First report of Neofusicoccum parvum causing canker on Castanea sativa in Spain

In April 2021, depressed bark with dark reddish coloration was observed on the stem of a five-year-old chestnut (Castanea sativa Mill.) plant, acquired from a commercial Galician nursery. One tissue sample was collected from the injury of this plant, surface-sterilized with 96% ethanol for 30 s and dried on sterilized tissue paper, plated on potato dextrose agar (PDA) and incubated at 25ºC. Fungal colonies were consistently isolated and after 5 days developed abundant greyish-white aerial mycelium. Two weeks later pycnidia with fusiform conidia were observed. For molecular identification, internal transcribed spacer (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTAT TGATATGC, White et al. 1990), beta-tubulin (BT2a: GGTAACCAAATCGGT GCTGCTTTC, BT2b: ACCCTCAGTGTAGTGACCCTTGGC, Glass & Donaldson 1995) and elongation factor (EF1-728F: CATCGA GAAGTTCGAGAAGG, EF1-1199R: GGGAAGTACCMGTGATCATGT, Walker et al. 2010) were amplified. BLAST analysis showed that ITS sequence of isolate LPPAF-971 (accession no. MZ314849) showed 99.63% identity with Neofusicoccum parvum isolates ACBA15 (accession no. KX244803) and mywxxq (accession no. MW767713), and 99.4% identity with isolate CMW9081T (accession no. AY230943). Beta-tubulin sequence (accession no. MZ561053) showed 100% identity with isolate GDTCMF1 (accession no. MN022786), and elongation factor sequence (accession no. MZ561054) showed 98.70% identity with isolate F7 (accession no. MN461166), all corresponding with N. parvum. Pathogenicity tests were carried out on ten five-year-old chestnut plants on which a 5mm PDA plug from the edge of an actively growing colony of the fungus was inoculated by a cut in the bark of one to three branches per plant up to a total of 16 inoculated branches and then wrapped with Parafilm©. Five plants inoculated with one plug of PDA without the fungus were used as controls. Plants were placed in a plastic tunnel with a lateral insect net, provided with drip irrigation and grown under natural conditions. Bark cankers symptoms similar to the one observed in the original sample were visible on all inoculated chestnut plants ten days after inoculation. No symptoms were observed on the controls. The assay was conducted twice. Fungal colonies morphologically identified as N. parvum were reisolated from bark cankers on inoculated chestnut plants, fulfilling Koch’s postulates. C. sativa is a widely distributed multipurpose tree, with important economic, environmental, cultural, and heritage functions (Bounous & Beccaro 2019), which underlines the importance of this finding with a view on its sanitary control. In addition, N. parvum, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & Phillips (Crous et al. 2006), is the causal agent of cankers and dieback in many crops and trees (Phillips et al. 2013) worldwide, but until now it had not been detected in C. sativa. To the best of our knowledge, this is the first report worldwide of N. parvum causing disease on chestnut in Spain. References: Bounous G & Beccaro G. 2019. Pp. 1. In: The Chestnut Handbook-Crop & Forest Management. Eds. Beccaro et al. CRC Press, Taylor & Francis Group. Crous PW et al. 2006. Stud. Mycol. 55: 235. doi.org/10.3114/sim.55.1.235 Glass NL & Donaldson GC. 1995. Appl Environ Microbiol 61: 1323. doi: 10.1128/aem.61.4.1323-1330 Phillips AJL et al. 2013. Stud. Mycol. 76: 51. doi:10.3114/sim0021 Walker DM et al. 2010. Mycologia 102: 1479. doi: 10.3852/10-002 White TJ et al. 1990. Pp. 315 In: PCR Protocols: a guide to methods and applications. Academic Press, San Diego, CA.

Download Full-text

First Report of Neofusicoccum parvum Associated with Chestnut Nut Rot in Italy

Plant Disease ◽

10.1094/pdis-01-21-0072-pdn ◽

2021 ◽

Author(s):

Salvatore Seddaiu ◽

Antonietta Mello ◽

Clizia Sechi ◽

Anna Cerboneschi ◽

Benedetto T. Linaldeddu

Keyword(s):

Elongation Factor ◽

Pcr Amplification ◽

Castanea Sativa ◽

Aerial Mycelium ◽

Mediterranean Area ◽

Morphological Characters ◽

Internal Transcribed Spacer Region ◽

Neofusicoccum Parvum ◽

First Report ◽

Sweet Chestnut

In autumn 2018, during a study on the pathogens involved in the etiology of chestnut nut rot symptoms observed in three of the main sweet chestnut (Castanea sativa) growing areas in Sardinia (Site 1: 39°56′55”N/09°11′45”E; site 2: 39°58’20”N/09°09′41”E; site 3: 40°52’50”N/09°08’45”E), Gnomoniopsis smithogilvyi was found to be the main causal agent. In addition to G. smithogilvyi, 15 out of 450 nuts processed, yielded on potato dextrose agar (PDA, 39 g/L) at 22°C white colonies with dense aerial mycelium becoming dark grey after 4 to 7 days. Pycnidia were produced within 4 weeks in half-strength PDA incubated at room temperature under natural daylight. The hyaline, ellipsoid to fusiform and aseptate conidia measured 13.4–19.2 × 4.8–7.7 μm (n = 50). All morphological characters matched those reported for Neofusicoccum parvum by Phillips et al. (2013). Identity of isolates was confirmed by DNA sequence analysis of the internal transcribed spacer region (ITS) and part of the translation elongation factor 1-alpha gene (tef1-α). DNA extraction, PCR ampliﬁcation reactions and DNA sequencing were carried out according to Linaldeddu et al. (2016). In the phylogenetic analysis based on combined ITS and tef1-α gene sequences the N. parvum isolates clustered within two well-supported subclades. In the first subclade (ML bootstrap = 88%) three isolates clustered together with the ex-type culture of N. parvum (CMW9081) while in the second subclade (ML bootstrap = 95%) three isolates clustered together with the ex-type culture of Neofusicoccum algeriense (CBS 137504), a species recently synonymised with N. parvum by Lopes et al. (2016). Sequences of six representative isolates were deposited in GenBank (MK968559–MK968564 and MT010339–MT010344 for ITS and tef1-α, respectively). The pathogenicity of six isolates, belonging to the two haplotypes, was undertaken by inoculating five asymptomatic nuts per isolate. After disinfecting the nut surface with 70% ethanol and removing a piece of shell (5 mm diameter) with a sterile cork borer, the nuts were inoculated with a same-sized agar-mycelium plug cut from the margin of a 5-day-old PDA colony. Ten control nuts were inoculated with a sterile PDA plug applied as described above. Inoculated nuts were kept in thermostat at 22 °C in the dark for 18 days. All nuts inoculated with N. parvum showed light-brown to dark necrosis of kernel associated with loss of tissue consistency. The symptoms were congruent with those observed in nature. All N. parvum isolates were successfully reisolated from all the inoculated nuts, fulfilling Koch’s postulates. No lesions were observed on controls. N. parvum is recognized as an emerging plant pathogen worldwide. In particular, several studies report N. parvum as a growing threat to agricultural and forest ecosystems in the Mediterranean area (Larignon et al., 2015; Manca et al., 2020). This is the first report of N. parvum causing chestnut nut rot in Italy.

Download Full-text

First Report of Neofusicoccum parvum Causing Dieback Disease of Chinese Weeping Cypress in China

Plant Disease ◽

10.1094/pdis-94-5-0641c ◽

2010 ◽

Vol 94 (5) ◽

pp. 641-641 ◽

Cited By ~ 3

Author(s):

S. B. Li ◽

J. Z. Li ◽

S. C. Li ◽

Z. H. Lu ◽

J. H. Wang ◽

...

Keyword(s):

Cross Sections ◽

Elongation Factor ◽

Aerial Mycelium ◽

Central China ◽

Internal Transcribed Spacer Region ◽

Middle Point ◽

Neofusicoccum Parvum ◽

First Report ◽

Dieback Disease ◽

And Control

Cupressus funebris Endl. (Chinese weeping cypress) is native to southwestern and central China. In June 2008, blighted shoots of Chinese weeping cypress trees were observed in Yunnan Province (southwestern China). Symptomatic trees were located in an ornamental planting established approximately 8 to 12 years ago. Additional samples were collected from 11 locations in the provinces of Sichuan, Yunnan, Guizhou, and Chongqing. Disease symptoms included yellowing and wilting of leaves on several branches, followed by sudden death within 6 to 8 weeks. Cross sections on trunks and branches revealed darkened zones. Tissue from diseased samples was plated on potato dextrose agar (PDA) and incubated at 25°C. Fungal isolates developed copious, white, aerial mycelium that became dark gray after 4 to 6 days and formed black pycnidia after 25 days. Conidia were hyaline, ellipsoidal to fusiform, externally smooth, thin walled, nonseptate, and measured 12.5 to 18.5 × 4.0 to 6.5 μm. Identity was confirmed by analysis of the rDNA internal transcribed spacer region (ITSI-5.8S-ITS2) and the translation elongation factor 1-alpha (EF1-α). BLAST searches at GenBank showed a high identity with reference sequences (ITS: >99%; EF1-α: 100%). Representative sequences of both regions were deposited in GenBank (ITS: Accession No. FJ842960 and FJ842961; EF1-α: Accession No. GU811148). Morphological and molecular results confirmed this species as Neofusicoccum parvum, reported as the anamorph of Botryosphaeria parva. Pathogenicity tests were conducted by stem inoculation of 2-year-old C. funebris seedlings. Mycelial plugs (4 mm in diameter) of N. parvum from actively growing colonies were applied to same-size bark wounds on the middle point of the stems. Control seedlings were inoculated with sterile PDA plugs. Inoculated and control seedlings (five each) were kept in a greenhouse and watered as needed. After 5 weeks, all C. funebris seedlings showed leaf wilting and dark vascular stem tissue. N. parvum was reisolated from all inoculated, symptomatic tissues, fulfilling Koch's postulates; no symptoms were visible in the control seedlings. N. parvum has previously been reported to cause canker and dieback disease of avocado (3), mango (2), and magenta cherry (Syzygium paniculatum) (1). To our knowledge, this is the first report of N. parvum causing dieback of C. funebris in China. References: (1) R. C. Ploetz et al. Plant Pathol. 58:801, 2009. (2) B. Slippers et al. Mycologia 97:99, 2005. (3) T. Zea-Bonilla et al. Plant Dis. 91:1052, 2007.

Download Full-text

First report of Diaporthe ueckerae causing stem canker on soybean (Glycine max L.) in Colombia

Plant Disease ◽

10.1094/pdis-04-21-0718-pdn ◽

2021 ◽

Author(s):

Nathali López-Cardona ◽

YUDY ALEJANDRA GUEVARA ◽

Lederson Gañán-Betancur ◽

Carol Viviana Amaya Gomez

Keyword(s):

Management Strategies ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Stem Canker ◽

Growth Stages ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Glycine Max L ◽

Soybean Plants

In October 2018, soybean plants displaying elongated black to reddish-brown lesions on stems were observed in a field planted to the cv. BRS Serena in the locality of Puerto López (Meta, Colombia), with 20% incidence of diseased plants. Symptomatic stems were collected from five plants, and small pieces (∼5 mm2) were surface sterilized, plated on potato dextrose agar (PDA) and incubated for 2 weeks at 25°C in darkness. Three fungal isolates with similar morphology were obtained, i.e., by subculturing single hyphal tips, and their colonies on PDA were grayish-white, fluffy, with aerial mycelium, dark colored substrate mycelium, and produced circular black stroma. Pycnidia were globose, black, occurred as clusters, embedded in tissue, erumpent at maturity, with an elongated neck, and often had yellowish conidial cirrus extruding from the ostiole. Alpha conidia were observed for all isolates after 30 days growth on sterile soybean stem pieces (5 cm) on water agar, under 25ºC and 12 h light/12h darkness photoperiod. Alpha conidia (n = 50) measured 6.0 – 7.0 µm (6.4 ± 0.4 µm) × 2.0 – 3.0 µm (2.5± 0.4 µm), were aseptate, hyaline, smooth, ellipsoidal, often biguttulate, with subtruncate base. Beta conidia were not observed. Observed morphological characteristics of these isolates were similar to those reported in Diaporthe spp. by Udayanga et al. (2015). DNA from each fungal isolate was used to sequence the internal transcribed spacer region (ITS), and the translation elongation factor 1-α (TEF1) gene, using the primer pairs ITS5/ITS4 (White et al. 1990) and EF1-728F/EF1- 986R (Carbone & Kohn, 1999), respectively. Results from an NCBI-BLASTn, revealed that the ITS sequences of the three isolates (GenBank accessions MW566593 to MW566595) had 98% (581/584 bp) identity with D. miriciae strain BRIP 54736j (NR_147535.1), whereas the TEF1 sequences (GenBank accessions MW597410 to MW597412) had 97 to 100% (330-339/339 bp) identity with D. ueckerae strain FAU656 (KJ590747). The species Diaporthe miriciae R.G. Shivas, S.M. Thomps. & Y.P. Tan, and Diaporthe ueckerae Udayanga & Castl. are synonymous, with the latter taking the nomenclature priority (Gao et al. 2016). According to a multilocus phylogenetic analysis, by maximum likelihood, the three isolates clustered together in a clade with reference type strains of D. ueckerae (Udayanga et al. 2015). Soybean plants cv. BRS Serena (growth stages V3 to V4) were used to verify the pathogenicity of each isolate using a toothpick inoculation method (Mena et al. 2020). A single toothpick colonized by D. ueckerae was inserted directly into the stem of each plant (10 plants per isolate) approximately 1 cm below the first trifoliate node. Noncolonized sterile toothpicks, inserted in 10 soybean plants served as the non-inoculated control. Plants were arbitrarily distributed inside a glasshouse, and incubated at high relative humidity (>90% HR). After 15 days, inoculated plants showed elongated reddish-brown necrosis at the inoculated sites, that were similar to symptoms observed in the field. Non-inoculated control plants were asymptomatic. Fungal cultures recovered from symptomatic stems were morphologically identical to the original isolates. This is the first report of soybean stem canker caused by D. ueckerae in Colombia. Due to the economic importance of this disease elsewhere (Backman et al. 1985; Mena et al. 2020), further research on disease management strategies to mitigate potential crop losses is warranted.

Download Full-text

First Report of Neofusicoccum parvum Associated with Grapevine Trunk Diseases in Croatia

Plant Disease ◽

10.1094/pdis-03-13-0283-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1656-1656 ◽

Cited By ~ 6

Author(s):

J. Kaliternam ◽

T. Milicevic ◽

D. Bencic ◽

B. Duralija

Keyword(s):

Aerial Mycelium ◽

Morphological Data ◽

Width Ratio ◽

Vitis Vinifera L ◽

Internal Transcribed Spacer Region ◽

Foeniculum Vulgare ◽

Neofusicoccum Parvum ◽

First Report ◽

Grapevine Trunk Diseases ◽

Trunk Diseases

In September 2010, during survey of diseased grapevines (Vitis vinifera L.) in vineyards at localities Zmajevac (BZ), Orahovica (SO), Cilipi (KC), and Novalja (PN), symptoms characteristic of grapevine trunk diseases (GTD) (3) were observed, showing on cross-sectioned cordons and trunks as brown, wedge-shaped perennial cankers and/or dark streaking of the wood. In Croatia, these symptoms were traditionally associated with Eutypa Tul. & C.Tul. and with fungi from Diaporthaceae (2). From affected grapevines (cvs. Grasevina, Pinot bijeli, Malvazija dubrovacka, and Gegic), samples of symptomatic cordons and trunks were collected (n ≥ 35). To isolate the causal agents from the samples, woodchips of symptomatic tissue, surface-sterilized in 2% sodium hypochlorite for 2 min, were placed on potato dextrose agar amended with streptomycin sulphate (50 μg/ml) and incubated for 7 days at 25°C in darkness. A percentage of samples (72, 15, 27, and 54% from BZ, SO, KC, and PN, respectively) yielded fungal colonies with abundant aerial mycelium, initially white, but turning olivaceous grey after 5 days. From these colonies, monohyphal isolates were obtained and pycnidial formation stimulated by cultivation on 2% water agar with stems of plant species Foeniculum vulgare Mill. at 25°C under diffuse light for 3 weeks. Pycnidia contained conidia that were hyaline, unicellular, ellipsoid with round apices and truncated bases, and thin walled with smooth surface. Dimensions of conidia (n ≥ 50) were (12.8) 15.3 ± 1.4 (17.6) × (5.4) 6.3 ± 0.8 (7.6) μm, with length/width ratio (2.0) 2.5 ± 0.5 (3.2). Based on morphological data, species Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips was suspected (1). For molecular identification, isolates BZ330, SO334, KC342, and PN121 were used for PCR to amplify internal transcribed spacer region and partial translation elongation factor 1-alpha gene, using primers ITS5/ITS4 and EF1-728F/EF1-986R, respectively. Obtained sequences were shown to be identical between the four isolates (GenBank: KF296318, KF296319) and when compared with sequences for reference N. parvum isolate CMW9080 (AY236942, AY236887) they showed >99% homology, confirming the isolates as species N. parvum. Pathogenicity tests were done by inoculation of detached green shoots (GS) and lignified canes (LC) (n = 5) of grapevine cv. Skrlet by either mycelial plugs of the same four isolates, or sterile agar plugs for the controls. Inoculated GS were kept in flasks with sterile water in a glasshouse for 10 days, and LC in humid dark chambers for 30 days, at 25°C. Resulting vascular necrosis measured 62 to 81 mm (GS) and 215 to 246 mm (LC), but was absent on controls. Koch's postulates were satisfied by successful reisolation of N. parvum only from plants inoculated with mycelial plugs. N. parvum has been recognized as a serious grapevine pathogen, causing similar symptoms worldwide (3). To our knowledge, this is the first report of N. parvum associated with GTD in Croatia, and due to its relatively high incidence at surveyed localities, it could present considerable threat, particularly for neighboring vine growing regions. Diplodia seriata De Not., a weak pathogen (3), was also identified from a percentage of samples in this survey. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) J. Kaliterna et al. Arh. Hig. Rada Toksikol. 63:471, 2012. (3) J. R. Urbez-Torres. Phytopathol. Mediterr. 50(Suppl.):S5, 2011.

Download Full-text

First Report of Euphorbia larica Dieback Caused by Fusarium brachygibbosum in Oman

Plant Disease ◽

10.1094/pdis-09-12-0828-pdn ◽

2013 ◽

Vol 97 (5) ◽

pp. 687-687 ◽

Cited By ~ 9

Author(s):

I. H. Al-Mahmooli ◽

Y. S. Al-Bahri ◽

A. M. Al-Sadi ◽

M. L. Deadman

Keyword(s):

Elongation Factor ◽

Aerial Mycelium ◽

Its Region ◽

Common Component ◽

First Report ◽

Ethnobotanical Uses ◽

Artificial Inoculations ◽

Stem Lesions ◽

Desert Flora

Euphorbia larica Boiss. (Arabic = Isbaq) is a dominant and common component of the native desert flora of northern Oman. Traditional ethnobotanical uses have included use of the latex for treating camels with parasites. In February 2011, E. larica plants showing stem lesions up to several cm long and in many cases with stem dieback were collected from Al-Khoudh 50 km west of Muscat. The disease appeared widespread within the location where several dead specimens were also recorded, although the cause was unclear. Sections (5 mm) of five diseased branches taken from different plants and placed on potato dextrose agar (PDA) in all cases yielded Fusarium-like colonies. Colonies recovered were initially white becoming rose to medium red in color with abundant aerial mycelium. Macroconidia were scarce and scattered (mean of 20 spores: 26.83 × 4.73 μm) with three to four septa per spore; microconidia were slightly curved, ovoid, and fusiform (mean of 20 spores: 11.64 × 4.03 μm) with zero to two septa per spore. Spherical chlamydospores (mean of 20 spores: 11.05 μm) were terminal and intercalary, single, and in chains. In vitro characters and spores measurements conformed to previously described features of Fusarium brachygibbosum Padwick (1). Mycelial plugs (5 mm) were taken from 7-day-old cultures of the fungus grown on 2.5% PDA and applied to a small incision (3 mm) on the stems of healthy E. larica grown in situ and protected with wet cotton and Parafilm. The residual agar, mycelium, cotton, and Parafilm were removed after 7 days and symptoms were recorded. Control stems were inoculated using PDA (5 mm) plugs alone and inoculations were repeated twice. Artificial inoculations resulted in dieback of all stems within 11 days and fungal colonies identical to initial isolations were recovered from artificially infected surface-sterilized stem pieces. Identification of F. brachygibbosum was confirmed by comparing sequences generated from the internal transcribed spacer (ITS) region of the ribosomal DNA (ITS1 and ITS4 primers) and the intron region of translation elongation factor alpha (EF1-α) (EF-1-986 and EF-728 primers). The ITS and EF1-α sequences were found to share 100% and 99% nucleotide similarity to previously published sequences of the ITS (HQ443206) and EF1-α (JQ429370) regions of F. brachygibbosum in GenBank. The accession number of ITS sequence of one isolate assigned to EMBL-Bank was HF562936. The EF sequence was assigned to EMBL-Bank accession (submission number Hx2000027017; number will be sent later). This pathogen has previously been reported on date palm (2) in Oman but, to our knowledge, this is the first report of this pathogen on E. larica. References: (1) A. M. Al-Sadi et al. Crop Prot. 37:1, 2012. (2) G. W. Padwick. Mycol. Pap. 12:11, 1945.

Download Full-text

First report of Trichoderma afroharzianum causing seed rot on maize in Italy

Plant Disease ◽

10.1094/pdis-12-21-2697-pdn ◽

2022 ◽

Author(s):

Martina Sanna ◽

Massimo Pugliese ◽

Maria Lodovica GULLINO ◽

Monica Mezzalama

Keyword(s):

Rna Polymerase Ii ◽

Elongation Factor ◽

Aerial Mycelium ◽

Light Cycle ◽

Conidial Suspension ◽

Ear Rot ◽

Trichoderma Spp ◽

Trichoderma Species ◽

First Report ◽

Pathogenicity Tests

Maize (Zea mays L.) is a cereal crop of great economic importance in Italy; production is currently of 60,602,320 t, covering 588,597 ha (ISTAT 2021). Trichoderma species are widespread filamentous fungi in soil, well known and studied as biological control agents (Vinale et al., 2008). Seeds of a yellow grain hybrid (class FAO 700, 132 days) were collected in September 2020 from an experimental field located in Carmagnola (TO, Italy: GPS: 44°53'11.0"N 7°40'60.0"E) and tested with blotter test (Warham et al., 1996) to assess their phytosanitary condition. Over the 400 seeds tested, more than 50% showed rotting and development of green mycelium typical of the genus Trichoderma. Due to the high and unexpected percentage of decaying kernels, ten colonies were identified by morphological and molecular methods. Single conidia colonies of one Trichoderma (T5.1) strain were cultured on Potato Dextrose Agar (PDA) for pathogenicity tests, and on PDA and Synthetic Nutrient-Poor Agar (SNA) for morphological and molecular identification. The colonies grown on PDA and SNA showed green, abundant, cottony, and radiating aerial mycelium, and yellow pigmentation on the reverse. Colony radius after 72 h at 30°C was of 60-65 mm on PDA and of 50-55 mm on SNA. The isolates produced one cell conidia 2.8 - 3.8 µm long and 2.1 - 3.6 µm wide (n=50) on SNA. Conidiophores and phialides were lageniform to ampulliform and measured 4.5 – 9.7 µm long and 1.6 – 3.6 µm wide (n=50); the base measure 1.5 – 2.9 µm wide and the supporting cell 1.4 – 2.8 µm wide (n=50). The identity of one single-conidia strain was confirmed by sequence comparison of the internal transcribed spacer (ITS), the translation elongation factor-1α (tef-1α), and RNA polymerase II subunit (rpb2) gene fragments (Oskiera et al., 2015). BLASTn searches of GenBank using ITS (OL691534) the partial tef-1α (OL743117) and rpb2 (OL743116) sequences of the representative isolate T5.1, revealed 100% identity for rpb2 to T. afroharzianum TRS835 (KP009149) and 100% identity for tef-1α to T. afroharzianum Z19 (KR911897). Pathogenicity tests were carried out by suspending conidia from a 14-days old culture on PDA in sterile H2O to 1×106 CFU/ml. Twenty-five seeds were sown in pots filled with a steamed mix of white peat and perlite, 80:20 v/v, and maintained at 23°C under a seasonal day/night light cycle. Twenty primary ears were inoculated, by injection into the silk channel, with 1 ml of a conidial suspension of strain T5.1 seven days after silk channel emergence (BBCH 65) (Pfordt et al., 2020). Ears were removed four weeks after inoculation and disease severity, reaching up to 75% of the kernels of the twenty cobs, was assessed visually according to the EPPO guidelines (EPPO, 2015). Five control cobs, inoculated with 1 ml of sterile distilled water were healthy. T. afroharzianum was reisolated from kernels showing a green mold developing on their surface and identified by resequencing of tef-1α gene. T. afroharzianum has been already reported on maize in Germany and France as causal agent of ear rot of maize (Pfordt et al. 2020). Although several species of Trichoderma are known to be beneficial microorganisms, our results support other findings that report Trichoderma spp. causing ear rot on maize in tropical and subtropical areas of the world (Munkvold and White, 2016). The potential production of mycotoxins and the losses that can be caused by the pathogen during post-harvest need to be explored. To our knowledge this is the first report of T. afroharzianum as a pathogen of maize in Italy.

Download Full-text

First Report of Stem Dieback Caused by Lasiodiplodia parva on Styphnolobium japonicum in China

Plant Disease ◽

10.1094/pdis-08-21-1598-pdn ◽

2021 ◽

Author(s):

Ziwei Zhou ◽

Cuiping Wu ◽

Jing Yang ◽

Jieying Xu ◽

Zhenpeng Chen ◽

...

Keyword(s):

Robinia Pseudoacacia ◽

Elongation Factor ◽

Aerial Mycelium ◽

Random Trees ◽

Molecular Evidence ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Accurate Identification ◽

Individual Tree ◽

First Report

Styphnolobium japonicum (L.) Schott is a variant of Robinia pseudoacacia and is a popular Asian tree widely used in traditional medicine. From March 2019 to 2021, a disease was found on the campus of Nanjing Forestry University and several landscape sites of Xuanwuhu Park, causing dieback. Most of the trees (approximately 40%) have rotted branches. On average, 60% of the branches per individual tree were affected by this disease. The initial round lesions were grayish brown. In the later stage, the whole branch becomes black and produces spherical fruiting bodies . Twenty diseased branches were picked from three random trees. Small tissues (3-4mm²) were surface-sterilized in 75% ethanol for 30 s followed by 1% NaClO for 90 s and placed on potato dextrose agar (PDA), and incubated in the dark at 25°C for three days. Hyphae were visibly emerged from 70% of the samples. Three representative isolates (Lth-soj1, Lth-soj2, and Lth-soj3) were obtained and deposited in China’s Forestry Culture Collection Center (Lth-soj1: cfcc55896, Lth-soj2: cfcc55897, Lth-soj3: cfcc55898). The colonies of three isolates on PDA were fast growing and white, which turned grey to dark grey after 3 days of incubation in the dark at 28°C . Two-weeks old colonies were black and fluffy on PDA, with abundant aerial mycelium, and the reverse side too was black in color. The fungus usually grew well on PDA and produced pycnidia and conidia within 3–4 weeks. Conidia were initially hyaline and aseptate, ellipsoid to ovoid, with granular content, apex broadly rounded, remaining hyaline and later becoming dark brown, one septate, thick walled, base truncate or round and longitudinally striate. The conidia (n=30) of a representative isolate（Lth-soj1）, measured 24.3 ± 0.3 μm in length and 13.3 ± 0.5 μm in width . The morphological characters of the three isolates matched those of Lasiodiplodia parva(Alves et al. 2008). For accurate identification, the DNA of the three isolates was extracted. The internal transcribed spacer region (ITS), translation elongation factor (EF1-α), and β-tubulin 2 (TUB2) genes were amplified using the primer pairs ITS1/ITS4 , EF1-728F/EF1-986R, and Bt2a/Bt2b , respectively. The sequences were deposited in GenBank under accession numbers MZ613154, MZ643245 and MZ643242 for Lth-soj1, MZ613155, MZ643246 and MZ643244 for Lth-soj2, and MZ613157, MZ643247 and MZ643243 for Lth-soj3. The ITS, EF1-α, and TUB2 sequences of isolate Lth-soj1 (GenBank Acc. No. MZ613154, MZ643245, MZ643242) were 100% (519/519 nt), 99.34% (299/301 nt), and 99.77% (436/437 nt) identical to those of MZ182360, EF622063, and MK294119, respectively. Interspecific differences were observed in a maximum-likelihood tree of Lasiodiplodia species using the concatenated dataset. Based on the morphological and molecular evidence, the isolates were identified as L. parva. The pathogenicity of three isolates were tested on potted three-year-old seedlings (100-cm tall) of S. japonicum maintained in a greenhouse. Healthy stems were wounded with a sterile needle then inoculated with 10 µL of conidial suspension. Control plants were treated with ddH2O. In total, 12 seedlings were inoculated including three controls. Three seedlings per isolate and 10 stems per seedling were used for each treatment. The plants were kept inside sealed polythene bags for the first 24 h and sterilized H2O was sprayed into the bags twice a day to maintain humidity and kept in a greenhouse at the day/night temperatures at 25/16°C. Within seven days, all the inoculated points showed lesions similar to those observed in field and the conidiomatas growing on the surface of the branches, whereas controls were asymptomatic . The infection rate of each of the three isolates was 100%. The strain was re-isolated from the lesions and sequenced as L.parva, whereas not from control stems. This is the first report of L. parva causing rotten branches of S. japonicum in China and the worldwide. These data will help to develop effective strategies for managing this newly emerging disease.

Download Full-text

First Report of Lasiodiplodia theobromae Associated with Decline of Grapevine Rootstock Mother Plants in Spain

Plant Disease ◽

10.1094/pdis-92-5-0832b ◽

2008 ◽

Vol 92 (5) ◽

pp. 832-832 ◽

Cited By ~ 13

Author(s):

A. Aroca ◽

R. Raposo ◽

D. Gramaje ◽

J. Armengol ◽

S. Martos ◽

...

Keyword(s):

Elongation Factor ◽

Aerial Mycelium ◽

Its Region ◽

Pathogenic Fungi ◽

Vascular Lesions ◽

Malt Extract ◽

Pathogenicity Test ◽

Lasiodiplodia Theobromae ◽

First Report ◽

Mother Plants

A field of Richter 110 rootstock mother plants in Valencia Province (eastern Spain) was surveyed during November 2006 to study the mycoflora of declining plants. Two canes with stunted leaves were collected from a plant with a reduced number of shoots. No cankers or vascular lesions were observed in the collected canes. Six wood chips (1 to 2 mm thick) were taken from one basal fragment (3 to 4 cm long) of each cane, surface sterilized in 70% ethanol for 1 min, and plated on malt extract agar supplemented with 0.5 g L–1 of streptomycin sulfate. Petri dishes were incubated for 7 days at 25°C. A fungus was consistently isolated from all samples that showed the following characteristics: colonies grown on potato dextrose agar (PDA) at 25°C developed a white, aerial mycelium that turned gray after 4 to 6 days and produced pycnidia after 1 month on sterile grapevine slivers of twigs placed on the PDA surface; conidia from culture were ellipsoidal, thick walled, initially hyaline, nonseptate, and measuring 20 to 25 (22.5) × 12 to 14 (13) μm; aged conidia were brown, 1-septate with longitudinal striations in the wall; and pseudoparaphyses variable in form and length were interspersed within the fertile tissue. The fungus was identified as Lasiodiplodia theobromae (Pat.) Griffon & Maubl. from the above characteristics (2). Identity was confirmed by analysis of the nucleotide sequences of the internal transcribed spacer (ITS) region from the rRNA repeat and part of the translation elongation factor 1-alpha (EF1-α) and the β-tubulin (B-tub) genes, as done elsewhere (1,3). BLAST searches at GenBank showed a high identity with reference sequences (ITS: 100%, EF1-α: 97%; B-tub: 99%). Representative sequences of the studied DNA regions were deposited at GenBank (Accession Nos.: ITS: EU254718; EF1-α: EU254719; and B-tub: EU254720). A pathogenicity test was conducted on 1-year-old grapevine plants cv. Macabeo grafted onto Richter 110 rootstocks maintained in a greenhouse. A superficial wound was made on the bark of 10 plants with a sterilized scalpel, ≈10 cm above the graft union. A mycelial plug obtained from the margin of an actively growing fungal colony (isolate JL664) was placed in the wound and the wound was wrapped with Parafilm. Ten additional control plants were inoculated with sterile PDA plugs. All control plants grew normally, and the inoculation wound healed 3 months after inoculation. Plants inoculated with L. theobromae showed no foliar symptoms in the same period, but developed cankers variable in size surrounding the inoculation sites. Vascular necroses measuring 8.4 ± 1.5 cm (mean ± standard error) developed in the inoculated plants that were significantly longer than the controls (0.3 ± 0.2 cm). The pathogen was reisolated from all inoculated plants and no fungus was reisolated from the controls. These results confirmed the pathogenicity of L. theobromae to grapevine and points to a possible involvement of L. theobromae in the aetiology of grapevine decline as previously reported (3,4). To our knowledge, this is the first report of L. theobromae isolated from grapevine in Spain. References: (1) J. Luque et al. Mycologia 97:1111, 2005. (2) E. Punithalingam. No. 519 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1976. (3) J. R. Úrbez-Torres et al. Plant Dis. 90:1490, 2006. (4) J. M. van Niekerk et al. Phytopathol. Mediterr. 45(suppl.):S43, 2006.

Download Full-text

First Report of Neofusicoccum parvum Associated with Dieback of Mango Trees in Peru

Plant Disease ◽

10.1094/pdis-93-4-0426b ◽

2009 ◽

Vol 93 (4) ◽

pp. 426-426 ◽

Cited By ~ 12

Author(s):

J. Javier-Alva ◽

D. Gramaje ◽

L. A. Alvarez ◽

J. Armengol

Keyword(s):

Dna Sequences ◽

Mangifera Indica ◽

Elongation Factor ◽

Tree Canopy ◽

Internal Transcribed Spacer Region ◽

Neofusicoccum Parvum ◽

First Report ◽

Early Maturation ◽

Mycelial Plug ◽

Stem Lesions

Mango (Mangifera indica L) is one of the most important cash crops of northern Peru. Since 2003, adult mango trees (cvs. Criollo and Kent) located in Piura Province developed symptoms of dieback characterized by the death of twigs and branches in the tree canopy. Additional disease symptoms involved darkened, elongated lesions on the peduncle, causing an early maturation of the fruit, and in advanced symptoms, stem-end rot of fruits. Symptoms were frequent in the spring months (September to November) when the lesions expand rapidly. Diseased tissues from branches and fruits were collected and small pieces of necrotic tissues were surface disinfected and plated onto potato dextrose agar (PDA) with 0.5 g L–1 streptomycin sulfate. Plates were incubated at 25°C in the dark. All affected tissues consistently developed colonies with a white mycelium, moderately dense, and becoming olivaceous gray after 5 to 6 days. Pycnidia were produced on sterile mango twigs placed on the surface of potato carrot agar (PCA) after 10 days. Conidia were hyaline, guttulate, aseptate, measuring (15-) 18.5 (-22.5) × (4-) 5.2 (-7.5) μm. Conidia became olivaceous and developed one or two septa before germination. Isolates were identified as Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers, & A.J.L. Phillips (1). DNA sequences of the rDNA internal transcribed spacer region (ITS) and part of the translation elongation factor 1-alpha (EF1-α) genes were used to confirm the identification through BLAST searches in GenBank (ITS: 99% identity to Accession No. EU080928; EF1-α: 98% identity to Accession No. AY343367). Representative sequences of the studied DNA regions were deposited at GenBank (ITS: Accession No. FJ528596; EF1-α: Accession No. FJ528597). Pathogenicity tests were conducted on 18-month-old potted mango plants cv. Kent with two N. parvum strains (A4 and A5). A mycelial plug (3 cm in diameter) taken from the margin of an actively growing colony of each isolate was put in a wound made with a cork borer of the same diameter on the stem of each plant. Inoculation wounds were wrapped with Parafilm. Controls were inoculated with sterile PDA plugs. Ten replicates for each isolate were used with an equal number of control plants. Plants were maintained in a greenhouse with a temperature range of 22 to 28°C. After 4 weeks, mango plants showed necrotic stem lesions originating from the inoculation point affecting also the branches of the inoculated plants. No differences in lesion area between strains were obtained. No lesions developed in the control plants. Reisolations from necrotic tissues were successful and both isolates were morphologically identical to those used for inoculations. N. parvum was isolated from all symptomatic trees in all surveyed areas. This pathogen has already been reported on mango (2) and currently represents a serious problem in the mango-producing areas of Peru. To our knowledge, this is the first report of N. parvum affecting mango in Peru. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) B. Slippers et al. Mycologia 97:99, 2005.

Download Full-text

First report of Fusarium falciforme (FSSC 3+4) causing root rot on chickpea in Mexico

Plant Disease ◽

10.1094/pdis-05-21-1123-pdn ◽

2021 ◽

Author(s):

Sixto Velarde Felix ◽

Victor Valenzuela ◽

Pedro Ortega ◽

Gustavo Fierros ◽

Pedro Rojas ◽

...

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Species Complex ◽

Elongation Factor ◽

Morphological Characteristics ◽

Aerial Mycelium ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Single Spore ◽

First Report

Chickpea (Cicer aretinium L.) is a legume crop of great importance worldwide. In January 2019, wilting symptoms on chickpea (stunted grow, withered leaves, root rot and wilted plants) were observed in three fields of Culiacan Sinaloa Mexico, with an incidence of 3 to 5%. To identify the cause, eighty symptomatic chickpea plants were sampled. Tissue from roots was plated on potato dextrose agar (PDA) medium. Typical Fusarium spp. colonies were obtained from all root samples. Ten pure cultures were obtained by single-spore culturing (Ff01 to Ff10). On PDA the colonies were abundant with white aerial mycelium, hyphae were branched and septae and light purple pigmentation was observed in the center of old cultures (Leslie and Summerell 2006). From 10-day-old cultures grown on carnation leaf agar medium, macroconidias were falciform, hyaline, with slightly curved apexes, three to five septate, with well-developed foot cells and blunt apical cells, and measured 26.6 to 45.8 × 2.2 to 7.0 μm (n = 40). The microconidia (n = 40) were hyaline, one to two celled, produced in false heads that measured 7.4 to 20.1 (average 13.7) μm × 2.4 to 8.9 (average 5.3) μm (n = 40) at the tips of long monophialides, and were oval or reniform, with apexes rounded, 8.3 to 12.1 × 1.6 to 4.7 μm; chlamydospores were not evident. These characteristics fit those of the Fusarium solani (Mart.) Sacc. species complex, FSSC (Summerell et al. 2003). The internal transcribed spacer and the translation elongation factor 1 alpha (EF1-α) genes (O’Donnell et al. 1998) were amplified by polymerase chain reaction and sequenced from the isolate Ff02 and Ff08 (GenBank accession nos. KJ501093 and MN082369). Maximum likelihood analysis was carried out using the EF1-α sequences (KJ501093 and MN082369) from the Ff02 and Ff08 isolates and other species from the Fusarium solani species complex (FSSC). Phylogenetic analysis revealed the isolate most closely related with F. falciforme (100% bootstrap). For pathogenicity testing, a conidial suspension (1x106 conidia/ml) was prepared by harvesting spores from 10-days-old cultures on PDA. Twenty 2-week-old chickpea seedlings from two cultivars (P-2245 and WR-315) were inoculated by dipping roots into the conidial suspension for 20 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80% and a 12-h/12-h light/dark cycle. After 8 days, the first root rot symptoms were observed on inoculating seedlings and the infected plants eventually died within 3 to 4 weeks after inoculation. No symptoms were observed plants inoculated with sterilized distilled water. The fungus was reisolated from symptomatic tissues of inoculated plants and was identified by sequencing the partial EF1-α gene again and was identified as F. falciforme (FSSC 3 + 4) (O’Donnell et al. 2008) based on its morphological characteristics, genetic analysis, and pathogenicity test, fulfilling Koch’s postulates. The molecular identification was confirmed via BLAST on the FusariumID and Fusarium MLST databases. Although FSSC has been previously reported causing root rot in chickpea in USA, Chile, Spain, Cuba, Iran, Poland, Israel, Pakistan and Brazil, to our knowledge this is the first report of root rot in chickpea caused by F. falciforme in Mexico. This is important for chickpea producers and chickpea breeding programs.

Download Full-text