First Report of Impatiens necrotic spot virus (INSV) Infecting Basil (Ocimum basilicum) in the United States

Basil (Ocimum basilicum L.), a native of India belonging to the Lamiaceae family, is an aromatic herb with distinctive aroma, and several commercial varieties are used extensively for culinary and ornamental purposes. During the summer of 2011 and 2012, potted plants of basil in a commercial greenhouse in the Richland-Kennewick area of Washington State were observed showing foliar symptoms consisting of chlorotic spots, ring spots, leaf distortion, and stem necrosis. In initial tests, extracts of symptomatic leaves were positive for Impatiens necrotic spot virus (INSV; genus Tospovirus, family Bunyaviridae), when tested with INSV immnunostrips (Agdia, Inc., Elkhart, IN). These samples were negative with immunostrips specific to Tomato spotted wilt virus (genus Tospovirus) and group-specific potyviruses. The virus from symptomatic leaves of basil was transmitted by leaf rub inoculation to Nicotiana benthamiana and Emilia sonchifolia, where it produced necrosis on inoculated leaves followed by systemic necrosis in the former and chlorotic spots and mosaic mottling in newly developed leaves in the latter. Symptomatic leaves from both host plants tested positive with INSV, but not with TSWV, immunostrips. For additional confirmation of INSV, total RNA was extracted from symptomatic leaves of basil using RNeasy Plant Minikit (Qiagen, Inc., Valencia, CA) and used for reverse transcription (RT)-PCR amplification of the nucleocapsid (N) gene using forward (5′-AGCTTAAATCAATAGTAGCA-3′) and reverse (5′-AGCTTCCTCAAGAATAGGCA-3′) primers. RT was carried out at 52°C for 60 min followed by denaturation at 94°C for 3 min. Subsequently, 35 cycles of PCR was carried out with each cycle consisting of 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The amplicons of about 610 nt obtained from RT-PCR were cloned into pTOPO2.1 vector (Invitrogen Corporation, Carlsbad, CA) and three independent clones were sequenced in both directions. Sequence analyses of these clones (GenBank Accession No. KC218475) showed 100% nucleotide sequence identity among themselves and 99% nucleotide sequence identity with INSV isolates from the United States (DQ523598, JX138531, and D00914) and a basil isolate (JQ724132) from Austria. These results further confirm the presence of INSV in symptomatic leaves of basil. Previously, basil has been reported to be naturally infected with TSWV in the United States (3) and INSV in Austria (2). Therefore, this study represents the first confirmed report of the virus in basil in the United States. No species of thrips vector was observed on the affected basil plants. The discovery of INSV in basil has important implications for the nursery industry due to the broad host range of the virus (1); stock plants may serve as a source of inoculum in production areas and infected plants could be distributed to homeowners. It is important for commercial nurseries to monitor for INSV to identify infected mother plants to prevent virus spread. Since more than 31 viruses belonging to 13 different genera have been reported in basil ( http://pvo.bio-mirror.cn/famly073.htm#Ocimumbasilicum ), further studies are in progress to determine if the observed symptoms on basil are only due to single infection of INSV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2). S. Grausgruber-Gröger. New Dis. Rep. 26:12, 2012. (3) G. E. Holcomb et al. Plant Dis. 83:966.

Download Full-text

First Complete Genome Sequence of an Isolate of Tomato Mottle Mosaic Virus Infecting Plants of Solanum lycopersicum in South America

Genome Announcements ◽

10.1128/genomea.00427-18 ◽

2018 ◽

Vol 6 (19) ◽

Cited By ~ 1

Author(s):

Alice Nagai ◽

Lígia M. L. Duarte ◽

Alexandre L. R. Chaves ◽

Maria A. V. Alexandre ◽

Pedro L. Ramos-González ◽

...

Keyword(s):

United States ◽

Nucleotide Sequence ◽

South America ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

The United States ◽

Tomato Plants ◽

Sequence Identity ◽

A Genome ◽

The City

ABSTRACT The complete nucleotide sequence of an isolate of tomato mottle mosaic virus (ToMMV) was determined. The virus, originally isolated from symptomatic tomato plants found in a county near the city of São Paulo, Brazil, has a genome with 99% nucleotide sequence identity with ToMMV from Mexico, China, Spain, and the United States.

Download Full-text

First Report of Squash Mosaic Virus in Ornamental Pumpkin in the Czech Republic

Plant Disease ◽

10.1094/pdis-05-11-0444 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1321-1321 ◽

Cited By ~ 2

Author(s):

J. Svoboda ◽

L. Leisova-Svobodova

Keyword(s):

United States ◽

Czech Republic ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

The United States ◽

The Czech Republic ◽

Sequence Identity ◽

Blast Analysis ◽

Das Elisa

In August 2010, yellow mosaic and leaf deformation were observed on leaves of field planted ornamental pumpkin (Cucurbita pepo L. convar. microcarpina Grebenščikov) plants near Tasovice Village in the Znojmo District of the Czech Republic. These symptoms were typical of a virus infection. Nine leaf samples were collected and examined for the presence of commonly occurring cucurbit viruses by double-antibody sandwich (DAS)-ELISA. Eight samples were infected with Zucchini yellow mosaic virus (ZYMV), seven with Watermelon mosaic virus-2 (WMV-2), five with Cucumber mosaic virus (CMV), and two with Squash mosaic virus (SqMV). Some aphid species were observed on inspected plants but we did not carried out a search for vectors. SqMV isolates, Tas-1 and Tas-5, were also infected with ZYMV and WMV-2. SqMV was separated from the other viruses by mechanical inoculation onto the resistant plant species Cucumis sativus L. ‘Taichung Mou Gua-1’, which is resistant to ZYMV and WMV-2 (3). The virus was transmitted back to C. pepo plants, and DAS-ELISA used for testing for multiple viruses proved the presence of SqMV alone. A C. pepo leaf sample was examined by electron microscopy to validate the presence of the virus. Isometric particles of approximately 30 nm in diameter, corresponding in size and shape to the described particles of SqMV (2), were observed. The presence of SqMV was verified by reverse transcription (RT)-PCR using specific primers designed on the sequence for coat proteins of SqMV found in NCBI and EMBL databases (SqMV-F: TGTGTACAAGATTGGTGGAGATGC; SqMV-R: AGGCTTCTAAAGCGAACTGGG). The obtained amplicons of approximately 1,900 bp were sequenced (GenBank Accession No. JF922966), and by using nucleotide blast analysis (4), identified as a part of RNA-2 genome. Blast analysis showed that the Czech SqMV isolates, Tas-1 and Tas-5, were identical and similar to published SqMV sequences from the United States, Japan, and China. The highest similarity was found between the Czech isolates and one isolate from the United States (Accession No. M96148; E = 0, nucleotide sequence identity = 90%) and one from China (Accession No. AF059533; E = 0, nucleotide sequence identity = 90%). To our knowledge, this is the first report of a natural occurrence of SqMV in the Czech Republic. SqMV can be transmitted via infected seeds by as much as 35% (1); therefore, protection against epidemics should be based on clean seed programs. References: (1) M. Alvarez et al. Phytopathology 68:257, 1978. (2) H. M. Mazzone et al. Biochim. Biophys. Acta 55:164, 1962. (3) T. Wai et al. J. Hered. 88:454, 1997. (4) Z. Zhang et al. J. Comput. Biol. 7:203, 2000.

Download Full-text

First Report of Iris yellow spot virus on Onion in Canada

Plant Disease ◽

10.1094/pdis-92-2-0318a ◽

2008 ◽

Vol 92 (2) ◽

pp. 318-318 ◽

Cited By ~ 8

Author(s):

C. A. Hoepting ◽

J. K. Allen ◽

K. D. Vanderkooi ◽

M. Y. Hovius ◽

M. F. Fuchs ◽

...

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Yellow Spot ◽

Home Garden ◽

N Gene ◽

Spot Virus ◽

Sequence Identity ◽

Symptomatic Tissue ◽

Das Elisa

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an economically important viral pathogen of onion vectored by onion thrips (Thrips tabaci Lindeman). Rapid spread of IYSV has occurred in the western United States and Georgia, with recent reports of IYSV from New York in the northeastern United States (1). In June and mid-July of 2007, symptomatic plants were found in Ontario, Canada in onions grown from sets in a home garden in Grey County (44°27′N, 80°53′W) and on a small commercial farm in Ottawa-Carleton County (45°14′N, 75°28′W), respectively. In the home garden, bleached, elongated lesions with tapered ends occurred on middle-aged leaves of 30% of 100 plants. By August 2007, 91% of these plants were symptomatic. In Ottawa-Carleton, two lesions with green centers and yellow borders occurred on a single leaf of a single plant in a field of 1,120 plants. Symptomatic leaf tissue tested positive for IYSV by IYSV-specific antiserum from Agdia Inc. (Elkhart, IN) in a double-antibody sandwich (DAS)-ELISA. These two isolated and remote finds of IYSV in Ontario prompted a survey in early August of 2007 of the Holland Marsh (44°5′N, 79°35′W), the largest onion-producing region in Ontario. Nine onion fields separated geographically across the Holland Marsh Region were scouted and one to three samples of symptomatic tissue per field were analyzed by DAS-ELISA. IYSV was confirmed in seven of nine (78%) fields surveyed and in 13 of 16 (81%) of the individual samples. A reverse transcription (RT)-PCR assay was used to verify the presence of IYSV in one new symptomatic tissue sample per field collected from three of the fields where IYSV was confirmed by ELISA. Primers specific to the small (S) RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′) were used (2). The resulting 1.2-kb amplicon, which included the 772-bp nucleocapsid (N) gene was cloned and sequenced. Sequence analysis showed that the N gene of the Ontario isolate (GenBank Accession No. EU287943) shared 92 to 98% nucleotide sequence identity with known IYSV N gene sequences. The highest nucleotide sequence identity (98%) was with Genbank Accession Nos. DQ233475 and DQ233472. To our knowledge, this is the first report of IYSV infection of onion in Ontario and Canada. This finding confirms further spread of the virus within North America and the need for research to develop more effective management options to reduce the impact of IYSV on onion production. The finding of IYSV in remote and isolated locations where onions were grown from sets implies that the spread of IYSV via infected bulbs warrants further investigation as a potentially important route of distribution of the virus. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006.

Download Full-text

Characterization and Epidemiology of Outbreaks of Impatiens necrotic spot virus on Lettuce in Coastal California

Plant Disease ◽

10.1094/pdis-07-13-0681-re ◽

2014 ◽

Vol 98 (8) ◽

pp. 1050-1059 ◽

Cited By ~ 10

Author(s):

Yen-Wen Kuo ◽

Robert L. Gilbertson ◽

Tom Turini ◽

Eric B. Brennan ◽

Richard F. Smith ◽

...

Keyword(s):

United States ◽

Frankliniella Occidentalis ◽

Spinacia Oleracea ◽

Disease Outbreaks ◽

Central Valley ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Weed Species ◽

Spot Virus

California is the leading producer of lettuce (Lactuca sativa) for the United States and grows 77% of the country's supply. Prior to 2006, coastal California lettuce was only periodically and incidentally infected by a single tospoviruses species: Tomato spotted wilt virus (TSWV). However, beginning in 2006 and continuing through 2012, severe outbreaks of disease caused by Impatiens necrotic spot virus (INSV) have affected the coastal lettuce crop, though TSWV was also present. In contrast, TSWV was the only tospovirus associated with disease outbreaks in Central Valley lettuce during this period. Disease surveys conducted over two seasons (2008 and 2009) in 10 commercial fields (acreage of 6 to 20 ha) indicated that INSV was the only tospovirus associated with economically damaging disease outbreaks in lettuce in the coastal region, with incidences of 0.5 to 27% (mean = 5.7%). Molecular characterization of INSV isolates associated with these disease outbreaks revealed little genetic diversity and indicated that lettuce-infecting INSV isolates were nearly identical to those previously characterized from ornamental or other hosts from different locations in the United States and the world. Monitoring of thrips revealed moderate to large populations in all surveyed lettuce fields, and the majority of thrips identified from these fields were western flower thrips, Frankliniella occidentalis. There was significant positive correlation (r2 = 0.91, P = 0.003) between thrips populations and INSV incidence in the most commonly encountered type of commercial lettuce (romaine, direct seeded, conventional) included in this study. A reverse-transcription polymerase chain reaction assay developed for detection of INSV in thrips showed promise as a monitoring tool in the field. Surveys for INSV reservoir hosts in the coastal production area revealed that the weeds little mallow (Malva parvifolia) and shepherd's purse (Capsella bursa-pastoris) were commonly infected. M. parvifolia plants infected in the field did not show obvious symptoms, whereas plants of this species inoculated in the laboratory with INSV by sap transmission developed necrotic spots and chlorosis. Eleven other weed species growing in the lettuce production areas were found to be hosts of INSV. Coastal crops found to be infected with INSV included basil (Ocimum basilicum), bell pepper (Capsicum annuum), calla lily (Zantedeschia aethiopica), faba bean (Vicia faba), radicchio (Cichorium intybus), and spinach (Spinacia oleracea). Thus, it is likely that INSV was introduced into coastal California lettuce fields via viruliferous thrips that initially acquired the virus from other local susceptible plant species. Results of this study provide a better understanding of INSV epidemiology in coastal California and may help growers devise appropriate disease management strategies.

Download Full-text

Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California

Plant Disease ◽

10.1094/pdis-93-6-0673c ◽

2009 ◽

Vol 93 (6) ◽

pp. 673-673 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

J. L. Sears ◽

B. Mou

Keyword(s):

Mosaic Virus ◽

Spinacia Oleracea ◽

The United States ◽

Natural Host ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Mechanical Transmission ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-GGATGTAAGCCCTTCTTTGTAGTGG-3′) and reverse (5′-CCTTCCAAGTCACCCTCTGATTG-3′) primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1–4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

Download Full-text

First Report of Pepino mosaic virus Infecting Tomato in Mexico

Plant Disease ◽

10.1094/pdis-04-11-0334 ◽

2011 ◽

Vol 95 (8) ◽

pp. 1035-1035 ◽

Cited By ~ 4

Author(s):

K.-S. Ling ◽

W. Zhang

Keyword(s):

Nucleotide Sequence ◽

Mosaic Virus ◽

Nucleotide Sequence Identity ◽

The United States ◽

Rt Pcr ◽

Pepino Mosaic Virus ◽

First Report ◽

Sequence Identity ◽

Pcr Product ◽

Greenhouse Tomatoes

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5′CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5′TCTTTGTATATGGTCGCAGC) targeting the 5′ portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5′AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5′CAGAAATGTGTTCAGAGGGG) targeting the 3′ portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

Download Full-text

First Report of Iris yellow spot virus Infecting Onion in Pennsylvania

Plant Disease ◽

10.1094/pdis-03-12-0254-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 1

Author(s):

C. A. Hoepting ◽

M. F. Fuchs

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

First Report ◽

Sequence Identity ◽

Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus; family Bunyaviridae) is an economically important pathogen of onion. It is vectored by onion thrips (Thrips tabaci Lindeman) and causes widespread disease of onion in all major onion growing states in the western United States (1). In the eastern United States, IYSV was first reported in Georgia in 2004 (4) and then in New York in 2006 (2). In mid-July of 2010, symptomatic onion (Allium cepa) plants (cv. Candy) were found in New Holland, Pennsylvania, in Lancaster County on a small, diversified commercial farm (40.06°N, 76.06°W). Bleached, elongated lesions with tapered ends occurred on middle-aged leaves on approximately 30% of the 13,760 plants in an area approximately one tenth of an acre. Leaf tissue from five symptomatic plants tested positive for IYSV in a double-antibody sandwich (DAS)-ELISA with IYSV-specific serological reagents from Agdia Inc. (Elkhart, IN). A reverse transcription (RT)-PCR assay was used to verify the presence of IYSV in a subset of symptomatic leaf samples that reacted to IYSV antibodies in DAS-ELISA. Primers specific to the nucleocapsid (N) gene of IYSV (5′-ACTCACCAATGTCTTCAAC-3′ and 5′-GGCTTCCTCTGGTAAGTGC-3′) were used to characterize a 402-bp fragment (3). The resulting amplicons were ligated in TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and two clones of each isolate were sequenced in both directions. Sequence analysis showed a consensus sequence for the partial N gene of the five IYSV isolates from Pennsylvania (GenBank Accession No. JQ952568) and an 87 to 100% nucleotide sequence identity with other IYSV N gene sequences that are available in GenBank. The highest nucleotide sequence identity (100%) was with an IYSV isolate from Texas (GenBank Accession No. DQ658242) and the lowest was with an isolate from India (GenBank Accession No. EU310291). To our knowledge, this is the first report of IYSV infection of onion in Pennsylvania. This finding confirms further spread of the virus within North America. Further study is warranted to determine the impact of IYSV on the Pennsylvania onion industry and to determine viable management strategies, if necessary. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004 (2) C. A. Hoepting et al. Plant Dis. 91:327, 2007 (3) C. L. Hsu et al. Plant Dis. 95:735-743. (4) S. W. Mullis et al. Plant Dis. 88: 1285, 2004.

Download Full-text

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽

10.1094/pdis-09-13-0992-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 701-701

Author(s):

K.-S. Ling ◽

R. Li ◽

D. Groth-Helms ◽

F. M. Assis-Filho

Keyword(s):

United States ◽

Dominican Republic ◽

Mosaic Virus ◽

Potato Spindle Tuber Viroid ◽

The United States ◽

Disease Outbreak ◽

Ringspot Virus ◽

Rt Pcr ◽

Spot Virus ◽

Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

Download Full-text

First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽

10.1094/pdis.2004.88.7.771b ◽

2004 ◽

Vol 88 (7) ◽

pp. 771-771 ◽

Cited By ~ 8

Author(s):

N. Martínez-Ochoa ◽

S. W. Mullis ◽

A. S. Csinos ◽

T. M. Webster

Keyword(s):

Southeastern United States ◽

Impatiens Necrotic Spot Virus ◽

Cyperus Esculentus ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

Black Shank ◽

Purple Nutsedge ◽

Yellow Nutsedge ◽

Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

Download Full-text

First Report of Cucurbit aphid-borne yellows virus in Spain

Plant Disease ◽

10.1094/pdis.2004.88.8.907a ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 22

Author(s):

M. Juarez ◽

V. Truniger ◽

M. A. Aranda

Keyword(s):

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Rt Pcr ◽

Sequence Comparisons ◽

E Coli ◽

Sequence Identity ◽

Tissue Print ◽

Sigma Chemical ◽

Beet Pseudo Yellows Virus ◽

Cucumis Melo L

In late spring 2003, field-grown melon plants (Cucumis melo L.) showing bright yellowing of older leaves were observed near Valladolises in Campo de Cartagena, Murcia, Spain. Symptoms resembled those caused by viruses of the genus Crinivirus (family Closteroviridae), but absence or very low populations of whiteflies were observed. However, diseased foci showed clear indications of heavy aphid infestations. Later, during the fall of 2003, squash plants (Cucurbita pepo L.) grown in open fields in the same area showed similar symptoms. Tissue print hybridizations to detect Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo yellows virus (BPYV) in symptomatic samples were negative. CYSDV and BPYV are two yellowing-inducing criniviruses previously described in Spain. In contrast, standard double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with antiserum against Cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, family Luteoviridae) that was kindly provided by H. Lecoq (INRA-Montfavet Cedex, France) were consistently positive. Definitive confirmation of CABYV associated with symptomatic samples was obtained by performing reverse-transcription polymerase chain reaction (RT-PCR) analyses for the CABYV coat protein gene. Total RNA extracts (TRI reagent; Sigma Chemical, St. Louis, MO) were obtained from symptomatic and asymptomatic leaf samples and RT-PCR reactions were carried out using the primers 5′-GAATACGGTCGCGGCTAGAAATC-3′ (CE9) and 5′-CTATTTCGGGTTCTGGACCTGGC-3′ (CE10) based on the CABYV sequence published by Guilley et al. (2). A single DNA product of approximately 600 bp was obtained only from symptomatic samples. Amplified DNA fragments from two independent samples (samples 36-2 and 37-5) were cloned in E. coli and sequenced (GenBank Accession Nos. AY529653 and AY529654). Sequence comparisons showed a 95% nucleotide sequence identity between the two sequences. A 97% and 94% nucleotide sequence identity was found among 36-2 and 37-5, respectively and the CABYV sequence published by Guilley et al. (2). CABYV seems to be widespread throughout the Mediterranean Basin (1,3) but to our knowledge, it has not previously been described in Spain. Additionally, our data suggest that significant genetic variability might be present in the Spanish CABYV populations. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) H. Guilley et al. Virology 202:1012, 1994. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992.

Download Full-text