equiseti species complex (FIESC) (FD_01651 and FD_01628). In addition, a phylogenetic analysis based on the concatenated nucleotide sequences placed the isolates in the F. incarnatum clade at 100% bootstrap support. Thus, both morphological observations and molecular criteria supported identification of the isolates as F. incarnatum (Desm.) Sacc (synonym: Fusarium semitectum) (Leslie and Summerell 2006, Nirenberg 1990). Pathogenicity tests were performed on susceptible rice cultivar ‘Xiushui134’. At pollen cell maturity stage, a 2-ml conidial suspension (5 × 105 macroconidia/ml) of each isolate was injected into 10 rice panicles. Control plants were inoculated with sterile distilled water. Then, the pots were kept in a growth chamber at 28°C, 80% relative humidity, and 12 h/12 h light (10,000 lux)/dark. The experiment was repeated two times for each isolate. Two weeks post-inoculation, all inoculated panicles showed similar symptoms with the original samples, whereas no symptoms were observed on the control. The pathogen was re-isolated from inoculated panicles and identified by the method described above to fulfill Koch's postulates. Previous studies reported that F. incarnatum reproduced perithecia to overwinter on rice stubble as the inoculum of Fusarium head blight of wheat in southern China (Yang et al. 2018). To our knowledge, this is the first report of spikelet rot on rice caused by F. incarnatum in China. Further investigation is needed to gain a better understanding its potential geographic distribution of this new pathogen on rice crop. References: (1) Huang, S. W., et al. 2011. Crop Prot. 30: 10. (2) White, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. (3) O’Donnell, K., et al. 1998. Proc. Natl. Acad. Sci. U.S.A. 95: 2044. (4) O'Donnell, K., Cigelnik, E. 1997. Mol. Phylogenet. Evol. 7: 103. (5) Geiser, D. M., et al. 2004. Eur. J. Plant Pathol. 110: 473. (6) Leslie, J. F., and Summerell, B. A. 2006. The Fusarium Laboratory Manual. Blackwell, Ames, IA. (7) Nirenberg, H. I. 1990. Stud. Mycol. 32: 91. (8) Yang, M. X., et al. 2018. Toxins. 10: 115. The author(s) declare no conflict of interest. Funding: Funding was provided by National Natural Science Foundation of China (grant no. 31800133), Zhejiang Provincial Natural Science Foundation of China (grant no. LQ18C140005), Key Research and Development Program of Zhejiang Province (grant no. 2019C02018), Shanghai Science and Technology for Agriculture Promotion Project (2019-02-08-00-08-F01127), and the Agricultural Science and Technology Innovation Program of China Academy of Agricultural Science (CAAS-ASTIP-2013- CNRRI).

Download Full-text

First Report of Tuber Rot Disease of Kala Zeera Caused by a Member of the Fusarium solani Species Complex in India

Plant Disease ◽

10.1094/pdis-02-12-0148-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1067-1067 ◽

Cited By ~ 1

Author(s):

V. Gupta ◽

D. John ◽

V. K. Razdan ◽

S. K. Gupta

Keyword(s):

Fusarium Solani ◽

Species Complex ◽

Morphological Characteristics ◽

Distilled Water ◽

Conidial Suspension ◽

Potato Dextrose Broth ◽

First Report ◽

Fusarium Solani Species Complex ◽

Rot Disease ◽

Tuber Rot

Bunium persicum (Kala zeera, also black cumin) is an economically important culinary crop that is cultivated for its seed pods and its tuberlike roots. In India, high-altitude regions of Himachal Pradesh, including the Padder valley and the Gurez area of Jammu and Kashmir, are areas of kalazeera production (3). In 2008 to 2009, tuber rot disease of kala zeera was observed during the late spring season in the Padder valley. Symptomatic plants were distributed in localized areas in the field and the symptoms included drying of foliage and rotting of tubers. White mycelia were found on the tubers at the late stages of disease development. Incidence of infection in the surveyed area was 80 to 90%. Yield losses were 50 to 60%. To isolate the causal pathogen, we cultured tissues from symptomatic tubers. Small bits of the infected tissue were surface disinfested in 0.1% mercuric chloride, followed by rinsing three times in sterile distilled water. The surface disinfested tissues were plated on potato dextrose agar (PDA) and incubated at 27°C for 4 days. Pure cultures of the mycelium from the diseased tissues were transferred to a second set of PDA for species identification. The fungus produced three types of spores: small, one-celled, oval microconidia; large, slightly curved, septate macroconidia; and rounded, thick-walled chlamydospores. Microconidia were mostly non-septate and 8.91 to 15.73 × 2.3 to 3.5 μm, whereas macroconidia were three- to five-septate and were 35.55 to 54.74 × 3.91 to 6.5 μm. On the basis of morphological characteristics (1), the fungus was identified and deposited as a member of the Fusarium solani species complex in the Indian Type Culture Collection, New Delhi (ID No. 8422.11). To confirm pathogenicity, healthy tubers were submerged for 20 min in a conidial suspension of the isolated fungus (1 × 105 cfu/ml), which was prepared in potato dextrose broth, incubated for 10 days at 27°C, and centrifuged at 140 rpm. Noninoculated controls were submerged in distilled water. Inoculated and control tubers were then planted in separate pots filled with sterilized soil and kept in a shade house. Symptoms appeared on inoculated tubers 9 to 10 days after planting. Signs of the pathogen in the form of mycelia were present. The tubers rotted and died 12 to 15 days after inoculation. Control tubers did not display any symptoms. F. solani species complex was reisolated from inoculated tubers, fulfilling Koch's postulates. F. solani has been reported to cause corm rot on gladiolus and saffron (2). To our knowledge, this is the first report of the F. solani species complex as pathogenic to tubers of kalazeera in India. References: (1) C. Booth. The Genus Fusarium. 47, 1971. (2) L. Z. Chen et al. J. Shanghai Agric. College 12:240, 1994. (3) K. S. Panwar et al. Agriculture Situation in India. 48:151, 1993.

Download Full-text

First report of Trichoderma afroharzianum causing seed rot on maize in Italy

Plant Disease ◽

10.1094/pdis-12-21-2697-pdn ◽

2022 ◽

Author(s):

Martina Sanna ◽

Massimo Pugliese ◽

Maria Lodovica GULLINO ◽

Monica Mezzalama

Keyword(s):

Rna Polymerase Ii ◽

Elongation Factor ◽

Aerial Mycelium ◽

Light Cycle ◽

Conidial Suspension ◽

Ear Rot ◽

Trichoderma Spp ◽

Trichoderma Species ◽

First Report ◽

Pathogenicity Tests

Maize (Zea mays L.) is a cereal crop of great economic importance in Italy; production is currently of 60,602,320 t, covering 588,597 ha (ISTAT 2021). Trichoderma species are widespread filamentous fungi in soil, well known and studied as biological control agents (Vinale et al., 2008). Seeds of a yellow grain hybrid (class FAO 700, 132 days) were collected in September 2020 from an experimental field located in Carmagnola (TO, Italy: GPS: 44°53'11.0"N 7°40'60.0"E) and tested with blotter test (Warham et al., 1996) to assess their phytosanitary condition. Over the 400 seeds tested, more than 50% showed rotting and development of green mycelium typical of the genus Trichoderma. Due to the high and unexpected percentage of decaying kernels, ten colonies were identified by morphological and molecular methods. Single conidia colonies of one Trichoderma (T5.1) strain were cultured on Potato Dextrose Agar (PDA) for pathogenicity tests, and on PDA and Synthetic Nutrient-Poor Agar (SNA) for morphological and molecular identification. The colonies grown on PDA and SNA showed green, abundant, cottony, and radiating aerial mycelium, and yellow pigmentation on the reverse. Colony radius after 72 h at 30°C was of 60-65 mm on PDA and of 50-55 mm on SNA. The isolates produced one cell conidia 2.8 - 3.8 µm long and 2.1 - 3.6 µm wide (n=50) on SNA. Conidiophores and phialides were lageniform to ampulliform and measured 4.5 – 9.7 µm long and 1.6 – 3.6 µm wide (n=50); the base measure 1.5 – 2.9 µm wide and the supporting cell 1.4 – 2.8 µm wide (n=50). The identity of one single-conidia strain was confirmed by sequence comparison of the internal transcribed spacer (ITS), the translation elongation factor-1α (tef-1α), and RNA polymerase II subunit (rpb2) gene fragments (Oskiera et al., 2015). BLASTn searches of GenBank using ITS (OL691534) the partial tef-1α (OL743117) and rpb2 (OL743116) sequences of the representative isolate T5.1, revealed 100% identity for rpb2 to T. afroharzianum TRS835 (KP009149) and 100% identity for tef-1α to T. afroharzianum Z19 (KR911897). Pathogenicity tests were carried out by suspending conidia from a 14-days old culture on PDA in sterile H2O to 1×106 CFU/ml. Twenty-five seeds were sown in pots filled with a steamed mix of white peat and perlite, 80:20 v/v, and maintained at 23°C under a seasonal day/night light cycle. Twenty primary ears were inoculated, by injection into the silk channel, with 1 ml of a conidial suspension of strain T5.1 seven days after silk channel emergence (BBCH 65) (Pfordt et al., 2020). Ears were removed four weeks after inoculation and disease severity, reaching up to 75% of the kernels of the twenty cobs, was assessed visually according to the EPPO guidelines (EPPO, 2015). Five control cobs, inoculated with 1 ml of sterile distilled water were healthy. T. afroharzianum was reisolated from kernels showing a green mold developing on their surface and identified by resequencing of tef-1α gene. T. afroharzianum has been already reported on maize in Germany and France as causal agent of ear rot of maize (Pfordt et al. 2020). Although several species of Trichoderma are known to be beneficial microorganisms, our results support other findings that report Trichoderma spp. causing ear rot on maize in tropical and subtropical areas of the world (Munkvold and White, 2016). The potential production of mycotoxins and the losses that can be caused by the pathogen during post-harvest need to be explored. To our knowledge this is the first report of T. afroharzianum as a pathogen of maize in Italy.

Download Full-text