scholarly journals First Report of Anthracnose Caused by Glomerella acutata on Chili Pepper in China

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 219-219 ◽  
Author(s):  
H. Xia ◽  
X.-L. Wang ◽  
H.-J. Zhu ◽  
B.-D. Gao
Keyword(s):  
Pcr Amplification ◽  
Morphological Characters ◽  
Chili Pepper ◽  
Colletotrichum Acutatum ◽  
First Report ◽  
Blast Search ◽  
Rdna Its ◽  
Its Sequence Analysis ◽  
Pcr Products ◽  
Needle Prick

A new anthracnose disease on chili pepper (cayenne pepper cv. Hongxiu 2003, fruiting type pepper) was found in Zhijiang County, Hunan, China in 2009. The disease was observed only on the fruits. Lesions were generally elongated, on which dark acervuli were arranged concentrically. Later, cracking of older lesions was observed. With a microscope, fungal conidia were observed to be 15.8 × 4.1 μm, fusiform or oval with one end acute, and single celled with two to seven oil globules. No setae were found on the acervuli. Eight isolates (HNZJ001–HNZJ008) showed no difference in colony feature when cultured on potato dextrose agar. All the isolates showed white growth at the early stages, but colonies turned pink when they produced powdery spores and then finally became red gray. The average colony diameter was 68.5 to 72.3 mm after 7 days with obvious gray black concentric rings because of the development of aerial and substrate mycelia. After a needle-prick inoculation with a suspension of 1 × 106 spores per ml of HNZJ001 on 30 chili pepper fruits with three repeats, the same symptoms were observed and the same fungus was recovered. In bioassays, HNZJ001 caused lesions on both mature and immature fruits, while Glomerella cingulata strain LSQ1 (GenBank Accession No. HQ607386) used as a control did not infect immature fruits. PCR amplification was carried out by utilizing universal rDNA-ITS primer pair ITS4/ITS5. Sequencing of the PCR products of HNZJ001 (GenBank Accession No. GU059863) showed 100% identity to G. acutata (GenBank Accession No. EU008863) and Colletotrichum acutatum (GenBank Accession No. AF207794) after a BLAST search. The pathogen was identified as G. acutata (asexual stage: C. acutatum) on the basis of morphological characters and rDNA-ITS sequence analysis. Worldwide, it has been reported that pepper anthracnose might be caused by up to five species of Glomerella (Colletotrichum): G. cingulata, C. coccodes, C. capsici, C. dematium, and G. acutata (2), among which only the first three were previously reported in China. In recent years, G. acutata was reported on such plants as apple (3) and strawberry (1) in China, but not on pepper. To our knowledge, this is the first report of G. acutata on chili pepper in China. References: (1) X.-J. Ren et al. Acta Phytopathol. Sin. 38:325, 2008. (2) P. P. Than et al. Zhejiang Univ. Sci. B 9:764, 2008. (3) R. Zhang et al. Plant Dis. 92:1474, 2008.

scholarly journals First Report of Colletotrichum acutatum Associated with Stem Blight of Blueberry Plants in China

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 422-422 ◽  
Author(s):  
C.-N. Xu ◽  
Z.-S. Zhou ◽  
Y.-X. Wu ◽  
F.-M. Chi ◽  
Z.-R. Ji ◽  
...  
Keyword(s):  
Vaccinium Corymbosum ◽  
Colletotrichum Acutatum ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Distilled Water ◽  
Conidial Suspension ◽  
First Report ◽  
Rdna Its ◽  
Its Sequence Analysis ◽  
Species Specific

An anthracnose disease was observed on stems of high-bush blueberry plants (Vaccinium corymbosum L.) in Liaoning Province, China in 2012. The typical symptoms consist of sudden wilting and dieback of stems during the growing season. Dark brown lesions originate from infected buds and kill portions of the stems. Lesions have grayish white centers, with the necrotic areas becoming 6 to 8 cm in length. Disinfected stem pieces were placed on potato dextrose agar (PDA) and incubated at 28°C for 5 to 7 days, after which the emerging colonies were transferred to fresh PDA. All isolates initially produced white growth, but turned pink after 7 days before becoming blackish green. The average colony diameter was 65.5 to 75.0 mm after 7 days. Conidia were aseptate, hyaline, fusiform to ellipsoid, 8.5 to 16.5 × 2.5 to 4.0 μm in size and single celled with two to seven oil globules. Setae were not found on the acervuli. These characteristics matched published descriptions of Colletotrichum acutatum (1) (teleomorph Glomerella acutata). Pathogenicity test was confirmed in 15 2-year-old healthy potted plants of cv. Berkeley. Stems of 10 plants were punctured with flamed needles and sprayed with 5 ml of conidial suspension (106 conidia per ml in sterile distilled water) of isolate LNSW1. Five control plants were inoculated with sterile distilled water. Seven days after inoculation, eight of the 10 blueberry plants exhibited stem lesions, leaf chlorosis, followed by branch dieback 15 days post-inoculation. The symptoms were similar to those observed on diseased plants in the field, and no lesions were observed on control plants. The pathogen was reisolated from the margin of lesions and identified by colony growth characteristics on PDA. PCR amplification of one isolate (LNSW1) was carried out by utilizing the universal rDNA-ITS primer pair ITS1/ITS4. The sequence (557 bp) of isolate LNSW1 (GenBank Accession No. JX392857) showed 99% identity to G. acutata (AB443950) and C. acutatum (AJ749672) in a BLAST search. An approximately 490-bp fragment was amplified from LNSW1 by the species-specific primer pair CaInt2/ITS4 (2). The pathogen was identified as G. acutata (asexual stage: C. acutatum J.H. Simmonds) on the basis of morphological characters, rDNA-ITS sequence analysis, and a PCR product with species-specific primers. To our knowledge, this is the first report of C. acutatum in high-bush blueberry plants in China. References: (1) C. Lei et al. Fungal Diversity 12:183, 2009. (2) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996

scholarly journals First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Strawberry in Korea

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1247-1247 ◽  
Author(s):  
M. H. Nam ◽  
T. I. Kim ◽  
M. L. Gleason ◽  
J. Y. Song ◽  
H. G. Kim
Keyword(s):  
Pcr Amplification ◽  
Morphological Characters ◽  
Fruit Rot ◽  
Colletotrichum Acutatum ◽  
Pathogenicity Test ◽  
First Report ◽  
Strawberry Anthracnose ◽  
Dark Green ◽  
Average Size ◽  
Species Specific

Symptoms typical of anthracnose fruit rot; sunken, dark brown lesions on maturing fruits, were found in a commercial field of strawberry (Fragaria × ananassa) cv. Cal Giant in Yangyang County, Korea in May 2007. Masses of conidia were produced in acervuli in the center of lesions. The fungus was isolated on potato dextrose agar (PDA). Colonies grown on PDA were pale to mouse gray and became dark green to black in reverse. Conidia were formed in orange-to-salmon pink masses in the center of the culture. The average size of conidia on PDA was 15.2 × 4.6 μm, and they were hyaline, straight, cylindrical, with pointed ends, and aseptate (1). The fungus did not form an ascigerous stage in culture. Mycelial growth rate was 7.5 mm per day at 25°C on PDA. The identity of two isolates was confirmed as Colletotrichum acutatum J.H. Simmonds by PCR amplification using species-specific primers TBCA and TB5 (2), resulting in a characteristic 330-bp band on agarose gel. Morphological characters were in accordance with previous reports on C. acutatum. A pathogenicity test was conducted with five healthy plants of cvs. Cal Giant, Maehyang, Seolhyang, Kumhyang, Akihime, and Redpearl. After fruits and flowers were sprayed with a conidia suspension (105 conidia per ml), the plants were maintained at 10 to 25°C and 100% relative humidity in a greenhouse. As a control, five healthy plants were sprayed with sterile distilled water and incubated under the same conditions. Dark brown, water-soaked spots appeared on mature fruits of all cultivars after 5 days, and lesions on green fruits appeared on individual achenes. Flowers developed dark lesions, dried out, and died. No symptoms were found on the control plants. After the pathogen was reisolated from fruits and flowers lesions, the morphological characters developed in culture as described above. To our knowledge, this is the first report of C. acutatum causing strawberry anthracnose in Korea. References: (1) B. J. Smith and L. L. Black. Plant Dis. 74:69, 1990. (2) P. Talhinhas et al. Appl. Environ. Microbiol. 71:2987, 2005.

scholarly journals First Report of Leaf Spot Caused by Alternaria alternata on Chinese Dwarf Banana in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 691-691 ◽  
Author(s):  
B. Z. Fu ◽  
Z. H. Zhang ◽  
L. H. Wang ◽  
G. Y. Li ◽  
J. Z. Zhang ◽  
...  
Keyword(s):  
Alternaria Alternata ◽  
Leaf Spot ◽  
Morphological Characteristics ◽  
Pcr Amplification ◽  
Its Region ◽  
Leaf Spot Disease ◽  
First Report ◽  
Spot Disease ◽  
Rdna Its ◽  
Its Sequence Analysis

The Chinese dwarf banana (Ensete lasiocarpum) is one of the ornamental bananas that belongs to Musaceae family. The plant is native to the southwestern China, where it grows semi-wild in the mountains between 1,500 and 2,500 m above sea level. During July 2011, a leaf spot disease on this plant was observed in the campus and parks in Kunming, Yunnan Province. The incidence level was about 22%, mainly on the old leaves. The leaf symptoms were irregular spots with gray to off-white centers surrounded by dark brown margins, and usually also surrounded by chlorotic halos. Leaf tissues (3 × 5 mm), cut from the margins of lesions, were surface-disinfected (95% ethanol for 3 min, 0.1% HgCl2 for 2 min, rinsed three times with sterile water), plated on potato sucrose agar (PSA), and incubated at 26°C under natural lights. The same fungus was consistently isolated from the diseased leaves. Colonies of white-to-dark gray mycelia formed on PSA that were black on the underside. The colonies were further identified as Alternaria sp. based on the dark brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 5.26 to 30.26 μm long and 3.95 to 15.79 μm wide, averaging 10.21 (±3.17) × 20.02 (±5.75) μm (n = 50), with a beak length of 0 to 7.89 μm, and had 3 to 8 transverse and 0 to 3 longitudinal septa. PCR amplification was carried out by utilizing universal rDNA-ITS primer pair ITS4/ITS5 (1). The ITS region of isolate DY1 (GenBank Accession No. KF516556) was 572 bp in length. BLAST search revealed 99% identity with two Alternaria alternata isolates (JF440581.1 and GQ121322.2). Phylogenetic analysis (MEGA 5.1) using the neighbor-joining algorithm placed the isolate in a well-supported cluster with other A. alternata isolates. The pathogen was identified as A. alternate (Fr.:Fr.) Keissler based on the morphological characteristics and rDNA-ITS sequence analysis. To confirm pathogenicity, Koch's postulates were performed on detached leaves of E. lasiocarpum inoculated with mycelial plugs with ddH2O and agar plugs as a control. Leaf spots identical to those observed in the field developed in 9 days on the inoculated leaves but not on the control. The inoculation assay used three leaves, totaling 72 spots for control and 36 spots for inoculation. The experiments were repeated once. A. alternata was consistently re-isolated from the inoculated leaves. The symptom developed easier with wounds. To our knowledge, this is the first report of E. lasiocarpum leaf spot disease caused by A. alternata in China and the world. References: (1) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (2) T. Y. Zhang. Flora Fungorum Sinicorum, Vol. 16: Alternaria. Science Press, Beijing, China, 2003.

scholarly journals Specific DNA identification of Pheretima in the Naoxintong capsule

2019 ◽  
Vol 14 (1) ◽  
Author(s):  
Xiaoxiao Zhu ◽  
Hoi-Yan Wu ◽  
Pang-Chui Shaw ◽  
Wei Peng ◽  
Weiwei Su
Keyword(s):  
Pcr Amplification ◽  
Cerebrovascular Diseases ◽  
Coi Gene ◽  
Chemical Marker ◽  
Dna Identification ◽  
Specific Primers ◽  
Blast Search ◽  
Pcr Products ◽  
Crude Drugs ◽  
Nucleotide Database

Abstract Background Pheretima is a minister drug in Naoxintong capsule (NXTC), a well-known traditional Chinese medicine (TCM) formula for the treatment of cardiovascular and cerebrovascular diseases. Owing to the loss of morphological and microscopic characteristics and the lack of recognized chemical marker, it is difficult to identify Pheretima in NXTC. This study aims to evaluate the feasibility of using DNA techniques to authenticate Pheretima, especially when it is processed into NXTC. Methods DNA was extracted from crude drugs of the genuine and adulterant species, as well as nine batches of NXTCs. Based on mitochondrial cytochrome c oxidase subunit I (COI) gene, specific primers were designed for two genera of genuine species, Metaphire and Amynthas, respectively. PCR amplification was performed with the designed primers on crude drugs of Pheretima and NXTCs. The purified PCR products were sequenced and the obtained sequences were identified to species level with top hit of similarity with BLAST against GenBank nucleotide database. Results Primers MF2R2 and AF3R1 could amplify specific DNA fragments with sizes around 230–250 bp, both in crude drugs and NXTC. With sequencing and the BLAST search, identities of the tested samples were found. Conclusion This study indicated that the molecular approach is effective for identifying Pheretima in NXTC. Therefore, DNA identification may contribute to the quality control and assurance of NXTC.

scholarly journals First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 769-769 ◽  
Author(s):  
J. Víchová ◽  
B. Staňková ◽  
R. Pokorný
Keyword(s):  
Czech Republic ◽  
Tomato Fruit ◽  
Colletotrichum Acutatum ◽  
Distilled Water ◽  
Species Determination ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Pcr Products ◽  
Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

scholarly journals First Report of Leaf Spot Disease Caused by Colletotrichum gloeosporioides on Chinese Bean Tree in China

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 138-138 ◽  
Author(s):  
B. Z. Fu ◽  
M. Yang ◽  
G. Y. Li ◽  
J. R. Wu ◽  
J. Z. Zhang ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Colletotrichum Gloeosporioides ◽  
Disease Incidence ◽  
Phylogenetic Analyses ◽  
Morphological Characteristics ◽  
Leaf Spot Disease ◽  
First Report ◽  
Spot Disease ◽  
Rdna Its ◽  
Its Sequence Analysis

Chinese bean tree, Catalpa fargesii f. duciouxii (Dode) Gilmour, is an ornamental arbor plant. Its roots, leaves, and flowers have long been used for medicinal purposes in China. During July 2010, severe outbreaks of leaf spot disease on this plant occurred in Kunming, Yunnan Province. The disease incidence was greater than 90%. The symptoms on leaves began as dark brown lesions surrounded by chlorotic halos, and later became larger, round or irregular spots with gray to off-white centers surrounded by dark brown margins. Leaf tissues (3 × 3 mm), cut from the margins of lesions, were surface disinfected in 0.1% HgCl2 solution for 3 min, rinsed three times in sterile water, plated on potato dextrose agar (PDA), and incubated at 28°C. The same fungus was consistently isolated from the diseased leaves. Colonies of white-to-dark gray mycelia formed on PDA, and were slightly brown on the underside of the colony. The hyphae were achromatic, branching, septate, and 4.59 (±1.38) μm in diameter on average. Perithecia were brown to black, globose in shape, and 275.9 to 379.3 × 245.3 to 344.8 μm. Asci that formed after 3 to 4 weeks in culture were eight-spored, clavate to cylindrical. The ascospores were fusiform, slightly curved, unicellular and hyaline, and 13.05 to 24.03 × 10.68 to 16.02 μm. PCR amplification was carried out by utilizing universal rDNA-ITS primer pair ITS4/ITS5 (2). Sequencing of the PCR products of DQ1 (GenBank Accession No. JN165746) revealed 99% similarity (100% coverage) with Colletotrichum gloeosporioides isolates (GenBank Accession No. FJ456938.1, No. EU326190.1, No. DQ682572.1, and No. AY423474.1). Phylogenetic analyses (MEGA 4.1) using the neighbor-joining (NJ) algorithm placed the isolate in a well-supported cluster (>90% bootstrap value based on 1,000 replicates) with other C. gloeosporioides isolates. The pathogen was identified as C. gloeosporioides (Penz.) Penz. & Sacc. (teleomorph Glomerella cingulata (Stoneman) Spauld & H. Schrenk) based on the morphological characteristics and rDNA-ITS sequence analysis (1). To confirm pathogenicity, Koch's postulates were performed on detached leaves of C. fargesii f. duciouxii, inoculated with a solution of 1.0 × 106 conidia per ml. Symptoms similar to the original ones started to appear after 10 days, while untreated leaves remained healthy. The inoculation assay used three leaves for untreated and six leaves for treated. The experiments were repeated once. C. gloeosporioides was consistently reisolated from the diseased tissue. C. gloeosporioides is distributed worldwide causing anthracnose on a wide variety of plants (3). To the best of our knowledge, this is the first report of C. gloeosporioides causing leaf spots on C. fargesii f. duciouxii in China. References: (1) B. C. Sutton. Page 1 in: Colletotrichum: Biology, Pathology and Control. CAB International. Wallingford, UK, 1992. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (3) J. Yan et al. Plant Dis. 95:880, 2011.

scholarly journals First Report of Colletotrichum acutatum sensu lato Causing Anthracnose on Gooseberry Fruits in the Czech Republic

Plant Disease ◽  
2013 ◽  
Vol 97 (9) ◽  
pp. 1249-1249 ◽  
Author(s):  
J. Víchová ◽  
B. Jílková ◽  
R. Pokorný
Keyword(s):  
Czech Republic ◽  
Morphological Characteristics ◽  
Colletotrichum Acutatum ◽  
Species Determination ◽  
Specific Primers ◽  
The Czech Republic ◽  
First Report ◽  
Sterile Needle ◽  
Pcr Products ◽  
Pathogen Dna

Gooseberry (Ribes uva-crispa L.) is a commonly grown fruit tree or bush in the Czech Republic. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. This pathogen has been reported causing anthracnose on strawberry in the Czech Republic (2), and recently it has become an important pathogen on the fruits of apple and tomato (4). In 2012, anthracnose symptoms were noticed on fruits of gooseberry (locality Pribyslavice, near Brno). The symptoms on fruit surfaces were round, brown, shriveled, sunken spots of 1.2 to 2.0 cm, with orange conidial masses on the spots. The pathogen was isolated from symptomatic fruits on PDA and cultured at 25 ± 2°C. The color of colonies varied with age from white to gray with occurrence of orange conidial masses. Conidia were colorless and fusiform, size 13 to 17 × 4 to 5 μm (n = 100). The morphological characteristics classified the pathogen as a Colletotrichum sp. To fulfill Koch's postulates, 25 disinfested healthy gooseberry fruits were pinpricked by sterile needle and 10 μl of spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity 70 ± 5%. Similar anthracnose symptoms were observed on all of gooseberry fruits a week after inoculation, whereas no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (size 490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded PCR product (size 450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the gooseberry fruit isolates (Accession No. JX843763 and JX843764) matched with 100% similarity to the C. acutatum sequences in GenBank. To our knowledge, this is the first report of C. acutatum sensu lato on gooseberry fruits in the Czech Republic. This pathogen can endanger the production of gooseberry fruits in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett., 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 96:769, 2012.

scholarly journals First Report of Passion Fruit Anthracnose Caused by Colletotrichum constrictum

Plant Disease ◽  
2021 ◽  
Author(s):  
Na Wang ◽  
Fumei Chi ◽  
Zhirui Ji ◽  
Zongshan Zhou ◽  
Junxiang Zhang
Keyword(s):  
Sequence Data ◽  
Control Strategies ◽  
Pcr Amplification ◽  
Morphological Characters ◽  
Fungal Species ◽  
Passion Fruit ◽  
Effective Control ◽  
First Report ◽  
Sterile Needle ◽  
Morphologic Data

Passion fruit (Passiflora edulis) is widely cultivated in tropic and subtropic regions. Because of its unique and intense flavour and high acidity, passion fruit juice concentrate is used in making delectable sauces, desserts, candy, ice cream, sherbet, or blending with other fruit juices. Anthracnose of passion fruit is favored by frequent rainfall and average temperatures above 27°C. In August 2018, anthracnose on passion fruit was observed in commercial plantings in Lincang, Yunnan, China (23.88 N, 100.08 E). Symptoms included lesions of oval to irregular shapes with brown to dark brown borders. Infection covered most of the fruit surface with pink-to-dark sporulation as reported by Tarnowski and Ploetz (2010). A conidial mass from an individual sorus observed on an infected fruit was isolated and cultured on potato dextrose agar (PDA) supplemented with 50 μg ml-1 of streptomycin. From a single microscopic field, two monospore isolates were dissected using a sterile needle, subcultured, and referred to as BXG-1 and BXG-2. Morphological characters including conidia colour, size, and shape were similar between the two isolates. Conidia were aseptate and cylindrical with apex and rounded base. Conidial length ranged from 12.3 to 16.1 µm (avg. 13.5) and width ranged from 5.5 to 6.2 µm (avg. 5.7). Morphologic data were consistent with Colletotrichum constrictum (Damm et al., 2012). To further confirm the fungal species, the ribosomal internal transcribed spacer (ITS), partial sequences of actin (ACT), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and β-tubulin 2 (TUB2) were amplified and sequenced. Primers and PCR amplification were described by Damm et al. (2012). The sequences were compared to type sequences in GenBank. The results showed the ITS (GenBank accession MW828148 and MW828149), ACT (MW855882 and MW855883), CHS-1 (MW855884 and MW855885), GAPDH (MW855886 and MW855887), and TUB2 (MW855888 and MW855889) sequences of the isolates BXG-1 and BXG-2 were 98% identical with sequence data from strain CBS:128504 of C. constrictum. A maximum likelihood tree was constructed using MEGA-X version 10.1.6 (Kumar et al., 2018) based on a combined dataset of the ITS, ACT, CHS-1, GAPDH, and TUB2 sequences of BXG-1 and BXG-2, and those of 18 Colletotrichum spp. previously deposited in GenBank (Damm et al., 2012). The phylogenetic analysis showed that BXG-1 and BXG-2 belong to the C. constrictum clade. Based on morphology and DNA sequencing, BXG-1 and BXG-2 were identified as C. constrictum. To verify pathogenicity, passion fruit were sprayed with a suspension of 1 × 105 conidia ml–1. Control fruit were sprayed with sterilized water. After inoculation, fruit were incubated in an Artificial Climate Box at 27°C and 80% RH. Necrotic symptoms appeared 8 days after inoculation and were similar to those observed on fruit form the field. The pathogen was reisolated from lesions thus fulfilling Koch’s postulates. C. constrictum has been reported to cause anthracnose of citrus from Australia (Wang et al., 2021) and mango from Italy (Ismail et al., 2015). To our knowledge, this is the first report of C. constrictum causing anthracnose on passion fruit worldwide, and these data will provide useful information for developing effective control strategies.

scholarly journals First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 920-920 ◽  
Author(s):  
M. Budziszewska ◽  
P. Wieczorek ◽  
K. Nowaczyk ◽  
N. Borodynko ◽  
H. Pospieszny ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Potato Production ◽  
Amino Acid Identity ◽  
Sequence Comparisons ◽  
First Report ◽  
Pcr Products ◽  
Potato Mop Top Virus ◽  
Negative Controls ◽  
North And South America ◽  
Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

Geopora ramila sp. nov. (Pezizales, Pyronemataceae) evidenced by morphological characters and phylogenetic analyses in Iran

Phytotaxa ◽  
2020 ◽  
Vol 475 (1) ◽  
pp. 29-42
Author(s):  
MASOUD SHEIBANI ◽  
SAMAD JAMALI
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Analyses ◽  
Morphological Characters ◽  
Its Sequence ◽  
Fars Province ◽  
Annual Plant ◽  
Blast Search ◽  
Rdna Its ◽  
Internally Transcribed Spacer ◽  
Close Relatives

A new Geopora species (Pyronemataceae), Geopora ramila was described and illustrated from the soil, under or in the vicinity of Helianthemum ledifolium var. ledifolium annual plant in Fars province, Iran. Morphologically, G. ramila is similar to G. pinyonensis and G. arenicola but distinguished from both by a combination of morphological characters including, color and size of ascocarps, size and shape of ascospores, habit and associated host. The ribosomal DNA internally transcribed spacer (rDNA ITS) sequence of the new species (Acc. No. MT108930 to MT108934) showed 87.82% identity with G. pinyonensis in the BLAST search in GenBank. ITS-based phylogenetic analysis clearly supports G. ramila is a new and distinctive species lacking close relatives among described species of Geopora.

Sign in / Sign up

Export Citation Format

Share Document