scholarly journals First Report of Chrysanthemum chlorotic mottle viroid in Chrysanthemum in China

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1320-1320 ◽  
Author(s):  
Z. Z. Zhang ◽  
S. Pan ◽  
S. F. Li
Keyword(s):  
Northern Blot ◽  
Blot Hybridization ◽  
Reference Sequence ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle ◽  
Young Leaves ◽  
Healthy Control ◽  
Chrysanthemum Chlorotic Mottle Viroid

During the spring of 2008, a chrysanthemum plant showing mild mottle on young leaves was observed in a garden in Beijing, China. After the plant was moved into a greenhouse, symptoms became severe with obvious yellowing and complete chlorosis on new leaves. In addition, when a survey was conducted for chrysanthemum diseases in 2010, plants with mild chlorotic spots on leaves were also found occasionally in a commercial field in Hainan, China. These symptoms resembled symptoms induced by Chrysanthemum chlorotic mottle viroid (CChMVd). Therefore, total RNA of 13 samples collected from Beijing (cultivar unknown) and Hainan (cv. Golden) was extracted according to Li et al. (2) and tested for CChMVd by northern blot hybridization using DIG-labeled CChMVd cRNA probe (1). All samples were CChMVd positive, and the healthy control was negative. The viroid was further confirmed by reverse transcription (RT)-PCR using CChMVd specific primers (forward: 5′-AGGTCGTA(T)AAACTTCCCCTCTAAA(G)CG-3′, homologous to nucleotides 134 to 159; and reverse: 5′-TCCAGTCGAGACCTGAAGTGGGTTTC-3′, complementary to nucleotides 133 to 108) (1). Two amplified products of approximately 400 bp were cloned into the pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells. Two positive clones were obtained from each isolate and sequenced. Four sequences obtained have been submitted to GenBank (Accession Nos. HQ891014 to HQ891017). Sequence analysis revealed that the obtained sequences shared 96.49 to 96.99% similarity with the reference sequence CChMVd (GenBank Accession No. NC003540). All the clones are 399 nucleotides long and are thought to be the symptomatic type based on their UUUC sequence at positions 82 to 85 in the CChMVd tetraloop (1). In addition, both isolates were mechanically inoculated to three healthy chrysanthemum plants of the unknown cultivar from Beijing. All inoculated plants developed chlorosis after 5 weeks and CChMVd infections were confirmed by northern blot hybridization and RT-PCR. CChMVd is an important pathogen that may potentially cause losses to the chrysanthemum industry. It is necessary to survey for CChMVd infection in various chrysanthemums cultivated in China. To our knowledge, this is the first report of CChMVd in chrysanthemum in China. References: (1) P. M. De la Pena et al. Proc. Natl. Acad. Sci. USA. 96:9960, 1999. (2) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

scholarly journals First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 422-422 ◽  
Author(s):  
M. Mijit ◽  
S. F. Li ◽  
S. Zhang ◽  
Z. X. Zhang
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
Ficus Carica ◽  
Pcr Analysis ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

scholarly journals First Report of Coleus blumei viroid 5 from Coleus blumei in India and Indonesia

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
D. M. Jiang ◽  
S. F. Li ◽  
F. H. Fu ◽  
Z. J. Wu ◽  
L. H. Xie
Keyword(s):  
Blot Hybridization ◽  
Rna Extraction ◽  
Reference Sequence ◽  
Rt Pcr ◽  
Dot Blot ◽  
First Report ◽  
Coleus Blumei ◽  
Infectious Clones ◽  
Three Samples ◽  
Dark Green

Coleus blumei, which was found originally in Indonesia, is an ornamental plant grown worldwide. It can be infected by several viroids of the genus Coleviroid, family Pospiviroidae. Six main viroids that infect coleus have been reported: Coleus blumei viroid 1 through 6 (CbVd-1 ~ CbVd-6). Although CbVd-1 was first reported in a commercial coleus in Brazil in 1989 (1), and then in Germany, Japan, Canada, Korea, China, and India, CbVd-5 was reported only in China in 2009 (2). Symptoms caused by CbVd-5 varied depending on different cultivars, and in case of an unknown cultivar of “Red with dark green edge,” are very clear albino symptoms. From 2010 to 2011, 60 and 3 leaf samples of coleus were collected from Hyderabad, India, and Java, Indonesia, respectively, and subjected to low molecular weight RNA extraction according to Li et al. (3). The results of dot-blot hybridization using CbVd-5 cRNA probes and RT-PCR using CbVd-5 specific primers (CbVd-5-PF: 5′-TGACTAGAACAGTAGTAAAG-3′ / CbVd-5-PR: 5′-AATTGAGGTCAAACCTCTTT-3′) demonstrated that 28 out of the 60 samples from India and all three samples from Indonesia were positive for CbVd-5. The resulting RT-PCR fragments from one sample selected randomly from each country were cloned into the pMD18-T vector (Takara) and transformed into E. coli DH5α competent cells. Five positive clones of each sample were sequenced. The result of sequence analysis revealed that the similarities of CbVd-5 between the sequences we obtained and the reference sequence (GenBank Accession No. NC003683) were 97.8 to 100%. Bioassay using nine viroid-free coleus plants from three cultivars (three from each cultivar), inoculated with CbVd-5 infectious clones by stem slashing, demonstrated that CbVd-5 could induce albino symptom on the leaves of the unknown cultivar “Red with dark green edge” 2 months after inoculation. To our knowledge, this is the first report of CbVd-5 from India and Indonesia, and the second report of CbVd-5 in the world. Considering the effect of CbVd-5 on the appearance of coleus and its recombination ability, a certification program may be needed to control the spread of this viroid. References: (1) M. E. N. Fonseca et al. Fitopatol. Bras. 14:94, 1989. (2) W. Y. Hou et al. Arch. Virol. 154:315, 2009. (3) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

scholarly journals First Report of Maize chlorotic mottle virus and Maize Lethal Necrosis in Kenya

Plant Disease ◽  
2012 ◽  
Vol 96 (10) ◽  
pp. 1582-1582 ◽  
Author(s):  
A. W. Wangai ◽  
M. G. Redinbaugh ◽  
Z. M. Kinyua ◽  
D. W. Miano ◽  
P. K. Leley ◽  
...  
Keyword(s):  
Mottle Virus ◽  
Streak Virus ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Varieties ◽  
Young Leaves ◽  
Symptomatic Leaf

In September 2011, a high incidence of a new maize (Zea mays L.) disease was reported at lower elevations (1,900 m asl) in the Longisa division of Bomet County, Southern Rift Valley, Kenya. The disease later spread to the Narok South and North and Naivasha Districts. By March 2012, the disease was reported at up to 2,100 m asl. Diseased plants had symptoms characteristic of virus diseases: a chlorotic mottle on leaves, developing from the base of young whorl leaves upward to the leaf tips; mild to severe leaf mottling; and necrosis developing from leaf margins to the mid-rib. Necrosis of young leaves led to a “dead heart” symptom, and plant death. Severely affected plants had small cobs with little or no grain set. Plants frequently died before tasseling. All maize varieties grown in the affected areas had similar symptoms. In these regions, maize is grown continuously throughout the year, with the main planting season starting in November. Maize streak virus was present, but incidence was low (data not shown). Infected plants were distributed throughout affected fields, with heavier infection along field edges. High thrips (Frankliniella williamsi Hood) populations were present in sampled fields, but populations of other potential disease vectors, such as aphids and leafhoppers, were low. Because of the high thrips populations and foliar symptoms, symptomatic plants were tested for the presence of Maize chlorotic mottle virus (MCMV) (3) using tissue blot immunoassay (TBIA) (1). Of 17 symptomatic leaf samples from each Bomet and Naivasha, nine from Bomet and all 17 from Naivasha were positive for MCMV. However, the observed symptoms were more severe than commonly associated with MCMV, suggesting the presence of maize lethal necrosis (MLN), a disease that results from maize infection with both MCMV and a potyvirus (4). Therefore, samples were tested for the presence of Sugarcane mosaic virus (SCMV), which is present in Kenya (2). Twenty-seven samples were positive for SCMV by TBIA, and 23 of 34 samples were infected with both viruses. Virus identities were verified with reverse-transcription (RT)-PCR (Access RT-PCR, Promega) and MCMV or SCMV-specific primers. MCMV primers (2681F: 5′-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5′-CGAATCTACACACACACACTCCAGC) amplified the expected 550-bp product from three leaf samples. Amplicon sequences were identical, and had 95 to 98% identity with MCMV sequences in GenBank. SCMV primers (8679F: 5′-GCAATGTCGAAGAAAATGCG) and 9595R: 5′-GTCTCTCACCAAGAGACTCGCAGC) amplified the expected 900-bp product from four leaf samples. Amplicon sequences had 96 to 98% identity, and were 88 to 96% identical with SCMV sequences in GenBank. To our knowledge, this is the first report of MCMV and of maize coinfection with MCMV and SCMV associated with MLN in Kenya and Africa. MLN is a serious threat to farmers in the affected areas, who are experiencing extensive to complete crop loss. References: (1) P. G. S. Chang et al. J. Virol. Meth. 171:345, 2011. (2) Delgadillo Sanchez et al. Rev. Mex. Fitopat. 5:21, 1987. (3) Jiang et al., Crop Prot. 11:248, 1992. (4) R. Louie, Plant Dis. 64:944, 1980.

scholarly journals Induction of hepatic metallothioneins determined at isoprotein and messenger RNA levels in glucocorticoid-treated rats

1988 ◽  
Vol 249 (2) ◽  
pp. 429-433 ◽  
Author(s):  
L D Lehman-McKeeman ◽  
G K Andrews ◽  
C D Klaassen
Keyword(s):  
Detection Limit ◽  
Northern Blot ◽  
Blot Analysis ◽  
Messenger Rna ◽  
Time Course ◽  
Northern Blot Analysis ◽  
Blot Hybridization ◽  
Northern Blot Hybridization ◽  
Single Dosage ◽  
Rna Levels

Induction of metallothionein-I (MT-I) and metallothionein-II (MT-II) by glucocorticoids was determined by h.p.l.c. analysis of proteins and Northern-blot analysis of MT mRNAs. Rats were injected with dexamethasone (0.03-10 mumol/kg) and hepatic concentrations of MTs were determined 24 h later. In control rats, only MT-II was detected (9.4 +/- 2.5 micrograms/g of liver), whereas the hepatic concentration of MT-I was below the detection limit (5 micrograms of MT/g). Dexamethasone did not increase MT-I above the detection limit at any dosage tested, but MT-II increased to 2.5 times control values at dosages of 0.30 mumol/kg and higher. Time-course experiments indicated that MT-II reached a maximum at 24 h after a single dosage of dexamethasone and returned to control values by 48 h. To determine whether dexamethasone increased MT-I in liver, samples were saturated with 109Cd, after which the amount of 109Cd in MT-I and MT-II was determined. Results indicated that, by this approach, MT-I and MT-II could be detected in control rats, and there was approx. 1.8 times more 109Cd in MT-II than in MT-I. At 24 h after administration of dexamethasone (1 mumol/kg), there was a small increase in the amount of 109Cd bound to MT-I, whereas the amount of 109Cd bound to MT-II increased to more than 2 times control values. Northern-blot hybridization with mouse cRNA probes indicated that MT-I and MT-II mRNAs increased co-ordinately after administration of dexamethasone. Thus, although glucocorticoids increase both MT-I and MT-II mRNAs, MT-II preferentially accumulates after administration of dexamethasone.

Comparison of human and porcine group C rotaviruses by Northern blot hybridization analysis

1991 ◽  
Vol 118 (3-4) ◽  
pp. 269-277 ◽  
Author(s):  
Y. Qian ◽  
L. J. Saif ◽  
A. Z. Kapikian ◽  
S. Y. Kang ◽  
B. Jiang ◽  
...  
Keyword(s):  
Northern Blot ◽  
Blot Hybridization ◽  
Hybridization Analysis ◽  
Northern Blot Hybridization

scholarly journals First Report of Maize chlorotic mottle virus Infecting Maize in the Democratic Republic of the Congo

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1448-1448 ◽  
Author(s):  
M. Lukanda ◽  
A. Owati ◽  
P. Ogunsanya ◽  
K. Valimunzigha ◽  
K. Katsongo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Democratic Republic ◽  
The United States ◽  
Mottle Virus ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Republic Of The Congo

Maize (Zea mays L.) is a major food and fodder crop cultivated on 1.54 million ha in the Democratic Republic of the Congo (DRC). In December 2013, unusually severe chlorotic mottle symptoms and pale green streaks were observed in local varieties (Mudishi 1 and 2, Bambou, Kasayi, H614, H613, and Mugamba) and exotic varieties (H520, H624, H403, HDK8031, and ZM607) in Beni, Lubero, and Rutshuru territories at 1,015 to 1,748 m elevation in North Kivu Province. Symptoms were prominent on newly emerging leaves that later developed marginal necrosis resembling the symptoms of maize lethal necrosis (MLN), caused by a dual infection of Maize chlorotic mottle virus (MCMV, genus Machlomovirus) and Sugarcane mosaic virus (SCMV, genus Potyvirus). Each of these viruses, but particularly MCMV, is also known to cause severe mosaic and mottling symptoms in maize (4). In January 2014, symptomatic and asymptomatic samples (n = 20) from disease-affected fields in Beni and Lubero provinces were collected for virus testing using Whatman FTA Classic Cards (1) and analyzed for MCMV (2681F: 5′-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5′-CGAATCTACACACACACACTCCAGC) and SCMV (8679F: 5′-GCAATGTCGAAGAAAATGCG and 9595R: 5′-GTCTCTCACCAAGAGACTCGCAGC) by reverse transcription (RT)-PCR (4). Samples were also analyzed for Maize streak virus (MSV, genus Mastrevirus), an endemic virus in DRC, by PCR using MSV specific primers (MSV215-234: CCAAAKDTCAGCTCCTCCG and MSV1770-1792: TTGGVCCGMVGATGTASAG) (3). A DNA product of expected size (~520 bp) resulted only for MCMV in all the symptomatic plant samples. None of the samples tested positive for SCMV or MSV. RT-PCR analyses were performed to ascertain the absence of potyviruses using the degenerate potyvirus primers (CIFor: 5′GGIVVIGTIGGIWSIGGIAARTCIAC and CIRev: 5′ACICCRTTYTCDATDATRTTIGTIGC3′) (2) were also negative. Occurrence of MCMV in symptomatic samples was further confirmed by antigen-coated plate (ACP)-ELISA using anti-MCMV rabbit polyclonal antibodies produced at the Virology Unit, IITA, Ibadan, Nigeria. The RT-PCR product of MCMV was purified and sequenced in both directions (GenBank Accession No. KJ699379). Pairwise comparison of 518 bp nucleotide sequence corresponding to p32 and p37 open reading frames of MCMV by BLASTn search revealed 99.8% nucleotide sequence identity with an MCMV isolate from Kenya (JX286709), 98 to 99% identity with the isolates from China (JQ982468 and KF010583), and 96% identity with the isolates from the United States (X14736 and EU358605). MCMV is a newly emerging virus in Africa, first detected during a severe MLND outbreak in 2011 in Kenya (4). This disease has since become a serious threat to maize production in East Africa. MCMV has been reported in maize from Kenya, Rwanda, Tanzania, and Uganda. To our knowledge, this is the first report of MCMV occurrence in DRC. This finding confirms the further geographic expansion of MCMV and illustrates the need for further studies to identify vectors and also create awareness about the disease and to strengthen surveillance to prevent its further spread in the continent. References: (1) O. J. Alabi et al. J. Virol. Met. 154:111, 2008. (2) C. Ha et al. Arch. Virol. 153:25, 2008. (3) K. E. Palmer and E. P. Rybicki. Arch. Virol. 146:1089, 2001. (4) A. Wangai et al. Plant Dis. 96:1582, 2012.

Sign in / Sign up

Export Citation Format

Share Document