First Report of Bacterial Leaf Spot of Cucurbita pepo Caused by Erwinia persicina in China

In February 2020, the common symptoms of water-soaked spots on Cucurbita pepo L. cotyledon were observed in Guangrao county in Shandong province, China. Field investigation showed that 40% of the Cucurbita pepo cotyledons in an area of approximately 0.8 ha were infected. The disease resulted in a severe loss in seedling production. Samples of C. pepo with water-soaked leaf spots were collected and prepared for pathogen analysis. Symptomatic cotyledon tissue was surface disinfested in 75% ethanol for 30 sec, then rinsed three times in sterilized water. Bacteria were released in sterile water in Petri dish for 2 min by cutting symptomatic tissue into small sections and stirring the plant tissue mixture fully. The diffusate was streaked onto plates containing nutrient agar (NA) and plates were incubated at 28℃ for 2 days. Three representative isolates were purified eventually from each of the plates. Colonies on NA were small, round and with smooth margins. All bacterial isolates characterized as gram-negative, white to cream color, and pink pigment was formed on the plates over long-term culture. The isolates were positive for catalase, VogesProskauer, potato rot, methyl red, acetoin production, nitrate utilization and citrate utilization, and acid production from maltose, glucose, melezitose, sucrose, D-arabinose, D-trehalose, cellobiose, lactose, raffinose, mannitol, D-sorbitol, melibiose and xylitol. KOH production was demonstrated according to strand formation within the potassium hydroxide test (Suslow et al. 1982). Isolates were negative for oxidase, arginine dihydrolase, phenylalanine deaminase, gelatinase, esculine, indole production and H2S production. Total genomic DNA was extracted from isolate XHL2002230201 with TIANamp Bacteria DNA Kit (TIANGEN). Universal primers 27F and 1492R (Monciardini et al. 2002) were used in PCR to amplify a 1,307-bp DNA fragment of the 16S rRNA region for molecular identification. Furthermore, four additional housekeeping genes (gyrB, atpD, rho, and rpoS) were selected and amplified using specially designed primers. The amplification products of 16S rRNA were sequenced and submitted to GenBank under accession number (MT568607.1). Sequence analysis showed 99% similarity to Erwinia persicina strains B57 (LM651373.1) and B64 (CI789_17875) by BLAST search in GenBank database (Gálvez et al. 2015; Cho et al. 2019). A phylogenetic tree was constructed, and the taxonomic position of strain XHL2002230201 was determined from the multilocus sequence analysis (MLSA) on 16S rRNA and other four housekeeping genes with E. persicina and not with other closely related Erwinia species. Pathogenicity tests and re-isolation and re-identification of the bacteria were performed to confirm the isolate and fulfill the Koch' postulates. The strain XHL2002230201 suspensions (108 CFU ml−1) were spray inoculated onto fifteen Cucurbita pepo seedlings with two true leaves, and the same number of control plants were inoculated with water. Experiments were repeated three times. All inoculated plants were kept in a moist chamber placed in a greenhouse at 28℃. Initial symptoms were observed on leaves of inoculated plants at 5 days post-inoculation, whereas no symptoms appeared on the plants inoculated with sterile distilled water. Based on morphological and biochemical characteristics, phylogenetic analysis, and Koch's postulates, the bacterial isolates were identified as E. persicina. To our knowledge, this is the first report of E. persicina causing leaf spot disease on Cucurbita pepo in China.

Download Full-text

First Report of a Leaf Spot on Snow Lotus Caused by Alternaria carthami in China

Plant Disease ◽

10.1094/pdis-92-2-0318b ◽

2008 ◽

Vol 92 (2) ◽

pp. 318-318

Author(s):

S. Zhao ◽

G. Xie ◽

H. Zhao ◽

H. Li ◽

C. Li

Keyword(s):

Leaf Spot ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Tianshan Mountain ◽

Causal Organism ◽

Saussurea Involucrata ◽

First Report ◽

Spot Disease ◽

Initial Symptoms ◽

Snow Lotus

Snow lotus (Saussurea involucrata Karel. & Kir. ex Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. In June of 2005, a leaf spot disease on commercially grown plants was found in the QiTai Region, south of the Tianshan Mountain area of Xinjiang, China at 2,100 m above sea level. Disease incidence was approximately 60 to 70% of the plants during the 2006 and 2007 growing seasons. Initial symptoms appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the leaflet blade by July. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. A fungus was consistently isolated from the margins of these lesions on potato dextrose agar. Fifty-eight isolates were obtained that produced abundant conidia in the dark. Conidia were usually solitary, rarely in chains of two, ellipsoid to obclavate, with 6 to 11 transverse and one longitudinal or oblique septum. Conidia measured 60 to 80 × 20 to 30 μm, including a filamentous beak (13 to 47 × 3.5 to 6 μm). According to the morphology, and when compared with the standard reference strains, the causal organism of leaf spot of snow lotus was identified as Alternaria carthami (1,4). Pathogenicity of the strains was tested on snow lotus seedlings at the six-leaf stage. The lower leaves of 20 plants were sprayed until runoff with conidial suspensions of 1 × 104 spores mL–1, and five plants sprayed with sterile distilled water served as controls. All plants were covered with a polyethylene bag, incubated at 25°C for 2 days, and subsequently transferred to a growth chamber at 25°C with a 16-h photoperiod. Light brown lesions developed within 10 days on leaflet margins in all inoculated plants. The pathogen was reisolated from inoculated leaves, and isolates were deposited at the Key Oasis Eco-agriculture Laboratory of Xinjiang Production and Construction Group, Xinjiang and the Institute of Biotechnology, Zhejiang University. No reports of a spot disease caused by A. carthami on snow lotus leaves have been found, although this pathogen has been reported on safflower in western Canada (3), Australia (2), India (1), and China (4). To our knowledge, this is the first report of a leaf spot caused by A. carthami on snow lotus in China. References: (1) S. Chowdhury. J. Indian Bot. Soc. 23:59, 1944. (2) J. A. G. Irwin. Aust. J. Exp. Agric. Anim. Husb. 16:921, 1976. (3) G. A. Petrie. Can. Plant Dis. Surv. 54:155, 1974. (4) T. Y. Zhang. J. Yunnan Agric. Univ.17:320, 2002.

Download Full-text

First Report of a Leaf Spot Disease of Bells-of-Ireland (Moluccella laevis) Caused by Cercospora apii in California

Plant Disease ◽

10.1094/pdis.2003.87.2.203a ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203

Author(s):

S. T. Koike ◽

S. A. Tjosvold ◽

J. Z. Groenewald ◽

P. W. Crous

Keyword(s):

Leaf Spot ◽

Sequence Data ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Spot Disease ◽

Leaf Spots ◽

Initial Symptoms

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.

Download Full-text

First Report of a Leaf Spot Disease of Tobacco Caused by Pseudomonas cichorii in China

Plant Disease ◽

10.1094/pdis-10-21-2158-pdn ◽

2021 ◽

Author(s):

Dayu Lan ◽

Fangling Shu ◽

Yanhui Lu ◽

Anfa Shou ◽

Wei Lin ◽

...

Keyword(s):

Pseudomonas Syringae ◽

Leaf Spot ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Pseudomonas Cichorii ◽

Koch’S Postulates ◽

First Report ◽

Initial Symptoms ◽

Wide Range ◽

Koch's Postulates

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.

Download Full-text

First Report of Leaf Spot Caused by Myrothecium roridum on Coffea canephora in Brazil

Plant Disease ◽

10.1094/pdis-06-14-0643-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1587-1587 ◽

Cited By ~ 3

Author(s):

A. D. A. Silva ◽

D. B. Pinho ◽

H. Costa ◽

U. P. Lopes ◽

O. L. Pereira

Keyword(s):

Leaf Spot ◽

Its Region ◽

Coffea Canephora ◽

Leaf Spot Disease ◽

Isolation And Identification ◽

Espírito Santo ◽

First Report ◽

Initial Symptoms ◽

Myrothecium Roridum ◽

Espirito Santo

Coffea canephora (conilon coffee) represents approximately 30% of the coffee marketed worldwide. The state of Espírito Santo is the largest conilon coffee-producing state in Brazil. In 2013 and 2014, leaves with a leaf spot were observed on most of the conilon coffee seedlings in a commercial nursery in Laranja da Terra, Espírito Santo, Brazil. The infected leaves were deposited in the VIC Herbarium (VIC 42482) and a pure single-spore culture of the pathogen was deposited in the culture collection of the Universidade Federal de Viçosa (Accession No. COAD 1729). The initial symptoms were circular, brown to dark brown lesions with yellow margins occurring on both leaf surfaces. In high humidity, concentric rings formed and the lesions expanded rapidly to reach up to 30 mm in diameter, and later became dark brown with a grayish center. Black sporodochia with white, and marginal mycelial tuffs bearing black spore masses were observed in the older lesions. These symptoms were consistent with those of Myrothecium leaf spot reported on Coffea spp. (3). Microscopic observation revealed aseptate, hyaline, and cylindrical conidia, rounded at both ends, greenish to black in mass, and 5 to 6 μm long and 1 to 2 μm wide. The symptoms and morphological characteristics described above matched the description of Myrothecium roridum Tode (4). To confirm this identification, DNA was extracted using a Wizard Genomic DNA Purification Kit and the sequence of an internal transcribed spacer (ITS) region was obtained and deposited in GenBank (Accession No. KJ815095). The sequence of the ITS region exhibited 100% identity over 561 bp with another M. roridum sequence in GenBank (JF343832). To verify the pathogenicity of the fungus, healthy leaves of the C. canephora clones 12v and 14 (four seedlings each) were wounded superficially with a sterilized needle and inoculated by spraying them with a suspension of M. roridum conidia (106 conidia ml−1). The seedlings were covered with plastic bags and incubated in a growth chamber at 25°C under a photoperiod of 12 h light/12 h dark for 5 days. The control seedlings were sprayed with distilled water and incubated similarly. Fifteen days after inoculation, symptoms in all inoculated seedlings were consistent with those initially observed on the naturally infected seedlings, whereas the controls remained healthy. Re-isolation and identification confirmed Koch's postulates. M. roridum has a wide host range, and symptoms were similar to those reported in other hosts of the pathogen in Brazil (2,3). There is only one report of M. roridum on C. canephora in Colombia (1); however, this pathogen was previously reported on C. arabica in Brazil, Colombia, Costa Rica, Guatemala, India, Indonesia, Puerto Rico, and the Virgin Islands (1,3). To our knowledge, this is the first report of a leaf spot caused by M. roridum on conilon coffee in Brazil. The cultivation of conilon coffee is increasing and the reported leaf spot disease affects the quality of the seedlings in nurseries. It is therefore important to conduct a thorough study of management strategies for this disease. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab. ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases , 27 May 2014. (2) A. M. Quezado Duval et al. Braz. J. Microbiol. 41:246, 2010. (3) S. F. Silveira et al. Fitopatol. Bras. 32:440, 2007. (4) M. Tulloch. Mycol. Pap. No. 130. CMI, Wallingford, UK, 1972.

Download Full-text

First Report of Bacterial Leaf Spot of Rieger Begonia Caused by Xanthomonas campestris pv. begoniae in China

Plant Disease ◽

10.1094/pdis-04-12-0391-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 282-282 ◽

Cited By ~ 2

Author(s):

L. H. Zhou ◽

G. H. Ji

Keyword(s):

Leaf Spot ◽

Xanthomonas Campestris ◽

Infection Process ◽

Leaf Spot Disease ◽

Leaf Margin ◽

Bacterial Strains ◽

Bacterial Leaf Spot ◽

First Report ◽

Initial Symptoms ◽

Phosphate Buffered Saline

Rieger begonia are collectively referred to as a begonia hybrid group. Its global annual sales is 90,000,000 cutting seedlings. It is one of the top ten potted plants. In the summer of 2011, serious outbreaks of a suspected bacterial leaf spot disease were observed on five Rieger begonia cultivars (Dark Britt, Rebecca, Blitz, Barkos, and Borias). These plants were grown for potted cutting seedling production in commercial nurseries located in Shilin county of Yunnan Province, China. The initial symptoms of the disease were small circular or polygonal water-soaked needle spots on leaf margin that later these spots expanded and joined together, forming bigger inverted V-shaped necrotic specks (4). Yellow-pigmented bacterial colonies were consistently isolated from diseased leaves and stems on NA agar medium and incubated at 28°C. Twelve bacterial strains were isolated and used for further studies. All the isolates were Gram-negative, rod-shaped, motile, aerobic, and non-sporing. All of the bacterial strains isolated in the present study were identified as Xanthomonas campestris pv. begoniae (Xcb) based on biochemical and physiological identification (Biolog carbon source utilization analysis) and 16S rDNA sequences analysis and further pathogenicity determination (1). The results show that the sequence homology rate of HT1-1 (GenBank Accession No. JN648097) and X. euvesicatoria (syn. X. campestris pv vesicatoria) (GeneBank Accession No. AM039952) is 99%. This strongly suggests that the Rieger begonia isolates belong to X. campestris pv. begoniae (2). For Koch's postulates, 10 surface-disinfected young leaves from five susceptible Rieger begonia plants (cv. Dark Britt) were inoculated by spraying a phosphate-buffered saline suspension of each bacterial isolate (3.0 × 108 CFU/ml) onto the leaves (3). Controls were inoculated similarly with phosphate-buffered saline solution. All inoculated plants were covered with polyethylene bags for 24 h at 25°C and then put in the greenhouse. After inoculation, water-soaked and necrotic symptoms were observed on inoculated Rieger begonia leaves within 7 to 9 days. No symptoms were observed on controls. Bacteria were reisolated and confirmed to be identical to the original isolates by the methods described above. To our knowledge, this is the first report of Xcb causing leaf spot on Rieger begonia plants in China. The infection process of Xcb on Rieger begonia plants and rapid detection of this pathogen are underway. References: (1) M. R. Gillings et al. PNAS 12:102, 2005. (2) C. L. Oliver et al. Plant Dis. 4:96, 2012. (3) H. Ornek et al. New Dis. Rep. 13:40, 2006. (4) O. Pruvost et al. Plant Dis. 4:96, 2012.

Download Full-text

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽

10.1094/pdis-03-13-0317-pdn ◽

2013 ◽

Vol 97 (10) ◽

pp. 1375-1375 ◽

Cited By ~ 1

Author(s):

B. Dutta ◽

R. D. Gitaitis ◽

F. H. Sanders ◽

C. Booth ◽

S. Smith ◽

...

Keyword(s):

16S Rrna ◽

16S Rrna Gene ◽

Leaf Spot ◽

Pathogenic Bacteria ◽

Bacterial Suspension ◽

Rrna Gene ◽

Bacterial Isolates ◽

Pcr Assay ◽

First Report ◽

The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Download Full-text

First Report of Corynespora cassiicola Causing Leaf Spot on Akebia trifoliate

Plant Disease ◽

10.1094/pdis-04-13-0454-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1659-1659 ◽

Cited By ~ 2

Author(s):

Y. F. Ye ◽

N. Jiang ◽

G. Fu ◽

W. Liu ◽

F. Y. Hu ◽

...

Keyword(s):

Leaf Spot ◽

Sequence Similarity ◽

Yangtze River Basin ◽

Morphological Characteristics ◽

Colletotrichum Acutatum ◽

Leaf Spot Disease ◽

Corynespora Cassiicola ◽

High Sequence Similarity ◽

First Report ◽

Initial Symptoms

Akebia species have been used for centuries in medicinal practices in a few Asian countries such as China and Japan. The dried stems of Akebia trifoliata are known as mutong in the Chinese pharmacopoeia (4) and mokutsu in Kampo, the traditional Chinese medicine developed in Japan (2). In China, the plant is grown in the provinces of Shandong, Hebei, Shanxi, Henan, Gansu, and some provinces in the south of the Yangtze River basin. During the summer of 2012, a leaf spot disease was detected on A. trifoliata grown in Nanning, Guangxi, China. The disease occurred and spread rapidly in July under conditions of high temperature and high humidity. The symptoms appeared on three sites that we inspected; disease incidences were higher than 80%. Initial symptoms consisted of small (less than 5 mm in diameter), circular, purple-brown leaf spots. Spots later enlarged and became elliptical, circular, or irregular with gray-white centers and dark brown rims. The centers were slightly concave. The spots could coalesce with each other, resulting in leaf desiccation and wilting. A fungal isolate was obtained from symptomatic leaf tissue that taken from a field (22°50′N, 108°22′E) in Nanning, Guangxi, China. Single-spore culture of the isolate was incubated on potato dextrose agar (PDA) for 7 days in the dark at 28°C. Conidiophores were straight to slightly curved, unbranched, and pale brown. Conidia (19.0 to 140.5 μm long and 7.0 to 11.0 μm wide) were formed singly or in chains, obclavate to cylindrical, straight or curved, pale brown, with a rounded apex and truncate base, and 1 to 13 pseudosepta. Morphological characteristics of the isolate were similar to the descriptions of Corynespora cassiicola (Berk. & M.A. Curtis) C.T. Wei (1). Genomic DNA of the isolate was extracted and used for PCR amplification of rDNA-ITS (internal transcribed spacer) sequence with primers ITS1 and ITS4. The PCR products were purified and sequenced. The sequence (GenBank Accession No. KC977496) was used in BLAST searches to interrogate GenBank for sequence similarity. High sequence similarity of 100% was obtained with several C. cassiicola strains. Pathogenicity of the isolate was investigated to demonstrate Koch's postulate. Young, healthy, fully expanded green leaves of A. trifoliata were surface sterilized. Fifteen leaves were inoculated with 10-μl drops of conidia suspension (105 conidia per ml) and 10 leaves were inoculated with the same volume of sterile water to serve as controls. All the leaves were placed in a humid chamber for 5 days. Spots with similar symptoms to those observed in the field developed on all inoculated leaves. The pathogen was reisolated and identified as C. cassiicola. The controls remained symptomless. According to previous reports, A. trifoliata was infected by Alternaria tenuissima in China and by Colletotrichum acutatum in Japan (3). To our knowledge, this is the first report of C. cassiicola found on Akebia species worldwide. Furthermore, this new disease primarily affects plantations and reduces the quality and yield of the medicine. Some effective measures should be taken to control this disease. References: (1) M. B. Ellis and P. Holliday. CMI Description of Pathogenic Fungi and Bacteria, 303, 1971. (2) F. Kitaoka et al. J. Nat. Med. 63:374, 2009. (3) Y. Kobayshi et al. J. Gen. Plant Pathol. 70:295, 2004. (4) L. Li et al. HortScience 45:4, 2010.

Download Full-text

First Report of Gray Leaf Spot of Mango (Mangifera indica) Caused by Pestalotiopsis mangiferae in Taiwan

Plant Disease ◽

10.1094/pdis-91-12-1684b ◽

2007 ◽

Vol 91 (12) ◽

pp. 1684-1684 ◽

Cited By ~ 6

Author(s):

Y. Ko ◽

K. S. Yao ◽

C. Y. Chen ◽

C. H. Lin

Keyword(s):

Leaf Spot ◽

Mangifera Indica ◽

Gray Leaf Spot ◽

Leaf Spot Disease ◽

Continuous Exposure ◽

Conidial Suspension ◽

Tropical Fruit ◽

First Report ◽

Spot Disease ◽

Initial Symptoms

Mango (Mangifera indica L.; family Anacardiaceae) is one of the world's most important fruit crops and is widely grown in tropical and subtropical regions. Since 2001, a leaf spot disease was found in mango orchards of Taiwan. Now, the disease was observed throughout (approximately 21,000 ha) Taiwan in moderate to severe form, thus affecting the general health of mango trees and orchards. Initial symptoms were small, yellow-to-brown spots on leaves. Later, the irregularly shaped spots, ranging from a few millimeters to a few centimeters in diameter, turned white to gray and coalesced to form larger gray patches. Lesions had slightly raised dark margins. On mature lesions, numerous black acervuli, measuring 290 to 328 μm in diameter, developed on the gray necrotic areas. Single conidial isolates of the fungus were identified morphologically as Pestalotiopsis mangiferae (Henn.) Steyaert (2,3) and were consistently isolated from the diseased mango leaves on acidified (0.06% lactic acid) potato dextrose agar (PDA) medium incubated at 25 ± 1°C. Initially, the fungus grew (3 mm per day) on PDA as a white, chalky colony that subsequently turned gray after 2 weeks. Acervuli developed in culture after continuous exposure to light for 9 to 12 days at 20 to 30°C. Abundant conidia oozed from the acervulus as a creamy mass. The conidia (17.6 to 25.4 μm long and 4.8 to 7.1 μm wide) were fusiform and usually straight to slightly curved with four septa. Three median cells were olivaceous and larger than the hyaline apical and basal cells. The apical cells bore three (rarely four) cylindrical appendages. Pathogenicity tests were conducted with either 3-day-old mycelial discs or conidial suspension (105 conidia per ml) obtained from 8- to 10-day-old cultures. Four leaves on each of 10 trees were inoculated. Before inoculation, the leaves were washed with a mild detergent, rinsed with tap water, and then surface sterilized with 70% ethanol. Leaves were wounded with a needle and exposed to either a 5-mm mycelial disc or 0.2 ml of the spore suspension. The inoculated areas were wrapped with cotton pads saturated with sterile water and the leaves were covered with polyethylene bags for 3 days to maintain high relative humidity. Wounded leaves inoculated with PDA discs alone served as controls. The symptoms described above were observed on all inoculated leaves, whereas uninoculated leaves remained completely free from symptoms. Reisolation from the inoculated leaves consistently yielded P. mangiferae, thus fulfilling Koch's postulates. Gray leaf spot is a common disease of mangos in the tropics and is widely distributed in Africa and Asia (1–3); however, to our knowledge, this is the first report of gray leaf spot disease affecting mango in Taiwan. References: (1) T. K. Lim and K. C. Khoo. Diseases and Disorders of Mango in Malaysia. Tropical Press. Malaysia, 1985. (2) J. E. M. Mordue. No. 676 in: CMI Descriptions of Pathogenic Fungi and Bacteria. Surrey, England, 1980. (3) R. C. Ploetz et al. Compendium of Tropical Fruit Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text

First Report of Leaf Spot Disease of Peony Caused by Seimatosporium botan in China

Plant Disease ◽

10.1094/pdis-10-10-0735 ◽

2011 ◽

Vol 95 (2) ◽

pp. 226-226

Author(s):

Y. B. Duan ◽

Z. Z. Yu ◽

Y. B. Kang

Keyword(s):

Basal Cell ◽

Leaf Spot ◽

Apical Cell ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Humid Atmosphere ◽

First Report ◽

Spot Disease ◽

Initial Symptoms

Tree peony (Paeonia suffruticosa Andrews), a perennial ligneous deciduous shrub in the Paeoniaceae family, is known for its beautiful and charming flowers. It is regarded as the flower symbol of China and is cultivated throughout the country. In August 2008, a previously unknown leaf spot was observed on peony cultivated in the Mountain Peony Garden located in the Luoyang area of Henan Province, China. In 2009, the leaf spot disease was observed in some gardens in the city of Luoyang, China. Initial symptoms appeared as small, round or irregular, brown, necrotic lesions in the middle of leaves. These lesions gradually enlarged up to 1 cm in diameter and were circular or irregular, brown to dark brown, and brown on the margins. In a humid atmosphere, black, sessile, discoid acervuli developed on the lesions, and the lesions sometimes became waxy-like, eventually coalesced, and nearly covered the entire leaf. Conidia produced in acervuli had two morphologically different types. One type had a single basal appendage, ellipsoid to fusiform, transversely three septate, 16 to 20 × 5 to 7 μm, smooth, basal cell obconic with a truncate base, subhyaline, 3 to 5 μm long; two central cells subcylindrical to dolioform, brown to dark brown, 8 to 10 μm long, apical cell conical with rounded apex, concolorous with the central cells, 4 to 5 μm long, basal appendage filiform, unbranched, excentric, 4 to 8 μm long. The other type had a single appendage at both ends, fusiform to subcylindrical, transversely three septate, 16 to 20 × 4 to 5 μm, smooth; basal cell obconic with a truncate base, subhyaline, 4 to 5 μm long; two central cells subcylindrical to dolioform, pale brown, 8 to 11 μm long; apical cell conical with an acute apex, hyaline to subhyaline, 4 to 5 μm long; basal appendage filiform, unbranched, excentric, 4 to 8 μm long; apical appendage filiform, unbranched, 4 to 8 μm long. Single conidial isolates of both types of conidia yielded identical colonies, which produced both types of conidia on potato dextrose agar (PDA), thus showing that both types of conidia belonged to the same fungus. Colonies on PDA were slimy in appearance, yellow to villous with an irregular taupe margin; reverse brown to grayish brown. Cultural and conidial characteristics of the isolates were similar to those of Seimatosporium botan (1). The DNA sequence for the fungus showed internal transcribed spacer region (ITS1-5.8S-ITS2) sequences (GenBank Accession No. HM067840) with 93% sequence identity to S. discosioides (Accession Nos. EF600970.1 and EF600969.1). This is the first submission of a S. botan sequence to GenBank. To determine pathogenicity, 20 healthy leaves of P. suffruticosa were inoculated by spraying a conidial suspension of S. botan onto the foliage. Ten leaves were sprayed with sterile water and served as controls. Plants were covered with plastic for 24 h to maintain high relative humidity. After 15 days, the symptoms described above were observed on leaves in all inoculated plants, whereas symptoms did not develop on the control plants. The pathogen was reisolated from inoculated leaves, fulfilling Koch's postulates. On the basis of morphology and ITS region sequences, we conclude that S. botan is the causal agent of leaf spots of P. suffruticosa. There is a report of S. botan on P. suffruticosa stems in Japan (1), but to our knowledge, this is the first report of leaf spot disease of peony caused by S. botan in China. References: (1) S. Hatakeyama et al. Mycoscience 45:106, 2004.

Download Full-text

First Report of Leaf Spot Caused by Corynespora cassiicola on Viburnum odoratissimum Ker-Gawl. var. awabuki (K. Koch) Zabel ex Rumpl. (sweet viburnum) in China

Plant Disease ◽

10.1094/pdis-04-21-0849-pdn ◽

2021 ◽

Author(s):

Tianning Zhang ◽

Huanhuan Liu ◽

Qingni Song ◽

Jun Liu ◽

Qingpei Yang ◽

...

Keyword(s):

Leaf Spot ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Puncture Wound ◽

First Report ◽

Leaf Spots ◽

Fungal Isolates ◽

Initial Symptoms ◽

Viburnum Odoratissimum ◽

Sweet Viburnum

Sweet viburnum [Viburnum odoratissimum Ker-Gawl. var. awabuki (K. Koch) Zabel ex Rumpl.] belonging to the family Adoxaceae, is a medical and landscape plant, native to Korea (Jeju Island), Taiwan, and Japan (Edita 1988). In June and September 2019, leaf spots were observed on approximately 65% to 80% of sweet viburnum plants in a hedgerow located in Fenghe Xincheng District (28°41'52.9"N 115°52'14.3"E) in Nanchang, China. Initial symptoms of disease appeared as dark brown spots surrounded by red halos (Figure 1 A), which expanded irregularly. Finally, the center of the lesions desiccated and became light-brown, surrounded by a deep-red halos (Figure 1 B). Ten leaf samples with typical symptoms were collected and washed with tap water for about 15 min. The tissue between the healthy and necrotic area (ca. 4 mm × 4 mm) was cut with a sterile scalpel and surface sterilized with 70% alcohol for 45 s, 2% NaClO for 2 min, washed in sterile deionized water three times, dried on sterilized filter paper, then placed in Petri dishes and incubated at 25℃ in the dark. After 3 to 5 days, the hyphal tips from the edges of growing colonies were transferred to fresh PDA dishes. Eventually, 54 fungal isolates were obtained and, of these, 39 isolates were identical in their morphological characteristics. Morphological analysis was performed according with Ellis (1971). The isolate S18, chosen as representative, formed a gray to grayish brown colony with concentric circleson PDA, and a diameter of 8.5 to 9 cm after 7 days incubation at 25℃ (Figure 1 G). Conidia were hyaline, straight or slightly curved, needle shaped, truncate at the base, and acuminate at the tip, with 2 to 6 pseudosepta, 18.90 to 38.38 µm (avg. = 27.51 µm) × 1.64 to 4.50 µm (avg. = 2.60 µm) (n = 36) (Figure 1 H). The genes of fungal isolates (i.e., ITS, tub2 and ACT) were amplified with ITS4/ITS5 for ITS (White, Bruns et al. 1990), Bt2a/Bt2b for tub2 (Glass and Donaldson 1995) and ACT783R/ACT512F for ACT (Carbone and Kohn 1999) and sequenced. The sequences were deposited in GenBank (MW165772 for ITS, MW175900 for ACT and MW168659 for tub2), which showing greater than 99.1% similarity to multiple C. cassiicola accessions, respectively. Pathogenicity tests were performed on healthy leaves in field by inoculating surface-sterilized mature leaves with puncture wound (Figure C) and non-wounded young leaves with 20 µL of a conidial suspension (105 conidia ml-1) (Figure F and G) at 26℃. After 4 to 7 days, all inoculated leaves reproduced similar symptoms as observed initially in the field (Figure 1 C, E and F). To fulfill Koch’s postulates, the fungus was isolated on PDA from the margins of leaf spots on inoculated leaves and confirmed as C. cassiicola by morphological characters and ITS gene sequencing. Previously, C. cassiicola was reported as an endophyte on Viburnum spp. and Viburnum odoratissimum (Alfieri et al. 1994). More recently, C. cassiicola has been reported as a pathogen of many plant species in China, such as kiwifruit (Cui, Gong et al. 2015), American sweetgum (Mao, Zheng et al. 2021), castor bean (Tang, Liu et al. 2020), and holly mangrove (Xie, He et al. 2020). To our knowledge, this is the first report of leaf spot disease on sweet viburnum caused by C. cassiicola in China and the precise identification of the causal agent will be useful for its management.

Download Full-text