scholarly journals First Report of Bacterial Stalk Rot of Maize Caused by Dickeya zeae in Mexico

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1267-1267 ◽  
Author(s):  
B. A. Martinez-Cisneros ◽  
G. Juarez-Lopez ◽  
N. Valencia-Torres ◽  
E. Duran-Peralta ◽  
M. Mezzalama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
The State ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Sterile Water ◽  
First Report ◽  
Stalk Rot ◽  
Positive Controls

A bacterial disease of maize, bacterial stalk and top rot, was found in the state of Morelos in February 2011, and in the state of Puebla in July 2013, Mexico. In both cases, the incidence of diseased plants was lower than 0.5%. The typical symptoms were a soft rot and darkening of the tissues affecting the stalk and the top of the plant, causing breaking of the stalk. The lesions progressed from the top to below nodes, leaf sheaths and blades, and rotten tissues emitted an unpleasant odor. Eleven diseased plants were collected, and bacterial colonies were isolated from fragments detached from the edges of symptomatic tissues after sterilization with a 0.5% solution of NaClO for 30 s, rinsing three times in sterile water. The sterilized fragments were macerated in drops of distilled sterile water for 10 min and the extract was streaked on King's medium B (agar 15 g, distilled water 1,000 ml, proteose peptone 20 g, K2HPO4 1.5 g, MgSO4·7H2O 1.5 g, glycerol 10 ml). Eight representative strains from Morelos and five from Puebla were selected for identification. All strains were gram-negative, grew at 37°C, showed pectynolitic activity on potato tubers, were positive for indole production, utilized arabinose, galactose, glucose, glycerol, lactose, mannose, melibiose, rafinose, ribose, and sucrose but did not produce acid from arabitol, adonitol, and keto-methyl-glucoside (3,4). Pathogenicity tests were conducted with each strain by inoculating with a syringe four 25-day-old maize seedlings with 107 CFU ml–1 bacterial cells in the leaf collar. Plants were incubated in the greenhouse at 30°C during the day and 24°C during the night with a 12-h photoperiod, and relative humidity of 93%. The reference strains Erwinia chrysanthemi pv zeae ATTC29942 and Dickeya zeae CFBP 2052 were used as positive controls in laboratory and greenhouses tests. Sterile water was used as negative control. Two days after inoculation, soft stalk rot symptoms developed that were identical to those observed in the field. No symptoms were observed on the negative controls. Diagnostic amplification of DNA by conventional PCR was carried out and yielded the expected amplicon size of 420 bp of the Dickeya-specific pel gene with the ADE primers set (2). PCR was used to amplify the 16S rRNA gene with the universal primers 27f and 1495r (5) for molecular identification of the 13 strains (GenBank Accession Nos. KJ438941, KJ438942, KJ438943, KJ438944, KJ438945, KJ438946, KJ438947, KJ438948, KJ438949, KJ438950, KJ438951, KJ438952, and KJ438953). The strains D. zeae CFBP 2052 and E. chrysanthemi pv. zeae ATCC 29942 were sequenced as positive controls. A BLAST search with the 13 16S rRNA gene sequences of 1.4 kb were 99% identical to the sequence of D. zeae CFBP 2052 (NR_041923). D. zeae can be a major disease of maize in tropical and subtropical countries. It is particularly severe under conditions of high temperature and high humidity, but it occurs sporadically. Control of the vector, Chilo partellus, can aid disease management (1). To our knowledge, this is the first report of D. zeae causing maize stalk rot in Mexico. References: (1) CABI. Crop Prot. Compend. CAB International, Wallingford, UK, 2014. (2) A. Nassar et al. Appl. Environ. Microbiol. 62:2228, 1996. (3) R. Samson et al. Int. J. Syst. Evol. Microbiol. 55:1415, 2005. (4) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. APS Press, St. Paul, MN, 2001. (5) W. G. Weisburg. J. Bacteriol. 173:697, 1991.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals First Report of Bud Soft Rot on Agave angustifolia Caused by Pantoea dispersa in Mexico

Plant Disease ◽  
2021 ◽  
Author(s):  
FRANCISCO PALEMON ◽  
Santo Angel Ortega-Acosta ◽  
Santiago Dominguez-Monge ◽  
Alvaro Castañeda-Vildozola ◽  
Guadalupe Reyes-Garcia ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Soft Rot ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Sterile Water ◽  
First Report ◽  
Agave Angustifolia ◽  
Pantoea Dispersa ◽  
Initial Symptoms

The agave (Agave spp.) is an important crop in México, with 120,897 ha grown mainly for alcoholic beverage production (SIAP, 2019). In September 2020, in the municipality of Huitzuco de los Figueroa (18.328692 N; 99.3998 W), Guerrero State, México, a serious disease was observed affecting Agave angustifolia. Disease incidence was 8% of 150 plants sampled over an approximate area of 2.5 ha. Initial symptoms of soft rot of the bud developed and produced an abundant exudate which appeared from the apical part to the base of the plant. In severe infections, the plants showed total maceration of the bud, and consequently death of the plants was observed. Symptomatic plant tissue was superficially disinfected with 1% NaOCl for 30 s, and rinsed in sterile water three times. The disinfected tissues were macerated and with a loop spread in Nutrient Agar. The plates were incubated at 28 ° C for 2 days. Yellowish bacterial colonies were isolated, and eight colonies were selected for characterization. The bacterial strains were gram negative and rod-shaped, negative for fluorescent pigment tests and Kovacs' oxidase. Two isolates designated AGA1 and AGA2 were identified by PCR amplification and sequencing of the partial 16S rRNA gene with the primer 27F / 1492R (Lane 1991), and partial fusA, rpoB, and gyrB genes (Delétoile et al. 2009). Sequences were deposited in GenBank, with the accession numbers for 16S rRNA, AGA1 as MW548406 and AGA2 as MW548407; for specific genes fusA (AGA1 = MW558445, AGA2 = MW558446), rpoB (AGA1 = MW558447, AGA2 = MW558448) and gyrB (AGA1 = MW558449, AGA2 = MW558450), and they were compared with the sequences available in GenBank using BLASTn. 16S rRNA gene sequences for AGA1 and AGA2 aligned with Pantoea dispersa (MT921704.1, 99.9% identity). Housekeeping genes also aligned 99 to 100% to P. dispersa (fusA = 100%, CP045216.1; rpoB = 99.8% MH015167.1 and gyrB = 99%, MK928270.1). Phylogenetic analysis of concatenated genes showed that strains AGA1 and AGA2 cluster with P. dispersa. To confirm pathogenicity, eight plants of six-month-old A. angustifolia were inoculated with strain AGA1 using sterile toothpicks dipped in 108 CFU/ml bacterial suspension. The toothpicks were inserted in the middle part of the bud. Four plants were inoculated with sterile water as control. The plants were covered with plastic bags and housed in a greenhouse (average temperature and relative humidity of 25 ° C and 85%, respectively). Pathogenicity tests were repeated two times. After seven days, all inoculated plants developed symptoms similar to those observed in the field. Control plants did not show symptoms. From the plants that showed symptoms, the pathogen was reisolated again and was identified by morphological and molecular characterization, following the method previously described, fulfilling Koch's postulates. In México, Erwinia cacticida and Pantoea ananatis has been previously reported on A. tequilana that as causing soft rot and red leaf ring, respectively (Jimenez-Hidalgo et al. 2004; Fucikovsky and Aranda 2006). To our knowledge, this is the first report of P. dispersa causing bud soft rot on A. angustifolia in México. More studies monitoring and control strategies of bud soft rot on A. angustifolia are required.

Marine mammals are natural hosts of Oceanivirga salmonicida, a bacterial pathogen of Atlantic salmon

2020 ◽  
Vol 139 ◽  
pp. 161-174
Author(s):  
R Palmer ◽  
GTA Fleming ◽  
S Glaeser ◽  
T Semmler ◽  
A Flamm ◽  
...  
Keyword(s):  
16S Rrna ◽  
Atlantic Salmon ◽  
16S Rrna Gene ◽  
Marine Mammals ◽  
Rrna Gene ◽  
Bacterial Disease ◽  
Common Dolphin ◽  
Stenella Coeruleoalba ◽  
Striped Dolphin ◽  
Natural Hosts

During 1992 and 1993, a bacterial disease occurred in a seawater Atlantic salmon Salmo salar farm, causing serious mortalities. The causative agent was subsequently named as Oceanivirga salmonicida, a member of the Leptotrichiaceae. Searches of 16S rRNA gene sequence databases have shown sequence similarities between O. salmonicida and uncultured bacterial clones from the digestive tracts of marine mammals. In the current study, oral samples were taken from stranded dolphins (common dolphin Delphinus delphis, striped dolphin Stenella coeruleoalba) and healthy harbour seals Phoca vitulina. A bacterium with growth characteristics consistent with O. salmonicida was isolated from a common dolphin. The isolate was confirmed as O. salmonicida, by comparisons to the type strain, using 16S rRNA gene, gyrB, groEL, and recA sequence analyses, average nucleotide identity analysis, and MALDI-TOF mass spectrometry. Metagenomic analysis indicated that the genus Oceanivirga represented a significant component of the oral bacterial microbiomes of the dolphins and seals. However, sequences consistent with O. salmonicida were only found in the dolphin samples. Analyses of marine mammal microbiome studies in the NCBI databases showed sequences consistent with O. salmonicida from the common dolphin, striped dolphin, bottlenose dolphin Tursiops truncatus, humpback whale Megaptera novaeangliae, and harbour seal. Sequences from marine environmental studies in the NCBI databases showed no sequences consistent with O. salmonicida. The findings suggest that several species of marine mammals are natural hosts of O. salmonicida.

scholarly journals Apis andreniformis associated Actinomycetes show antimicrobial activity against black rot pathogen (Xanthomonas campestris pv. campestris)

PeerJ ◽  
2021 ◽  
Vol 9 ◽  
pp. e12097
Author(s):  
Yaowanoot Promnuan ◽  
Saran Promsai ◽  
Wasu Pathom-aree ◽  
Sujinan Meelai
Keyword(s):  
Antimicrobial Activity ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Honey Bee ◽  
Pseudomonas Syringae ◽  
Xanthomonas Campestris ◽  
Pathogenic Bacteria ◽  
Rrna Gene ◽  
Apis Andreniformis

This study aimed to investigate cultivable actinomycetes associated with rare honey bee species in Thailand and their antagonistic activity against plant pathogenic bacteria. Actinomycetes were selectively isolated from the black dwarf honey bee (Apis andreniformis). A total of 64 actinomycete isolates were obtained with Streptomyces as the predominant genus (84.4%) followed by Micromonospora (7.8%), Nonomuraea (4.7%) and Actinomadura (3.1%). All isolates were screened for antimicrobial activity against Xanthomonas campestris pv. campestris, Pectobacterium carotovorum and Pseudomonas syringae pv. sesame. Three isolates inhibited the growth of X. campestris pv. campestris during in vitro screening. The crude extracts of two isolates (ASC3-2 and ASC5-7P) had a minimum inhibitory concentration (MIC) of 128 mg L−1against X. campestris pv. campestris. For isolate ACZ2-27, its crude extract showed stronger inhibitory effect with a lower MIC value of 64 mg L−1 against X. campestris pv. campestris. These three active isolates were identified as members of the genus Streptomyces based on their 16S rRNA gene sequences. Phylogenetic analysis based on the maximum likelihood algorithm showed that isolate ACZ2-27, ASC3-2 and ASC5-7P were closely related to Streptomyces misionensis NBRC 13063T (99.71%), Streptomyces cacaoi subsp. cacaoi NBRC 12748T (100%) and Streptomyces puniceus NBRC 12811T (100%), respectively. In addition, representative isolates from non-Streptomyces groups were identified by 16S rRNA gene sequence analysis. High similarities were found with members of the genera Actinomadura, Micromonospora and Nonomuraea. Our study provides evidence of actinomycetes associated with the black dwarf honey bee including members of rare genera. Antimicrobial potential of these insect associated Streptomyces was also demonstrated especially the antibacterial activity against phytopathogenic bacteria.

scholarly journals The First Report of Stolbur Phytoplasma Associated with Phyllody of Calendula officinalis in Serbia

Plant Disease ◽  
2014 ◽  
Vol 98 (8) ◽  
pp. 1152-1152 ◽  
Author(s):  
S. Pavlovic ◽  
M. Starovic ◽  
S. Stojanovic ◽  
G. Aleksic ◽  
S. Kojic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Natural Infection ◽  
Cytotoxic Activities ◽  
Rrna Gene ◽  
Calendula Officinalis ◽  
Aster Yellows ◽  
First Report ◽  
Pot Marigold ◽  
Stolbur Phytoplasma

Pot marigold (Calendula officinalis L.) is native to southern Europe. Compounds of marigold flowers exhibit anti-inflammatory, anti-tumor-promoting, and cytotoxic activities (4). In Serbia, pot marigold is cultivated as an important medicinal and ornamental plant. Typical phyllody, virescence, proliferation of axillary buds, and witches' broom symptoms were sporadically observed in 2011 in Pancevo plantation, Serbia (44°51′49″ N, 20°39′33″ E, 80 m above sea level). Until 2013, the number of uniformly distributed affected pot marigold plants reached 20% in the field. Due to the lack of seed production, profitability of the cultivation was seriously affected. Leaf samples from 10 symptomatic and 4 symptomless marigold plants were collected and total nucleic acid was extracted from midrib tissue (3). Direct PCR and nested PCR were carried out with primer pairs P1/16S-SR and R16F2n/R16R2n, respectively (3). Amplicons 1.5 and 1.2 kb in length, specific for the 16S rRNA gene, were amplified in all symptomatic plants. No PCR products were obtained when DNA isolated from symptomless plants was used. Restriction fragment length polymorphism (RFLP) patterns of the 1.2-kb fragments of 16S rDNA were determined by digestion with four endonucleases separately (TruI1, AluI, HpaII, and HhaI) and compared with those of Stolbur (Stol), Aster Yellows (AY), Flavescence dorée-C (FD-C), Poinsettia Branch-Inducing (PoiBI), and Clover Yellow Edge (CYE) phytoplasmas (2). RFLP patterns from all symptomatic pot marigold plants were identical to the Stol pattern, indicating Stolbur phytoplasma presence in affected plants. The 1.2-kb amplicon of representative Nv8 strain was sequenced and the data were submitted to GenBank (accession no. KJ174507). BLASTn analysis of the sequence was compared with sequences available in GenBank, showing 100% identity with 16S rRNA gene of strains from Paeonia tenuifolia (KF614623) and corn (JQ730750) from Serbia, and peach (KF263684) from Iran. All of these are members of the 16SrXII ‘Candidatus Phytoplasma solani’ group, subgroup A (Stolbur). Phytoplasmas belonging to aster yellows (16SrI) (Italy and Canada) and peanut witches' broom related phytoplasma (16SrII) group (Iran) have been identified in diseased pot marigold plants (1). To our knowledge, this is the first report of natural infection of pot marigold by Stolbur phytoplasma in Serbia. References: (1) S. A. Esmailzadeh-Hosseini et al. Bull. Insectol. 64:S109, 2011. (2) I. M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998. (3) J. P. Prince. Phytopathology 83:1130, 1993. (4) M. Ukiya et al. J. Nat. Prod. 69:1692, 2006.

scholarly journals Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos) Shown with 16S rRNA Gene-Based Microbial Community Analysis

2013 ◽  
Vol 2013 ◽  
pp. 1-5 ◽  
Author(s):  
Isamu Maeda ◽  
Mohammad Shohel Rana Siddiki ◽  
Tsutomu Nozawa-Takeda ◽  
Naoki Tsukahara ◽  
Yuri Tani ◽  
...  
Keyword(s):  
Microbial Community ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Pathogenic Bacteria ◽  
Community Analysis ◽  
Microbial Community Analysis ◽  
Intestinal Microbiome ◽  
Rrna Gene ◽  
Jungle Crow ◽  
Corvus Macrorhynchos

Jungle Crows (Corvus macrorhynchos) prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous toEimeriasp., which belongs to the protozoan phylumApicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the generaCampylobacterandBrachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

scholarly journals First Report of Blueberry Reddening Disease in Serbia Associated with 16SrXII-A (Stolbur) Phytoplasma

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1653-1653 ◽  
Author(s):  
M. Starović ◽  
S. Kojic ◽  
S. T. Kuzmanovic ◽  
S. D. Stojanovic ◽  
S. Pavlovic ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Vaccinium Corymbosum ◽  
23S Rrna ◽  
Rrna Gene ◽  
Restriction Enzyme Digestion ◽  
First Report ◽  
Stolbur Phytoplasma ◽  
The 16S Rrna Gene

Blueberries (Vaccinium corymbosum) are among the healthiest fruits due to their high antioxidant content. The total growing area of blueberries in Serbia ranges from 80 to 90 ha. A phytoplasma-like disease was observed for the first time during July 2009 in three blueberry cultivars (Bluecrop, Duke, and Spartan) grown in central Serbia, locality Kopljare (44°20′10.9″ N, 20°38′39.3″ E). Symptoms of yellowing and reddening were observed on the upper leaves and proliferating shoots, similar to those already described on blueberries (4). There was uneven ripening of the fruits on affected plants. Incidence of affected plants within a single field was estimated to be greater than 20% in 2009 and 50% in 2010. Blueberry leaves, together with petioles, were collected during two seasons, 2009 and 2010, and six samples from diseased plants and one from symptomless plants from each cultivar, resulting in 42 samples in total. For phytoplasma detection, total DNA was extracted from the veins of symptomatic and asymptomatic leaves of V. corymbosum using the protocol of Angelini et al. (1). Universal oligonucleotide primers P1/P7 were used to amplify a 1.8-kb DNA fragment containing the 16S rRNA gene, the 16S-23S spacer region, and the 5′ end of the 23S rRNA gene. Subsequently, a 1.2-kb fragment of the 16S rRNA gene was amplified by nested PCR with the R16F2n/R16R2 primers. Reactions were performed in a volume of 50 μl using Dream Taq Green master mix (Thermo Scientific, Lithuania). PCR reaction conditions were as reported (3), except for R16F2n/R2 primers set (annealing for 30 s at 58°C). PCR products were obtained only from the DNA of symptomatic plants. Fragments of 1.2 kb were further characterized by the PCR-RFLP analysis, using AluI, HpaII, HhaI, and Tru1I restriction enzymes (Thermo Scientific, Lithuania), as recommended by the manufacturer. The products of restriction enzyme digestion were separated by electrophoresis on 2.5% agarose gel. All R16F2n/R2 amplicons showed identical RFLP patterns corresponding to the profile of the Stolbur phytoplasma (subgroup 16SrXII-A). The results were confirmed by sequencing the nested PCR product from the representative strain Br1. The sequence was deposited in NCBI GenBank database under accession number KC960486. Phylogenetic analysis showed maximal similarities with SH1 isolate from Vitis vinifera, Jordan (KC835139.1), Bushehr (Iran) eggplant big bud phytoplasma (JX483703.1), BA strain isolated from insect in Italy (JQ868436.1), and also with several plants from Serbia: Arnica montana L. (JX891383.1), corn (JQ730750.1), Hypericum perforatum (JQ033928.1), tobacco (JQ730740.1), etc. In conclusion, our results demonstrate that leaf discoloration of V. corymbosum was associated with a phytoplasma belonging to the 16SrXII-A subgroup. The wild European blueberry (Vaccinium myrtillus L.) is already detected as a host plant of 16SrIII-F phytoplasma in Germany, North America, and Lithuania (4). The main vector of the Stolbur phytoplasma, Hyalesthes obsoletus Signoret, was already detected in Serbia (2). The first report of Stolbur phytoplasma occurrence on blueberry in Serbia is significant for the management of the pathogen spreading in blueberry fields. Since the cultivation of blueberry has a great economic potential in the region, it is important to identify emerging disease concerns in order to ensure sustainable production. References: (1) E. Angelini et al. Vitis 40:79, 2001. (2) J. Jović et al. Phytopathology 99:1053, 2009. (3) S. Pavlovic et al. J. Med. Plants Res. 6:906, 2012. (4) D. Valiunas et al. J. Plant Pathol. 86:135, 2004.

scholarly journals Isolation and Characterization of Endophytic Bacteria from Tembelekan (Lantana camara L.) as Antibacterial Compounds Producer

2015 ◽  
Vol 2 (2) ◽  
pp. 86-98
Author(s):  
Dina Dyah Saputri ◽  
Maria Bintang ◽  
Fachriyan H Pasaribu
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Endophytic Bacteria ◽  
Pathogenic Bacteria ◽  
Lantana Camara ◽  
Rrna Gene ◽  
Antibacterial Compounds ◽  
Isolation And Characterization ◽  
Ms Analysis

Endophytic bacteria are microorganisms that live in the internal tissues of plants and have symbiotic mutualism with their host plants. Endophytic bacteria may produce secondary metabolites that can be developed for medical, agricultural, and industrial purposes. Lantana camara is a medicinal plant that has therapeutic potential to treat a variety of diseases such as fever, tuberculosis, rheumatism, asthma, and skin disease. The purpose of this study was to isolate and characterize endophytic bacteria from Lantana camara which has potential to produce antibacterial compounds. The method of this research include isolation of endophytic bacteria of Lantana camara. Antibacterial activity assay was done against four types of pathogenic bacteria i.e. Bacillus cereus, Escherichia coli, Staphylococcus aureus, and Salmonella enteritidis. Characterization of endophytic bacteria was by 16S rRNA gene analysis and identification of antibacterial compounds by GC-MS analysis. Isolation of endophytic bacteria from Lantana camara resulted in BT22 as a potential isolate. Analysis of 16S rRNA gene showed that the BT22 isolate was similar to Bacillus amyloliquefaciens YB-1402 with 99% identity. The results of GC-MS analysis showed some antibacterial compounds such as: Cyclohexanone, 2-[2-(1,3-dithiolan-2-yl)propyl]-6-methyl-3-(1-methylethyl), Octadecane (CAS) n-Octadecane and Tetracosane (CAS) n-Tetracosane.

Sign in / Sign up

Export Citation Format

Share Document