Morphological and Chemical Variation of Wild Sweet Chestnut (Castanea sativa Mill.) Populations

Sweet chestnut (Castanea sativa Mill., Fagaceae) is one of the oldest cultivated tree species in the Mediterranean, providing multiple benefits, and, since it has edible seeds, it represents an interesting model species for the research of morphological and chemical variability. In this study, morphometric methods and chemical analyses were used to quantify the extent of differences in phenotypic and nutritional traits between eight natural populations of sweet chestnut from different environmental conditions, where different management types are applied, high-forest and coppice. The samples were collected from the Prealps in Italy to the western part of Bosnia and Herzegovina. In total, 31 nut and kernel morphometric and nutritional traits were studied on 160 trees, and various multivariate statistical analyses were used to study intra- and interpopulation variations. Both analyses, morphometric and chemical, revealed a similar pattern of diversity, with morphological and chemical variability not associated with geographic or environmental variables. In addition, we found significant correlations between morphometric and chemical data. High phenotypic variability was determined both among and within the studied populations, and all populations had a similar level of diversity. The results of the analysis of morphological and chemical diversity can have many practical applications for the management, production, and conservation of the sweet chestnut genetic resources for nut production.

Genetic Characterisation of Chestnut Cultivars in Crete

(1) Background and objectives: Cretan chestnut belongs to sweet chestnut (Castanea sativa Mill.) and has been historically associated with the lifestyle of rural communities with great economic importance. However, chestnut genetic resources in Crete have rarely been studied and assessed, while chestnuts are threatened by several anthropogenic factors. This study assessed the genetic variability of the Cretan sweet chestnut using 59 trees corresponding to the four best-known chestnut cultivars (Strovliani, Rogdiani, Koutsakera and Katharokastania). (2) Materials and Methods: The trees were evaluated using seven simple sequence repeat markers (SSRs): three nSSRs and four EST-SSRs. (3) Results: Genomic SSR results revealed notable genetic diversity in terms of expected heterozygosity, level of polymorphism and effective number of alleles. Moreover, in the four chestnut cultivars, twenty-two unique genotypes were identified, deeming each cultivar to be in fact a multiclonal variety. Genetic differentiation among cultivars was relatively low, though highly significant. Four different groups of synonymies were found: two homonymy groups in Katharokastania and Strovliani, six in Rogdiani and eight in Koutsakera. The cluster analysis and PCoA results reveal two main clusters, one corresponding to the Rogdiani cultivar and the other to Katharokastania, while the other two could not be assigned to a particular group. (4) Conclusions: The null hypothesis of single-clone genotype-to-cultivar correspondence was tested and could not be accepted.

Effect of Roasting, Boiling, and Frying Processing on 29 Polyphenolics and Antioxidant Activity in Seeds and Shells of Sweet Chestnut (Castanea sativa Mill.)

Sweet chestnuts (Castanea sativa Mill.) are highly prized nuts, and the consumption of fresh chestnuts is usually preceded by roasting, boiling, and frying. The aim of this work was to simultaneously analyze 29 polyphenolic compounds for the first time in raw, boiled, roasted, and fried chestnut seeds and shells using HPLC-MS/MS. Principal component analysis depending on the HPLC-MS/MS results showed that roasting, boiling, and frying affected the contents of 25 detected phenolic compounds in a unique way, of which the most notable phenolics were gallic acid, ellagic acid, and (+)-catechin. Additionally, total polyphenolic content (TPC) was measured via the Folin–Ciocalteu method, and TPC in seeds and inner and outer shells was increased in all treatments except for microwave-roasted seeds. Furthermore, the higher TPC in the inner and outer shells when compared to seeds supported their higher antioxidant activity (AOA) determined via the DPPH experiment. AOA of seeds was increased in all treatments, while the AOA of shells was higher in roasting and lower in boiling and frying treatments. The assessment of these changes is necessary so that chestnut seed consumption and the recycling of their shells as a natural source of antioxidants can be maximized.

First report of Neofusicoccum parvum causing canker on Castanea sativa in Spain

In April 2021, depressed bark with dark reddish coloration was observed on the stem of a five-year-old chestnut (Castanea sativa Mill.) plant, acquired from a commercial Galician nursery. One tissue sample was collected from the injury of this plant, surface-sterilized with 96% ethanol for 30 s and dried on sterilized tissue paper, plated on potato dextrose agar (PDA) and incubated at 25ºC. Fungal colonies were consistently isolated and after 5 days developed abundant greyish-white aerial mycelium. Two weeks later pycnidia with fusiform conidia were observed. For molecular identification, internal transcribed spacer (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTAT TGATATGC, White et al. 1990), beta-tubulin (BT2a: GGTAACCAAATCGGT GCTGCTTTC, BT2b: ACCCTCAGTGTAGTGACCCTTGGC, Glass & Donaldson 1995) and elongation factor (EF1-728F: CATCGA GAAGTTCGAGAAGG, EF1-1199R: GGGAAGTACCMGTGATCATGT, Walker et al. 2010) were amplified. BLAST analysis showed that ITS sequence of isolate LPPAF-971 (accession no. MZ314849) showed 99.63% identity with Neofusicoccum parvum isolates ACBA15 (accession no. KX244803) and mywxxq (accession no. MW767713), and 99.4% identity with isolate CMW9081T (accession no. AY230943). Beta-tubulin sequence (accession no. MZ561053) showed 100% identity with isolate GDTCMF1 (accession no. MN022786), and elongation factor sequence (accession no. MZ561054) showed 98.70% identity with isolate F7 (accession no. MN461166), all corresponding with N. parvum. Pathogenicity tests were carried out on ten five-year-old chestnut plants on which a 5mm PDA plug from the edge of an actively growing colony of the fungus was inoculated by a cut in the bark of one to three branches per plant up to a total of 16 inoculated branches and then wrapped with Parafilm©. Five plants inoculated with one plug of PDA without the fungus were used as controls. Plants were placed in a plastic tunnel with a lateral insect net, provided with drip irrigation and grown under natural conditions. Bark cankers symptoms similar to the one observed in the original sample were visible on all inoculated chestnut plants ten days after inoculation. No symptoms were observed on the controls. The assay was conducted twice. Fungal colonies morphologically identified as N. parvum were reisolated from bark cankers on inoculated chestnut plants, fulfilling Koch’s postulates. C. sativa is a widely distributed multipurpose tree, with important economic, environmental, cultural, and heritage functions (Bounous & Beccaro 2019), which underlines the importance of this finding with a view on its sanitary control. In addition, N. parvum, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & Phillips (Crous et al. 2006), is the causal agent of cankers and dieback in many crops and trees (Phillips et al. 2013) worldwide, but until now it had not been detected in C. sativa. To the best of our knowledge, this is the first report worldwide of N. parvum causing disease on chestnut in Spain. References: Bounous G & Beccaro G. 2019. Pp. 1. In: The Chestnut Handbook-Crop & Forest Management. Eds. Beccaro et al. CRC Press, Taylor & Francis Group. Crous PW et al. 2006. Stud. Mycol. 55: 235. doi.org/10.3114/sim.55.1.235 Glass NL & Donaldson GC. 1995. Appl Environ Microbiol 61: 1323. doi: 10.1128/aem.61.4.1323-1330 Phillips AJL et al. 2013. Stud. Mycol. 76: 51. doi:10.3114/sim0021 Walker DM et al. 2010. Mycologia 102: 1479. doi: 10.3852/10-002 White TJ et al. 1990. Pp. 315 In: PCR Protocols: a guide to methods and applications. Academic Press, San Diego, CA.

Effects of hydrolyzable tannin extract obtained from sweet chestnut wood (Castanea sativa Mill.) against bacteria causing subclinical mastitis in Thai Friesian dairy cows

Background and Aim: Hydrolyzable tannins are an important group of secondary plant metabolites, which are known for antimicrobial activity. This study aimed to assess the efficiency with which a hydrolyzable tannin extract from sweet chestnut wood (Castanea sativa Mill.) could inhibit mastitis-causing bacteria in vitro. Materials and Methods: The negative control used was sterile water, and the positive controls were penicillin and gentamicin. The treatments included five concentrations of hydrolyzable tannins (63, 190, 313, 630, and 940 mg/mL). In cows with subclinical mastitis, the bacteria causing the disease were isolated and identified. Then, the antibacterial activity of the hydrolyzable tannin extract was assessed by the disk diffusion method, by determining the minimum inhibitory concentration (MIC) and by determining the minimum bactericidal concentration (MBC). Results: Penicillin inhibited (p<0.01) the growth of Staphylococcus aureus, Streptococcus uberis, and Pseudomonas aeruginosa but could not inhibit (p>0.05) the growth of Streptococcus agalactiae, Escherichia coli, and Klebsiella pneumoniae. However, gentamicin and hydrolyzable tannins could inhibit (p<0.01) all isolated bacteria. Increasing the concentration of hydrolyzable tannin extract resulted in a quadratic increase in the inhibition zone diameter of S. aureus and S. agalactiae and a linear increase in the inhibition zone diameter of E. coli, K. pneumoniae, and P. aeruginosa. In addition, 630 and 940 mg/mL of hydrolyzable tannin extract showed the highest antibacterial activity against S. agalactiae and E. coli (p<0.01), while 940 mg/mL concentration had the highest antibacterial activity against K. pneumoniae (p<0.01). The MIC and MBC of the extract were 27.3-190 mg/mL and 58.8-235 mg/mL, respectively, with the MBC: MIC ratio being 2:1. Conclusion: The antimicrobial activity of the hydrolyzable tannin extract against subclinical mastitis bacteria was comparable to the antibiotics (positive controls) at concentrations over 630 mg/mL. Although these in vitro findings are promising, further research is needed to determine whether hydrolyzable tannins could be used to control or prevent subclinical mastitis in dairy cows.

Determination of Grafting Adaptation of Some Chestnut (Castanea sativa Mill.) Genotypes with Marigoule (C. Sativa × C. Crenata) Cultivar

In this study, to reproduce natural chestnut genotypes, the fruit characteristics of the Düzce region determined by local people are good in a healthy way, compatible with Marigoule (C. sativa × C. crenata) hybrid varieties resistant to branch cancer and root rot was investigated. In this study, 24 different chestnut genotypes were used. As the grafting method, the most commonly used tongue grafting, split grafting, chip budding grafting, and side grafting method were used. All procedures related to grafting were carried out in the greenhouses of the Düzce University Faculty of Forestry. In this study, local genotypes that are compatible with Marigoule chestnut were determined. As a result, the native genotype, which showed the best adaptation to Marigoule seedlings, was 87.5% of Yalnızçam, and after that, 79.2% of the Ereğli Sefer genotype. The lowest fit showed Broken genotype with 15% and Akçakoca1genotype with 17.5%. Besides, the compatibility of foreign varieties Maraval, Marigoule, and Betizac were also investigated. As a result, Betizac had the highest compatibility with 95%, while Maraval had 67.5%. The most successful in the grafting methods applied was the side graft (74.2%) followed by tongue grafting (59.9%), splitting grafting (51.4%), and chip budding grafting (29.7%).

Traditional ethnoveterinary knowledge of indigestion or diarrhoea treatments in cattle on the Bilogora hills in Croatia

Traditional knowledge of plants and their preparations used for the treatment of animal diseases was passed down orally from generation to generation, so there are no written records or they are very rare. This study is based on the first documentation of ethnoveterinary knowledge for indigestion or diarrhoea treatment in cattle on the Bilogora hills in northwestern Croatia. Data collection was conducted from 2008 until 2018, in eighteen villages of four municipalities in the Koprivni?ko-križeva?ka county, Croatia. Plant specimens were well known, in addition they were confirmed and identified by the skilled botanist. Nine plant species: flax (Linum usitatissimum L.), chamomile (Matricaria recutita L.), hazelwort (Asarum europaeum L.), broad-leaved dock (Rumex obtusifolius L.), sweet chestnut (Castanea sativa Mill.), common oak (Quercus robur L.), white willow (Salix alba L.), common mallow (Malva sylvestris L.), yarrow (Achillea millefolium L.) from 7 botanical families were documented. Decoction and herbal tea were the most common preparation methods. The most often used plants to treat mild diarrhea in cattle were chamomile and broad-leaved dock, and for hard, watery diarrhoea bark of sweet chestnut and sessile oak. The most often used plants to treat indigestion in cattle were hazelwort, chamomille, and flaxseed. Farmers used mostly leaves (about 57%), flowers and stems (more than 25%), bark (about 13%), branches, and seeds (5%) for herbal preparations. Thus the aim of the present study is to document that ethnoveterinary tradition for the next generations. Keywords: Cattle; Diarrhoea; Ethnoveterinary; Indigestion