First Report of Coleus blumei viroid 5 from Coleus blumei in India and Indonesia

Coleus blumei, which was found originally in Indonesia, is an ornamental plant grown worldwide. It can be infected by several viroids of the genus Coleviroid, family Pospiviroidae. Six main viroids that infect coleus have been reported: Coleus blumei viroid 1 through 6 (CbVd-1 ~ CbVd-6). Although CbVd-1 was first reported in a commercial coleus in Brazil in 1989 (1), and then in Germany, Japan, Canada, Korea, China, and India, CbVd-5 was reported only in China in 2009 (2). Symptoms caused by CbVd-5 varied depending on different cultivars, and in case of an unknown cultivar of “Red with dark green edge,” are very clear albino symptoms. From 2010 to 2011, 60 and 3 leaf samples of coleus were collected from Hyderabad, India, and Java, Indonesia, respectively, and subjected to low molecular weight RNA extraction according to Li et al. (3). The results of dot-blot hybridization using CbVd-5 cRNA probes and RT-PCR using CbVd-5 specific primers (CbVd-5-PF: 5′-TGACTAGAACAGTAGTAAAG-3′ / CbVd-5-PR: 5′-AATTGAGGTCAAACCTCTTT-3′) demonstrated that 28 out of the 60 samples from India and all three samples from Indonesia were positive for CbVd-5. The resulting RT-PCR fragments from one sample selected randomly from each country were cloned into the pMD18-T vector (Takara) and transformed into E. coli DH5α competent cells. Five positive clones of each sample were sequenced. The result of sequence analysis revealed that the similarities of CbVd-5 between the sequences we obtained and the reference sequence (GenBank Accession No. NC003683) were 97.8 to 100%. Bioassay using nine viroid-free coleus plants from three cultivars (three from each cultivar), inoculated with CbVd-5 infectious clones by stem slashing, demonstrated that CbVd-5 could induce albino symptom on the leaves of the unknown cultivar “Red with dark green edge” 2 months after inoculation. To our knowledge, this is the first report of CbVd-5 from India and Indonesia, and the second report of CbVd-5 in the world. Considering the effect of CbVd-5 on the appearance of coleus and its recombination ability, a certification program may be needed to control the spread of this viroid. References: (1) M. E. N. Fonseca et al. Fitopatol. Bras. 14:94, 1989. (2) W. Y. Hou et al. Arch. Virol. 154:315, 2009. (3) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

Download Full-text

First Report of Chrysanthemum chlorotic mottle viroid in Chrysanthemum in China

Plant Disease ◽

10.1094/pdis-04-11-0335 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1320-1320 ◽

Cited By ~ 11

Author(s):

Z. Z. Zhang ◽

S. Pan ◽

S. F. Li

Keyword(s):

Northern Blot ◽

Blot Hybridization ◽

Reference Sequence ◽

Northern Blot Hybridization ◽

Rt Pcr ◽

First Report ◽

Chlorotic Mottle ◽

Young Leaves ◽

Healthy Control ◽

Chrysanthemum Chlorotic Mottle Viroid

During the spring of 2008, a chrysanthemum plant showing mild mottle on young leaves was observed in a garden in Beijing, China. After the plant was moved into a greenhouse, symptoms became severe with obvious yellowing and complete chlorosis on new leaves. In addition, when a survey was conducted for chrysanthemum diseases in 2010, plants with mild chlorotic spots on leaves were also found occasionally in a commercial field in Hainan, China. These symptoms resembled symptoms induced by Chrysanthemum chlorotic mottle viroid (CChMVd). Therefore, total RNA of 13 samples collected from Beijing (cultivar unknown) and Hainan (cv. Golden) was extracted according to Li et al. (2) and tested for CChMVd by northern blot hybridization using DIG-labeled CChMVd cRNA probe (1). All samples were CChMVd positive, and the healthy control was negative. The viroid was further confirmed by reverse transcription (RT)-PCR using CChMVd specific primers (forward: 5′-AGGTCGTA(T)AAACTTCCCCTCTAAA(G)CG-3′, homologous to nucleotides 134 to 159; and reverse: 5′-TCCAGTCGAGACCTGAAGTGGGTTTC-3′, complementary to nucleotides 133 to 108) (1). Two amplified products of approximately 400 bp were cloned into the pGEM-T vector (Promega, Madison, WI) and transformed into E. coli DH5α competent cells. Two positive clones were obtained from each isolate and sequenced. Four sequences obtained have been submitted to GenBank (Accession Nos. HQ891014 to HQ891017). Sequence analysis revealed that the obtained sequences shared 96.49 to 96.99% similarity with the reference sequence CChMVd (GenBank Accession No. NC003540). All the clones are 399 nucleotides long and are thought to be the symptomatic type based on their UUUC sequence at positions 82 to 85 in the CChMVd tetraloop (1). In addition, both isolates were mechanically inoculated to three healthy chrysanthemum plants of the unknown cultivar from Beijing. All inoculated plants developed chlorosis after 5 weeks and CChMVd infections were confirmed by northern blot hybridization and RT-PCR. CChMVd is an important pathogen that may potentially cause losses to the chrysanthemum industry. It is necessary to survey for CChMVd infection in various chrysanthemums cultivated in China. To our knowledge, this is the first report of CChMVd in chrysanthemum in China. References: (1) P. M. De la Pena et al. Proc. Natl. Acad. Sci. USA. 96:9960, 1999. (2) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

Download Full-text

First Report of Tomato torrado virus on Weed Hosts in Spain

Plant Disease ◽

10.1094/pdis-92-5-0831b ◽

2008 ◽

Vol 92 (5) ◽

pp. 831-831 ◽

Cited By ~ 19

Author(s):

A. Alfaro-Fernández ◽

C. Córdoba-Sellés ◽

M. C. Cebrián ◽

J. A. Herrera-Vásquez ◽

J. A. Sánchez-Navarro ◽

...

Keyword(s):

Canary Islands ◽

Natural Infection ◽

Blot Hybridization ◽

Molecular Hybridization ◽

World Intellectual Property Organization ◽

Rt Pcr ◽

Weed Species ◽

Dot Blot ◽

Nicotiana Glauca ◽

First Report

Tomato torrado virus (ToTV) is a recently identified Picorna-like virus that causes “torrado disease” in tomatoes (4). Typical symptoms of “torrado disease” seen in tomato crops (Solanum lycopersicum L. formerly Lycopersicon esculentum L.) were initially defined as yellow areas at the base of the leaflet that later developed into necrotic spots that sometimes abscised, leaving holes in the leaflet. Other plants showed extensive necrosis progressing from the base to the tip of the leaflet. Fruits were distorted with necrotic lines on the surface that often cracked. Affected plants had a burnt-like appearance and the production was seriously reduced. These symptoms have been observed in tomato crops in Murcia (Spain) and the Canary Islands (Spain) (1). To identify possible alternative hosts that may serve as virus reservoirs, samples of 72 different common weed species were collected in greenhouses in Murcia and the Canary Islands where “torrado disease” symptoms were observed in tomatoes. Forty-seven showed virus-like symptoms and 25 were asymptomatic. Symptoms included mild mosaic, blistering, vein clearing, interveinal yellowing, yellow spots, necrosis, leaf distortion, and curling. Samples were analyzed by one-step reverse transcription (RT)-PCR using primers specific for ToTV to amplify 580 bp of the polyprotein region of RNA2 (3) and dot-blot hybridization with a digoxygenin-labeled RNA probe complementary to the same portion of the ToTV genome. Twenty-two of the 72 weed samples belonging to Amaranthus sp. (Amaranthaceae); Spergularia sp. (Caryophyllaceae); Atriplex sp., Chenopodium ambrosioides L., Chenopodium sp., and Halogetum sativus (Loef. ex L.) Moq. (Chenopodiaceae); Senebiera didyma Pers. (Cruciferae); Malva sp. (Malvacae); Polygonum sp. (Polygonaceae); and Nicotiana glauca Graham and Solanum nigrum L. (Solanaceae) were positive for ToTV by molecular hybridization (10 samples) and RT-PCR (22 samples, including the samples positive by molecular hybridization). PCR products obtained from Atriplex sp. (Canary Islands) and S. didyma (Murcia) were sequenced (GenBank Accessions EU090252 and EU090253). BLAST analysis showed 99% identity to ToTV RNA2 sequence (GenBank Accession DQ388880). Two tomato plants were positive for ToTV by RT-PCR after mechanical back-inoculation, although no symptoms were observed. This study showed ToTV infects common weeds present in Spanish tomato crops. Recently, Trialeurodes vaporariorum has been reported to transmit ToTV (2), although the efficiency of transmission is unknown. The vector-assisted transmission of ToTV could explain the infection of weeds in affected greenhouses. To our knowledge, this is the first report of natural infection of weeds by ToTV. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (3) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization WO/2006/085749, 2006. (4) M. Verbeek et al. Arch. Virol. 152:881, 2007.

Download Full-text

First Report of Coleus blumei viroid 2 from Commercial Coleus in China

Plant Disease ◽

10.1094/pdis-12-10-0928 ◽

2011 ◽

Vol 95 (4) ◽

pp. 494-494 ◽

Cited By ~ 7

Author(s):

F. H. Fu ◽

S. F. Li ◽

D. M. Jiang ◽

H. Q. Wang ◽

A. Q. Liu ◽

...

Keyword(s):

Ornamental Plant ◽

Reference Sequence ◽

Hainan Province ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Coleus Blumei ◽

Blast Analysis ◽

Pcr Product ◽

The Family

Coleus (Coleus blumei) is an ornamental plant that is susceptible to infection by several viroids of the genus Coleviroid, which is a member of the family Pospiviroidae. Coleus blumei viroid (CbVd) -1 was first reported in commercial yellow coleus fields in Brazil in 1989 (1). In addition, CbVd-2, CbVd-3, and CbVd-4 have only been detected from coleus in Germany in 1996 (4). CbVd-5 and CbVd-6 were recently identified in China (2). In March 2010, leaves were collected from 50 symptomless coleus plants from a commercial nursery in Hainan Province, China. Total RNA was extracted from the leaves (3). Reverse transcription (RT)-PCR using CbVd-2 specific primers (forward: 5′-AGCTTACCTGGGTTCCCT-3′ and reverse: 5′-CTCTCCTCTATTTACTCTCTTCTC-3′) corresponding to positions 76 to 93 and 52 to 75 on the CbVd-2 reference sequence, respectively (GenBank Accession No. NC003682). Amplification of a 301-bp product was obtained from one sample. This PCR product was then cloned into pMD18-T (Takara, Dalian, China). Twelve positive clones were sequenced and the results were subjected to BLAST analysis. Sequence analysis showed that two sequences (GenBank Accessions Nos. HQ727542 and HQ727544) shared 99% identity with the reference sequence of CbVd-2 (NC003682), and four sequences (HQ727541, HQ727543, HQ727545 and HQ727547) had 99.34% identity with the reference sequence of CbVd-2 (NC003682). The proposed secondary structures of these variants have approximately 75% paired nucleotides. Results suggested the presence of CbVd-2, which is a member of the Coleviroid genus, Pospoviroidae family. To our knowledge, this is the first report of CbVd-2 from commercial coleus in China. References: (1) M. E. N. Fonseca et al. Fitopatol. Bras. 14:94, 1989. (2) W. Y. Hou et al. Arch. Virol. 154:993, 2009. (3) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995. (4) R. L. Spieker et al. J. Gen. Virol. 77:2839, 1996.

Download Full-text

First Report of Tomato torrado virus Infecting Tomato in Hungary

Plant Disease ◽

10.1094/pdis-93-5-0554c ◽

2009 ◽

Vol 93 (5) ◽

pp. 554-554 ◽

Cited By ~ 18

Author(s):

A. Alfaro-Fernández ◽

G. Bese ◽

C. Córdoba-Sellés ◽

M. C. Cebrián ◽

J. A. Herrera-Vásquez ◽

...

Keyword(s):

Coat Protein ◽

Mosaic Virus ◽

Polyclonal Antibodies ◽

Blot Hybridization ◽

Sandwich Elisa ◽

World Intellectual Property Organization ◽

Tomato Mosaic Virus ◽

Rt Pcr ◽

Dot Blot ◽

First Report

During the growing seasons of 2007 and 2008, in commercial greenhouses of tomato crops (Solanum lycopersicum L.) located in Szeged, Öcsöd, and Csongrád (southeastern regions of Hungary), unusual disease symptoms were observed, including necrotic spots in defined areas at the base of the leaflet, necrosis in the stems, and necrotic lines on the fruits surface. Affected plants appeared inside the greenhouses with a random distribution and the incidence recorded was at least 40%. These symptoms resembled those described for Tomato torrado virus (ToTV) infection in Spain (1) and Poland (3). To verify the identity of the disease, three symptomatic plants from commercial greenhouses of each geographic location were selected and analyzed by double-antibody sandwich-ELISA using polyclonal antibodies specific to Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tomato mosaic virus (ToMV), Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany), and Pepino mosaic virus (PepMV) (DSMZ, Braunschweig, Germany). Total RNA was extracted and tested by reverse transcription (RT)-PCR with three pair of specific primers: one pair used to amplify the coat protein (CP) gene of PepMV (2) and the other two pairs specific to ToTV that amplify 580 bp of the polyprotein (4) and a fragment of 574 bp in the CP Vp23 (3). Nonisotopic dot-blot hybridization using a digoxygenin-labeled RNA probe complementary to the aforementioned fragment of the polyprotein was also performed. Tomato samples were negative for all the viruses tested by serological analysis and for PepMV by RT-PCR. However, all three samples were positive for ToTV by molecular hybridization and RT-PCR. RT-PCR products were purified and directly sequenced. The amplified fragments of the three Hungarian isolates, ToTV-H1, ToTV-H2, and ToTV-H3, for the polyprotein (GenBank Accession Nos. EU835496, FJ616995, and FJ616994, respectively) and the CP Vp23 (GenBank Accession Nos. FJ616996, FJ616997, and FJ616998, respectively) showed 99 to 98% nt identity with the polyprotein and the coat protein regions of ToTV from Spain and Poland (GenBank Accession Nos. DQ3888880 and EU563947, respectively). Whiteflies, commonly found in Hungarian greenhouses, have been reported to transmit ToTV (3), although the efficiency of transmission is unknown. To our knowledge, this is the first report of ToTV in Hungary. References: (1) A. Alfaro-Fernández et al. Plant Dis. 91:1060, 2007. (2) I. Pagán et al. Phytopathology 96:274, 2006. (3) H. Pospieszny et al. Plant Dis. 91:1364, 2007. (4) J. Van der Heuvel et al. Plant Virus Designated Tomato Torrado Virus. Online publication. World Intellectual Property Organization. WO/2006/085749, 2006.

Download Full-text

First Report of Peach latent mosaic viroid Infecting Peach in Egypt

Plant Disease ◽

10.1094/pdis-92-4-0649b ◽

2008 ◽

Vol 92 (4) ◽

pp. 649-649 ◽

Cited By ~ 1

Author(s):

M. Hassan ◽

P. Rysanek ◽

M. Malfitano ◽

D. Alioto

Keyword(s):

Blot Hybridization ◽

Leaf Tissue ◽

Stone Fruit ◽

Rt Pcr ◽

Dot Blot ◽

First Report ◽

Detection Techniques ◽

Mediterranean Countries ◽

Canadian Isolate ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) is a widespread pathogen of stone fruit trees in some European and Mediterranean countries and also in North America. To access the presence of the viroid in Egypt, a survey was conducted that covered five commercial peach orchards in the El Khatatba Region in Al Minufiya Governorate. During 2003 and 2004, 73 peach trees (cv. Florida grafted on Nemagard rootstock) were visually inspected and sampled. No symptoms characteristic of PLMVd infection, such as mosaic, delayed growth, or fruit suture cracking, were observed. All samples were tested for the presence of PLMVd using dot-blot hybridization and reverse transcription (RT)-PCR. Aliquots (5 μl) of total nucleic acids extracted from approximately 2 mg of leaf tissue were spotted onto positively charged nylon membranes and hybridized under stringent conditions with a digoxigenin-labeled riboprobe (2). The extracts (1 μl) also were used in RT-PCR as described (1). Only 1 of the 73 peach trees was positive for PLMVd using these detection techniques. The RT-PCR product was of the size expected for PLVMd and was cloned and sequenced. The 339 nucleotide sequence was deposited in GenBank as Accession No. DQ839564. The sequence of this Egyptian PLMVd isolate was 94% identical to the reference PLMVd variant (GenBank Accession No. M83545) and most closely (95%) related to Canadian isolate variant 16 (GenBank Accession No. AJ550911). Such a low incidence compared with other countries may be because the survey was restricted to a limited number of samples, conducted on newly reclaimed lands where no sources of infection existed before, and material with relatively low PLMVd incidence might have been used for planting. Although the incidence of PLMVd was low in this survey, the occurrence represents a threat to the stone fruit tree industry in this country and regular screening of PLMVd in certification programs is suggested. To our knowledge, this is the first report of PLMVd on peach in Egypt. References: (1) S. Loreti et al. EPPO Bull. 29:433, 1999. (2) A. M. Shamloul et al. Acta Hortic. 386:522, 1995.

Download Full-text

Feasibility of Qualitative Testing of BCR-ABL and JAK2 V617F in Suspected Myeloproliperative Neoplasm (MPN) Using RT-PCR Reversed Dot Blot Hybridization (RT-PCR RDB)

Clinical Lymphoma Myeloma & Leukemia ◽

10.1016/j.clml.2019.01.005 ◽

2019 ◽

Vol 19 (4) ◽

pp. 220-227

Author(s):

Najmiatul Masykura ◽

Ummu Habibah ◽

Siti Fatimah Selasih ◽

Soegiarto Gani ◽

Cosphiadi Irawan ◽

...

Keyword(s):

Blot Hybridization ◽

Jak2 V617f ◽

Rt Pcr ◽

Dot Blot ◽

Dot Blot Hybridization

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

First Report of Tomato Brown Rugose Fruit Virus Infecting Tomato Crop in Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-21-1065-pdn ◽

2021 ◽

Author(s):

Ahmed Sabra ◽

Mohammed Ali Al Saleh ◽

I. M. Alshahwan ◽

Mahmoud A. Amer

Keyword(s):

Saudi Arabia ◽

Mosaic Virus ◽

Solanum Lycopersicum ◽

Tomato Mosaic Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Pcr Products ◽

Dark Green ◽

Leaf Symptoms

Tomato (Solanum lycopersicum L.) is the most economically important member of family Solanaceae and cultivated worldwide and one of the most important crops in Saudi Arabia. The aim of this study is screening of the most common viruses in Riyadh region and identified the presence of tomato brown rugose fruit virus (ToBRFV) in Saudi Arabia. In January 2021, unusual fruit and leaf symptoms were observed in several greenhouses cultivating tomatoes commercially in Riyadh Region, Saudi Arabia. Fruit symptoms showed irregular brown spots, deformation, and yellowing spots which render the fruits non-marketable, while the leaf symptoms included mottling, mosaic with dark green wrinkled and narrowing. These plants presented the symptoms similar to those described in other studies (Salem et al., 2015, Luria et al., 2017). A total 45 Symptomatic leaf samples were collected and tested serologically against suspected important tomato viruses including: tomato chlorosis virus, tomato spotted wilt virus, tomato yellow leaf curl virus, tomato chlorotic spot virus, tomato aspermy virus, tomato bushy stunt virus, tomato black ring virus, tomato ringspot virus, tomato mosaic virus, pepino mosaic virus and ToBRFV using Enzyme linked immunosorbent assay (ELISA) test (LOEWE®, Biochemica, Germany), according to the manufacturers' instructions. The obtained results showed that 84.4% (38/45) of symptomatic tomato samples were infected with at least one of the detected viruses. The obtained results showed that 55.5% (25/45) of symptomatic tomato samples were found positive to ToBRFV, three out of 25 samples (12%) were singly infected, however 22 out of 45 (48.8%) had mixed infection between ToBRFV and with at least one of tested viruses. A sample with a single infection of ToBRFV was mechanically inoculated into different host range including: Chenopodium amaranticolor, C. quinoa, C. album, C. glaucum, Nicotiana glutinosa, N. benthamiana, N. tabacum, N. occidentalis, Gomphrena globosa, Datura stramonium, Solanum lycopersicum, S. nigrum, petunia hybrida and symptoms were observed weekly and the systemic presence of the ToBRFV was confirmed by RT-PCR and partial nucleotide sequence. A Total RNA was extracted from DAS-ELISA positive samples using Thermo Scientific GeneJET Plant RNA Purification Mini Kit. Reverse transcription-Polymerase chain reaction (RT-PCR) was carried out using specific primers F-3666 (5´-ATGGTACGAACGGCGGCAG-3´) and R-4718 (5´-CAATCCTTGATGTG TTTAGCAC-3´) which amplified a fragment of 1052 bp of Open Reading Frame (ORF) encoding the RNA-dependent RNA polymerase (RdRp). (Luria et al. 2017). RT-PCR products were analyzed using 1.5 % agarose gel electrophoresis. RT-PCR products were sequenced in both directions by Macrogen Inc. Seoul, South Korea. Partial nucleotide sequences obtained from selected samples were submitted to GenBank and assigned the following accession numbers: MZ130501, MZ130502, and MZ130503. BLAST analysis of Saudi isolates of ToBRFV showed that the sequence shared nucleotide identities ranged between 98.99 % to 99.50 % among them and 98.87-99.87 % identity with ToBRFV isolates from Palestine (MK881101 and MN013187), Turkey (MK888980, MT118666, MN065184, and MT107885), United Kingdom (MN182533), Egypt (MN882030 and MN882031), Jordan (KT383474), USA (MT002973), Mexico (MK273183 and MK273190), Canada (MN549395) and Netherlands (MN882017, MN882018, MN882042, MN882023, MN882024, and MN882045). To our knowledge, this is the first report of occurrence of ToBRFV infecting tomato in Saudi Arabia which suggests its likely introduction by commercial seeds from countries reported this virus and spread in greenhouses through mechanical means. The author(s) declare no conflict of interest. Keywords: Tomato brown rugose fruit virus, tomato, ELISA, RT-PCR, Saudi Arabia References: Luria N, et al., 2017. PLoS ONE 12(1): 1-19. Salem N, et al., 2015. Archives of Virology 161(2): 503-506. Fig. 1. Symptoms caused by ToBRFV showing irregular brown spots, deformation, yellowing spots on fruits (A, B, C) and bubbling and mottling, mosaic with dark green wrinkled and narrowing on leaf (D).

Download Full-text

Laboratory Evidence of Norwalk Virus Contamination on the Hands of Infected Individuals

Applied and Environmental Microbiology ◽

10.1128/aem.02576-13 ◽

2013 ◽

Vol 79 (24) ◽

pp. 7875-7881 ◽

Cited By ~ 30

Author(s):

Pengbo Liu ◽

Blanca Escudero ◽

Lee-Ann Jaykus ◽

Julia Montes ◽

Rebecca M. Goulter ◽

...

Keyword(s):

Blot Hybridization ◽

Rna Extraction ◽

High Pressure Processing ◽

Norwalk Virus ◽

Dot Blot ◽

Definitive Evidence ◽

Reverse Transcription Quantitative Pcr ◽

Outbreak Investigations ◽

Pcr Products ◽

Polyethylene Glycol Precipitation

ABSTRACTHuman norovirus (NoV) outbreak investigations suggest that the hands of infected individuals play an important role in NoV transmission. However, there is no experimental evidence documenting the likelihood and degree of NoV contamination on hands. As part of a clinical trial designed to evaluate the efficacy of high-pressure processing for Norwalk virus (NV) inactivation in oysters, 159 hand rinse samples were collected from 6 infected and 6 uninfected subjects. NV was concentrated from the samples by polyethylene glycol precipitation, followed by RNA extraction using an automated guanidinium isothiocyanate-silica method. NV RNA was detected and quantified using multiple NV-specific reverse transcription-quantitative PCR (RT-qPCR) assays. A total of 25.4% (18/71) of the hand rinse samples collected from 6 infected volunteers were presumptively positive for NV, with an average of 3.86 log10genomic equivalent copies (GEC) per hand. Dot blot hybridization of PCR products obtained using a different primer set, and DNA sequencing of selected amplicons, provided further confirmation of the presence of NV in the hand rinses. NV contamination was also detected in two hand rinse samples obtained from one uninfected subject. These findings provide definitive evidence of NV contamination on the hands of infected subjects observed under controlled clinical research conditions. Such data support the need for better hand hygiene strategies to prevent NoV transmission.

Download Full-text

First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽

10.1094/pdis-10-14-1028-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 422-422 ◽

Cited By ~ 3

Author(s):

M. Mijit ◽

S. F. Li ◽

S. Zhang ◽

Z. X. Zhang

Keyword(s):

Mosaic Virus ◽

Blot Hybridization ◽

Ficus Carica ◽

Pcr Analysis ◽

Northern Blot Hybridization ◽

Rt Pcr ◽

Glycoprotein Precursor ◽

First Report ◽

Common Fig ◽

Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

Download Full-text