First Report of Artichoke yellow ringspot virus in Globe Artichoke in Turkey

Turkey is one of the main globe artichoke (Cynara cardunculus L. subsp. scolymus (L.) Hayek) producers in the world. Cultivation of this crop is done mainly in the Aegean and Eastern Marmara regions with asexually propagated cultivars such as Bayrampasa and Sakiz. More than half of total globe artichoke production in Turkey is obtained from the provinces of Izmir, Aydin, and Mugla in the Aegean region. Surveys in 2011 and 2012 were carried out to look for the presence of Artichoke yellow ringspot virus (AYRSV), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) in the globe artichoke production areas in these three provinces. Double antibody sandwich (DAS)-ELISA and reverse transcriptase (RT)-PCR assays conducted for TMV and TSWV showed that the samples were not infected with these two viruses. Due to the lack of commercial ELISA kits against AYRSV, RT-PCR and biological indexing were used for its identification. Leaf tissues from 35 symptomatic and 25 symptomless plants were sampled and analyzed by RT-PCR using as template total RNAs extracted by a silica gel method (1). RT-PCR was conducted as previously reported (1). A PCR product of the expected size (about 530 bp) was obtained from five plant samples that were collected from Izmir province and had symptoms of bright yellow spots and line patterns on the leaves. The incidence of diseased plants in the fields ranged from 1 to 5%. In previously conducted studies, these symptoms were defined as typical symptoms of AYRSV on artichokes (2,3,4). One of the PCR products was cloned and sequenced. BLASTn analysis of the obtained sequence (GenBank Accession No. KC622054) showed 92% nucleotide identity with the partial RNA1 sequence of an AYRSV isolate from Allium cepa (AM087671.2). Furthermore, selected test plants were mechanically inoculated with sap from plant samples that were positive in RT-PCR. Chlorotic local lesions and systemic mottling symptoms were observed on Chenopodium quinoa; chlorotic lesions, mosaic, and deformation on Cucumis sativus; and systemic mosaic, reddish necrotic local lesions, and malformation on Phaseolus vulgaris (French bean). Results of the biological tests were confirmed by RT-PCR. AYRSV has a wide host range including artichoke and six other cultivated plant species and can be easily transmitted by seed, plant sap, and vegetative propagation (3). To our knowledge, this is the first report of natural infection of globe artichoke by AYRSV in Turkey. AYRSV infections can have a detrimental effect on the growth and yield of artichoke plantings. This assay will be useful for further epidemiological studies. References: (1) X. Foissac et al. Acta Hortic. 550:37, 2001. (2) D. Galliitelli et al. Adv. Virus Res. 84:289, 2012. (3) P. E. Kyriakopoulou et al. Ann. Inst. Phytopathol. Benaki 14:139, 1985. (4) V. I. Maliogka et al. Phytopathology 96:622, 2006.

Download Full-text

First Report of Tobacco rattle virus in Spinach in California

Plant Disease ◽

10.1094/pdis-94-1-0125b ◽

2010 ◽

Vol 94 (1) ◽

pp. 125-125 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

T. Tian ◽

H.-Y. Liu

Keyword(s):

Sugar Beet ◽

Spinacia Oleracea ◽

Sandwich Elisa ◽

Tobacco Rattle Virus ◽

Chenopodium Quinoa ◽

Mechanical Transmission ◽

Rt Pcr ◽

First Report ◽

Local Lesions ◽

Rigid Rod

In 2009 in coastal California (Santa Barbara County), commercially grown spinach (Spinacia oleracea) in two nearby fields exhibited symptoms of a previously unrecognized virus-like disease. Symptoms consisted of general chlorosis and bright yellow blotches and spots. Necrotic spots were also associated with the disease. In affected fields, disease occurred in limited, irregularly shaped patches that ranged from one to several meters in diameter. Symptomatic plants were unmarketable and these small patches of spinach were not harvested. With a transmission electron microscope, rigid, rod-shaped particles with a clear central canal were observed from plant sap of the symptomatic spinach. Analysis by a double-antibody sandwich-ELISA assay (Agdia Inc., Elkhart, IN) for Tobacco rattle virus (TRV) showed that the symptomatic plants were positive. Symptomatic spinach from the field was used for mechanical transmission to Chenopodium quinoa, C. murale, C. capitatum, spinach, and sugar beet (Beta vulgaris). All inoculated plants showed chlorotic local lesions and sugar beet showed chlorotic local lesions with rings. To further confirm the presence of TRV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR with forward (5′-TACATCACATCTGCCTGC-3′) and reverse (5′-CTTCATTCACACAACCCTTG-3′) primers specific to the movement protein gene from the spinach isolate of TRV (GenBank Accession No. AJ007294). Amplicons of the expected size (approximately 562 bp) were obtained. The RT-PCR products were sequenced (GenBank Accession No. GU002156) and compared with TRV sequences in GenBank to confirm the identity of the products. Sequences obtained had 96% nucleotide identity and 97% amino acid identity with TRV sequences available under the GenBank Accession Nos. FJ357571 and AJ007294. On the basis of the data from electron microscopy and serological and molecular analyses, the virus was identified as TRV. Soil samples collected from one of the fields were assayed for nematodes; however, Paratrichodorus or Trichodorus species were not recovered. To our knowledge, this is the first report of TRV in spinach in California. TRV has also been reported in spinach in England (1) and Germany (2). References: (1) A. Kurppa et al. Ann. Appl. Biol. 98:243, 1981. (2) K. Schmidt and R. Koenig. Arch. Virol. 144:503, 1999.

Download Full-text

First Report of Strawberry latent ringspot virus in Strawberry in the United States and Canada

Plant Disease ◽

10.1094/pdis.2004.88.5.575a ◽

2004 ◽

Vol 88 (5) ◽

pp. 575-575 ◽

Cited By ~ 12

Author(s):

R. R. Martin ◽

I. E. Tzanetakis ◽

J. E. Barnes ◽

J. F. Elmhirst

Keyword(s):

British Columbia ◽

Chenopodium Quinoa ◽

The United States ◽

Ringspot Virus ◽

Broad Host Range ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

The Family ◽

Polymerase Chain

Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5′ CCTCTCCAACC-TGCTAGACT 3′) and SLRSV R (5′ AAGCGCATGAAGGTGTAACT 3′) that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

Botrytis porri in Onion Seed Crops and Onion Seed

Plant Disease ◽

10.1094/pdis.2002.86.10.1178c ◽

2002 ◽

Vol 86 (10) ◽

pp. 1178-1178 ◽

Cited By ~ 3

Author(s):

L. J. du Toit ◽

M. L. Derie ◽

T. Hsiang ◽

G. Q. Pelter

Keyword(s):

Natural Infection ◽

Fungal Growth ◽

Semiarid Region ◽

Species Determination ◽

First Report ◽

Plant Samples ◽

Onion Seed ◽

Plastic Bag ◽

Petri Plate ◽

Seed Crops

Nine fields direct-seeded with onion (Allium cepa L.) were surveyed in central Washington in the spring and summer of 2001 for Botrytis species associated with onion seed crops produced in this semiarid region. Forty plants were sampled from each field in a ‘W’ pattern in April, and 20 plants were similarly sampled from each field in June and July. Each plant was placed in a separate plastic bag, stored at 4 ± 2°C for 3 to 5 weeks, sliced lengthwise using a knife sterilized with 70% ethyl alcohol, incubated in a moist chamber for 5 days, and examined under a dissecting microscope. Fungal growth resembling Botrytis spp. was transferred to acidified potato dextrose agar (PDA) for species identification based on colony morphology, rate of growth, and spore and sclerotium characteristics (3). Cultures were incubated on a laboratory bench at 24 ± 4°C with 8 to 16 h of daylight. A species resembling B. porri (3) was detected in 3 fields in April at an incidence ranging from 3 to 28%, and in 2 of the same 3 fields in each of June and July at incidences ranging from 5 to 10%. Infected plants were asymptomatic at the time of sampling. The isolates formed brown, cerebriform sclerotia and sporulated sparsely. Subsamples of seed harvested from each field were assayed for Botrytis spp. To detect internal infection, 400 seeds from each of the nine fields were soaked in 0.525% NaOCl for 60 s, triple-rinsed in sterile deionized water, air dried, placed on a selective agar medium (2) with 20 seed per 9-cm-diameter petri plate, and incubated at 24°C (12 h day/night) for 14 days. Seeds were examined 5, 10, and 14 days after plating, and fungi resembling Botrytis spp. were transferred to acidified PDA for species determination. Isolates resembling B. porri were detected in 0.75% of seed from two of the three fields in which this species was isolated from plant samples. The internal transcribed spacer 1 region of ribosomal DNA of four isolates of the putative B. porri (two from plant samples and two from seed) were sequenced, and all four sequences matched that of B. porri registered in GenBank (Accession No. Z99666) most closely. Botrytis porri is a pathogen of garlic (A. sativum L.), leek (A. porrum L.), and wild garlic (A. vineale L.), but can infect onion and shallot (A. ascalonicum L.) when inoculated on these hosts (1). To our knowledge, this is the first report of natural infection of onion by B. porri, and the first report of seedborne B. porri on onion. References: (1) W. R. Jarvis. Pathology. Page 62 in: Botryotinia and Botrytis Species: Taxonomy, Physiology, and Pathogenicity. Canada Department of Agriculture, Monograph No. 15, 1977. (2) G. Kritzman and D. Netzer. Phytoparasitica 6:3, 1978. (3) A. H. Presly. Plant Pathol. 34:422, 1985.

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

First Report of a Carlavirus in Fuchsia spp. in New Zealand

Plant Disease ◽

10.1094/pdis-05-11-0443 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1484-1484 ◽

Cited By ~ 2

Author(s):

Z. Perez-Egusquiza ◽

L. W. Liefting ◽

S. Veerakone ◽

G. R. G. Clover ◽

M. Ciuffo

Keyword(s):

Electron Microscopy ◽

New Zealand ◽

Coat Protein ◽

Chenopodium Quinoa ◽

Plant Diseases ◽

Nucleotide Identity ◽

Impatiens Necrotic Spot Virus ◽

Rt Pcr ◽

First Report ◽

Genome Region

The genus Fuchsia has 110 known species and numerous hybrids. These ornamental plants with brightly colored flowers originate from Central and South America, New Zealand, and Tahiti, but a wider variety are now grown all over the world. Few viruses have been reported in Fuchsia spp.: a carlavirus, Fuchsia latent virus (FLV) (1–3), a cucumovirus, Cucumber mosaic virus (CMV) (3), and two tospoviruses, Impatiens necrotic spot virus (INSV) and Tomato spotted wilt virus (TSWV) (4). In August 2009, five plants, each representing a different cultivar of Fuchsia hybrid, from home gardens in the Auckland and Southland regions of New Zealand, displayed variable symptoms including mild chlorosis, mild mottle, or purple spots on leaves. Plants tested negative for CMV, INSV, and TSWV using commercial ImmunoStrips (Agdia Inc., Elkhart, IN); however, flexuous particles of ~650 to 700 nm were found by electron microscopy in all samples. Local lesions were also observed on Chenopodium quinoa plants 4 weeks after sap inoculation. Total RNA was extracted from all plants with a RNeasy Plant Mini Kit (Qiagen Inc., Doncaster, Australia) and tested by reverse transcription (RT)-PCR using two generic sets of primers (R. van der Vlugt, personal communication) designed to amplify fragments of ~730 and 550 bp of the replicase and coat protein genes of carlaviruses, respectively. Amplicons of the expected size were obtained for all samples, cloned, and at least three clones per sample were sequenced. No differences within clones from the same samples were observed (GenBank Accession Nos. HQ197672 to HQ197681). A BLASTn search of the viral replicase fragment showed the highest nucleotide identity (76%) to Potato rough dwarf virus (PRDV) (EU020009), whereas the coat protein fragment had maximum nucleotide identity (70 to 72%) to PRDV (EU020009 and DQ640311) and Potato virus P (DQ516055). Sequences obtained were also pairwise aligned using the MegAlign program (DNASTAR, Inc., Madison, WI) and results showed that the isolates had 83 to 97% identity to each other within each genome region. Further sequences (HQ197925 and HQ197926) were obtained from a Fuchsia plant originating from Belgium, a BLASTn analysis showed high nucleotide identity (84 to 99%) to the New Zealand isolates. The low genetic identity to other Carlavirus members suggests that these isolates belong to a different species from those previously sequenced. On the basis of electron microscopy and herbaceous indexing, the isolates had similar characteristics to a carlavirus reported from Fuchsia in Italy (1) and FLV reported in Canada (2). The Italian carlavirus isolate was obtained and tested with the same primers by RT-PCR. Pairwise analysis of the Italian sequences (HQ197927 and HQ197928) with the New Zealand and Belgian sequences showed between 84 and 95% similarity within each genome region. These results suggest that the carlavirus infecting these plants is the same virus, possibly FLV. To our knowledge, this is the first report of this carlavirus infecting Fuchsia spp. in New Zealand, but the virus has probably been present for some time in this country and is likely to be distributed worldwide. References: (1) G. Dellavalle et al. Acta Hortic. 432:332, 1996. (2) L. J. John et al. Acta Hortic. 110:195, 1980. (3) P. Roggero et al. Plant Pathol. 49:802, 2000. (4) R. Wick and B. Dicklow. Diseases in Fuchsia. Common Names of Plant Diseases. Online publication. The American Phytopathological Society, St. Paul, MN, 1999.

Download Full-text

First Report of Beet necrotic yellow vein virus Infecting Spinach in California

Plant Disease ◽

10.1094/pdis-94-5-0640a ◽

2010 ◽

Vol 94 (5) ◽

pp. 640-640 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

B. Mou ◽

K. Richardson ◽

S. T. Koike

Keyword(s):

Spinacia Oleracea ◽

Sandwich Elisa ◽

Chenopodium Quinoa ◽

Yellow Vein ◽

Mechanical Transmission ◽

Polymyxa Betae ◽

Rt Pcr ◽

First Report ◽

Vein Clearing ◽

Rigid Rod

In 2009, plants from two spinach (Spinacia oleracea) experimental fields in Monterey County and one commercial spinach field in Ventura County of California exhibited vein-clearing, mottling, interveinal yellowing, and stunting symptoms. For experimental fields, up to 44% of spinach plants have symptoms. With a transmission electron microscope, rigid rod-shaped particles with central canals were observed from plant sap of the symptomatic spinach. Analysis with a double-antibody sandwich-ELISA assay for Beet necrotic yellow vein virus (BNYVV) showed that all 10 symptomatic plants we tested were positive and 5 asymptomatic plants were negative. Symptomatic spinach from both counties was used for mechanical transmission experiments. Chenopodium quinoa, Tetragonia expansa, and Beta vulgaris (sugar beet) showed chlorotic local lesions and B. macrocarpa and spinach showed vein-clearing, mottling, and systemic infections. To further confirm the presence of BNYVV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from field- and mechanically inoculated symptomatic spinach plants using an RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR. Forward and reverse primers specific to the BNYVV RNA-3 P25 protein gene from the beet isolate were used (2). Amplicons of the expected size (approximately 860 bp) were obtained. Four RT-PCR products were sequenced and the sequences were identical (GenBank Accession No. GU135626). Sequences from the spinach plants had 97 to 99% nucleotide and 94 to 100% amino acid identity with BNYVV RNA-3 P25 protein sequences available in the GenBank. On the basis of the data from electron microscopy, indicator plants, serology, and cDNA sequencing, the virus was identified as BNYVV. BNYVV has been reported from spinach fields in Italy (1). To our knowledge, this is the first report of BNYVV occurring naturally on spinach in California. Since BNYVV is transmitted by the zoospores of the soil-inhabiting plasmodiophorid Polymyxa betae, it could be a new threat to spinach production in the state. References: (1) C. R. Autonell et al. Inf. Fitopatol. 45:43, 1995. (2) H.-Y. Liu and R. T. Lewellen, Plant Dis. 91:847, 2007.

Download Full-text

First Report on the Natural Occurrence of Cherry virus A in Mirabelle Plum (Prunus domestica var. insititia)

Plant Disease ◽

10.1094/pd-89-0433a ◽

2005 ◽

Vol 89 (4) ◽

pp. 433-433 ◽

Cited By ~ 5

Author(s):

L. Svanella-Dumas ◽

A. Marais ◽

P. Gentit ◽

J. Lamorte ◽

T. Candresse

Keyword(s):

Natural Infection ◽

Plant Viruses ◽

Natural Occurrence ◽

Prunus Domestica ◽

Rt Pcr ◽

Pcr Assay ◽

First Report ◽

Specific Pcr ◽

Specific Pcr Assay ◽

Prunus Spp

Cherry virus A (CVA) is a member of the Capillovirus genus (2). It was discovered serendipitously during cloning of the little cherry agent (2) and has since been shown to be relatively widespread in sweet and sour cherry (Prunus cerasus and P. avium) (2,3). It is currently unclear whether CVA is associated with any specific symptoms in these hosts. Although it can be transmitted by grafting and thus propagated in peach, it has not been reported to naturally infect any host other than cherry. Using a degenerate reverse transcription-polymerase chain reaction (RT-PCR) technique targeting a conserved region of the RNA-dependent RNA polymerase (RdRp) and allowing the amplification of members of the Trichovirus, Capillovirus, and Foveavirus genera of filamentous plant viruses (1), a number of symptomatic Prunus spp. germplasm were evaluated. Among these, a cv. Mirabelle dorée accession (Prunus domestica var. insititia P332) of French origin exhibited severe symptoms of rosetting, severe leaf and fruit deformation, and yellow mosaic occasionally turning necrotic. RT-PCR conducted on symptomatic samples produced an amplification product of the expected size (362 bp) in several independent experiments. Sequencing of these products yielded a single sequence (GenBank Accession No. AY792509) with 88.1% nucleotide identity and 93.2% amino acid identity with the type strain of CVA (2). Presence of a CVA isolate was independently confirmed using a CVA-specific PCR assay directly on the original plum material or following experimental transmission by grafting on several new hosts including apricot (P. armeniaca cv. Priana) and plum (P. domestica cv. Prune d'Ente). To our knowledge, this is the first report of natural infection of CVA in plum. The symptoms observed in the infected plum are reminiscent of those caused by severe Prune dwarf virus (PDV) strains. Infection by PDV was confirmed using a PDV-specific PCR assay. The contribution, if any, of CVA to the symptoms observed remains to be evaluated. These findings suggest that the possible presence of CVA in noncherry Prunus spp. hosts should be taken into consideration by quarantine and certification programs. References: (1) X. Foissac et al. Acta Hortic. 550:3743, 2001. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995. (3) M. J. Kirby et al. Plant Pathol. 50:6, 2001.

Download Full-text

First Report of Papaya ringspot virus and Zucchini yellow mosaic virus in Luohanguo (Siraitia grosvenorii) in China

Plant Disease ◽

10.1094/pd-89-0530a ◽

2005 ◽

Vol 89 (5) ◽

pp. 530-530 ◽

Cited By ~ 4

Author(s):

Y.-M. Liao ◽

X.-J. Gan ◽

B. Chen ◽

J.-H. Cai

Keyword(s):

Mosaic Virus ◽

Zucchini Yellow Mosaic Virus ◽

Viral Disease ◽

Ringspot Virus ◽

Yellow Mosaic Virus ◽

Watermelon Mosaic Virus ◽

Papaya Ringspot Virus ◽

Rt Pcr ◽

First Report ◽

Siraitia Grosvenorii

Luohanguo, Siraitia grosvenorii (Swingle) C. Jeffrey, is a perennial cucurbitaceous plant that is an economically important medicinal and sweetener crop in Guangxi province, China. Surveys conducted during the summer to fall seasons of 2003-2004 in northern Guangxi showed symptoms typical of a viral disease, including leaf mottling, mosaic, vein clearing, curling, and shoestring-like distortion in the field. Mechanical inoculation of sap from leaves of symptomatic plants collected from the surveyed areas caused similar symptoms on tissue culture-derived healthy Luohanguo plants. Two sequences of 0.7 and 1.6 kb with 88 and 97% identity to Papaya ringspot virus (PRSV) and Zucchini yellow mosaic virus (ZYMV) were amplified using reverse transcription-polymerase chain reaction (RT-PCR) with purified flexuous viral particles or total RNA extracted from the symptomatic Luohanguo leaves as templates with conserved degenerate potyvirus primers (1). To confirm the results, primers specific for PRSV (PP1/PP2, genome coordinates 4064-4083/5087-5069, GenBank Accession No X97251) and ZYMV (ZP1/ZP2, genome coordinates 5540-5557/7937-7920, GenBank Accession No L31350) were used to perform RT-PCR from the same RNA templates. The expected 1.0- and 2.3-kb fragments were amplified and they were 90 and 95% identical to PRSV and ZYMV in sequence, respectively. Watermelon mosaic virus was not detected. To our knowledge, this is the first report of the occurrence of PRSV and ZYMV in Luohanguo. Reference: (1) A. Gibbs et al. J. Virol. Methods 63:9, 1997.

Download Full-text

First Report of Alfalfa mosaic virus in Viburnum lucidum in Spain

Plant Disease ◽

10.1094/pdis-92-7-1132b ◽

2008 ◽

Vol 92 (7) ◽

pp. 1132-1132 ◽

Cited By ~ 2

Author(s):

M. C. Cebrián ◽

M. C. Córdoba-Sellés ◽

A. Alfaro-Fernández ◽

J. A. Herrera-Vásquez ◽

C. Jordá

Keyword(s):

Mosaic Virus ◽

Natural Infection ◽

Alfalfa Mosaic Virus ◽

The United States ◽

Rt Pcr ◽

Water Control ◽

First Report ◽

Pcr Product ◽

Pcr Assays ◽

The Mediterranean

Viburnum sp. is an ornamental shrub widely used in private and public gardens. It is common in natural wooded areas in the Mediterranean Region. The genus includes more than 150 species distributed widely in climatically mild and subtropical regions of Asia, Europe, North Africa, and the Americas. In January 2007, yellow leaf spotting in young plants of Viburnun lucidum was observed in two ornamental nurseries in the Mediterranean area of Spain. Symptoms appeared sporadically depending on environmental conditions but normally in cooler conditions. Leaf tissue from 24 asymptomatic and five symptomatic plants was sampled and analyzed by double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany) and Alfalfa mosaic virus (AMV) (SEDIAG S.A.S, Longvic, France). All symptomatic plants of V. lucidum were positive for Alfalfa mosaic virus (AMV). The presence of AMV was tested in the 29 samples by one-step reverse transcription (RT)-PCR with the platinum Taq kit (Invitrogen Life Technologies, Barcelona, Spain) using primers derived from a partial fragment of the coat protein gene of AMV (2). The RT-PCR assays produced an expected amplicon of 700 bp in the five symptomatic seropositive samples. No amplification product was observed when healthy plants or a water control were used as a template in the RT-PCR assays. One PCR product was purified (High Pure PCR Product Purification Kit; Roche Diagnostics, Mannheim, Germany) and directly sequenced (GenBank Accession No. EF427449). BLAST analysis showed 96% nucleotide sequence identity to an AMV isolate described from Phlox paniculata in the United States (GenBank Accession No. DQ124429). This virosis has been described as affecting Viburnum tinus L. in France (1). To our knowledge, this is the first report of natural infection of Viburnum lucidum with AMV in Spain, which might have important epidemiological consequences since V. lucidum is a vegetatively propagated ornamental plant. References: (1) L. Cardin et al. Plant Dis. 90:1115, 2006. (2) Ll. Martínez-Priego et al. Plant Dis. 88:908, 2004.

Download Full-text