Characterization and Epidemiology of Outbreaks of Impatiens necrotic spot virus on Lettuce in Coastal California

California is the leading producer of lettuce (Lactuca sativa) for the United States and grows 77% of the country's supply. Prior to 2006, coastal California lettuce was only periodically and incidentally infected by a single tospoviruses species: Tomato spotted wilt virus (TSWV). However, beginning in 2006 and continuing through 2012, severe outbreaks of disease caused by Impatiens necrotic spot virus (INSV) have affected the coastal lettuce crop, though TSWV was also present. In contrast, TSWV was the only tospovirus associated with disease outbreaks in Central Valley lettuce during this period. Disease surveys conducted over two seasons (2008 and 2009) in 10 commercial fields (acreage of 6 to 20 ha) indicated that INSV was the only tospovirus associated with economically damaging disease outbreaks in lettuce in the coastal region, with incidences of 0.5 to 27% (mean = 5.7%). Molecular characterization of INSV isolates associated with these disease outbreaks revealed little genetic diversity and indicated that lettuce-infecting INSV isolates were nearly identical to those previously characterized from ornamental or other hosts from different locations in the United States and the world. Monitoring of thrips revealed moderate to large populations in all surveyed lettuce fields, and the majority of thrips identified from these fields were western flower thrips, Frankliniella occidentalis. There was significant positive correlation (r2 = 0.91, P = 0.003) between thrips populations and INSV incidence in the most commonly encountered type of commercial lettuce (romaine, direct seeded, conventional) included in this study. A reverse-transcription polymerase chain reaction assay developed for detection of INSV in thrips showed promise as a monitoring tool in the field. Surveys for INSV reservoir hosts in the coastal production area revealed that the weeds little mallow (Malva parvifolia) and shepherd's purse (Capsella bursa-pastoris) were commonly infected. M. parvifolia plants infected in the field did not show obvious symptoms, whereas plants of this species inoculated in the laboratory with INSV by sap transmission developed necrotic spots and chlorosis. Eleven other weed species growing in the lettuce production areas were found to be hosts of INSV. Coastal crops found to be infected with INSV included basil (Ocimum basilicum), bell pepper (Capsicum annuum), calla lily (Zantedeschia aethiopica), faba bean (Vicia faba), radicchio (Cichorium intybus), and spinach (Spinacia oleracea). Thus, it is likely that INSV was introduced into coastal California lettuce fields via viruliferous thrips that initially acquired the virus from other local susceptible plant species. Results of this study provide a better understanding of INSV epidemiology in coastal California and may help growers devise appropriate disease management strategies.

Download Full-text

Variation within Lactuca spp. for Resistance to Impatiens necrotic spot virus

Plant Disease ◽

10.1094/pdis-06-17-0790-re ◽

2018 ◽

Vol 102 (2) ◽

pp. 341-348 ◽

Cited By ~ 1

Author(s):

Ivan Simko ◽

Claire E. Richardson ◽

William M. Wintermantel

Keyword(s):

Host Plants ◽

Frankliniella Occidentalis ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Insect Vector ◽

Necrotic Spot ◽

Spot Virus ◽

Susceptible Host ◽

Breeding Lines ◽

Plant Introductions

Lettuce (Lactuca sativa L.) production in coastal California, one of the major lettuce-producing areas of the United States, is regularly affected by outbreaks of Impatiens necrotic spot virus (INSV), a member of the genus Orthotospovirus. Transmission of INSV among lettuce crops in this growing region has been attributed predominantly to the western flower thrips (Frankliniella occidentalis). INSV is acquired by first- or second-instar thrips nymphs feeding on infected host plants (not necessarily lettuce). The virus replicates within the insect vector, and is transmitted to new plants by adult thrips as they feed on epidermal and mesophyll cells of susceptible host plants. All currently grown cultivars of lettuce are susceptible to the disease. Screening lettuce for resistance to INSV under field conditions is problematic because natural infections appear sporadically and the virus is not evenly distributed across infected fields. We have developed a greenhouse-based assay that uses viruliferous thrips in combination with mechanical inoculation that allows dependable, year-round screening for resistance. In all, 89 cultivars, breeding lines, and plant introductions of cultivated lettuce, together with 53 accessions from 11 other Lactuca spp., 4 accessions from two dandelion (Taraxacum) species, and 4 tomato (Solanum lycopersicum L.) lines were evaluated for resistance to INSV. All tested material was susceptible to INSV to varying degrees, with the exception of two tomato lines that carry the Sw-5 gene that confers resistance to Tomato spotted wilt virus, a virus closely related to INSV. In cultivated lettuce, a partial resistance to INSV was observed in cultivars Amazona, Ancora, Antigua, Commodore, Eruption, Iceberg, La Brillante, Merlot, Telluride, and Tinto. Limited comparison of the greenhouse-based screening results with the data from opportunistic evaluations of resistance on 775 lettuce accessions from six field trials indicates consistency of results from both greenhouse and field environments. The most resistant lettuce accessions are being incorporated into our breeding program for introgression of resistance into lettuce breeding lines.

Download Full-text

First Report of Impatiens necrotic spot virus (INSV) Infecting Basil (Ocimum basilicum) in the United States

Plant Disease ◽

10.1094/pdis-11-12-1101-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 850-850 ◽

Cited By ~ 5

Author(s):

S. Poojari ◽

R. A. Naidu

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

The United States ◽

Ocimum Basilicum ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

Sequence Identity

Basil (Ocimum basilicum L.), a native of India belonging to the Lamiaceae family, is an aromatic herb with distinctive aroma, and several commercial varieties are used extensively for culinary and ornamental purposes. During the summer of 2011 and 2012, potted plants of basil in a commercial greenhouse in the Richland-Kennewick area of Washington State were observed showing foliar symptoms consisting of chlorotic spots, ring spots, leaf distortion, and stem necrosis. In initial tests, extracts of symptomatic leaves were positive for Impatiens necrotic spot virus (INSV; genus Tospovirus, family Bunyaviridae), when tested with INSV immnunostrips (Agdia, Inc., Elkhart, IN). These samples were negative with immunostrips specific to Tomato spotted wilt virus (genus Tospovirus) and group-specific potyviruses. The virus from symptomatic leaves of basil was transmitted by leaf rub inoculation to Nicotiana benthamiana and Emilia sonchifolia, where it produced necrosis on inoculated leaves followed by systemic necrosis in the former and chlorotic spots and mosaic mottling in newly developed leaves in the latter. Symptomatic leaves from both host plants tested positive with INSV, but not with TSWV, immunostrips. For additional confirmation of INSV, total RNA was extracted from symptomatic leaves of basil using RNeasy Plant Minikit (Qiagen, Inc., Valencia, CA) and used for reverse transcription (RT)-PCR amplification of the nucleocapsid (N) gene using forward (5′-AGCTTAAATCAATAGTAGCA-3′) and reverse (5′-AGCTTCCTCAAGAATAGGCA-3′) primers. RT was carried out at 52°C for 60 min followed by denaturation at 94°C for 3 min. Subsequently, 35 cycles of PCR was carried out with each cycle consisting of 94°C for 1 min, 58°C for 45 s, and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. The amplicons of about 610 nt obtained from RT-PCR were cloned into pTOPO2.1 vector (Invitrogen Corporation, Carlsbad, CA) and three independent clones were sequenced in both directions. Sequence analyses of these clones (GenBank Accession No. KC218475) showed 100% nucleotide sequence identity among themselves and 99% nucleotide sequence identity with INSV isolates from the United States (DQ523598, JX138531, and D00914) and a basil isolate (JQ724132) from Austria. These results further confirm the presence of INSV in symptomatic leaves of basil. Previously, basil has been reported to be naturally infected with TSWV in the United States (3) and INSV in Austria (2). Therefore, this study represents the first confirmed report of the virus in basil in the United States. No species of thrips vector was observed on the affected basil plants. The discovery of INSV in basil has important implications for the nursery industry due to the broad host range of the virus (1); stock plants may serve as a source of inoculum in production areas and infected plants could be distributed to homeowners. It is important for commercial nurseries to monitor for INSV to identify infected mother plants to prevent virus spread. Since more than 31 viruses belonging to 13 different genera have been reported in basil ( http://pvo.bio-mirror.cn/famly073.htm#Ocimumbasilicum ), further studies are in progress to determine if the observed symptoms on basil are only due to single infection of INSV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2). S. Grausgruber-Gröger. New Dis. Rep. 26:12, 2012. (3) G. E. Holcomb et al. Plant Dis. 83:966.

Download Full-text

Spinach (Spinacia oleracea) is a New Natural Host of Impatiens necrotic spot virus in California

Plant Disease ◽

10.1094/pdis-93-6-0673c ◽

2009 ◽

Vol 93 (6) ◽

pp. 673-673 ◽

Cited By ~ 4

Author(s):

H.-Y. Liu ◽

J. L. Sears ◽

B. Mou

Keyword(s):

Mosaic Virus ◽

Spinacia Oleracea ◽

The United States ◽

Natural Host ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Mechanical Transmission ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus

Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5′-GGATGTAAGCCCTTCTTTGTAGTGG-3′) and reverse (5′-CCTTCCAAGTCACCCTCTGATTG-3′) primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1–4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus in the Czech Republic

Plant Disease ◽

10.1094/pdis.2000.84.9.1045b ◽

2000 ◽

Vol 84 (9) ◽

pp. 1045-1045 ◽

Cited By ~ 4

Author(s):

J. Mertelik ◽

V. Mokra ◽

B. Gotzova ◽

S. Gabrielova

Keyword(s):

Czech Republic ◽

Plant Species ◽

Frankliniella Occidentalis ◽

Impatiens Necrotic Spot Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Necrotic Spot ◽

Weed Species ◽

Stellaria Media ◽

Spot Virus ◽

The Czech Republic

Impatiens necrotic spot virus (INSV) was found for the first time in the Czech Republic in 1999 in Columnea sp. and Curcuma sp. plants that were imported. They were grown in a garden among other ornamental crops. By June 2000, INSV was detected in 17 ornamental plant species in several gardening establishments never having received imported plants. Frankliniella occidentalis thrips were present at the sites of INSV infection. Natural INSV infection was found also in Stellaria media, which is an important weed species in our conditions. INSV was identified by enzyme-linked immunosorbent assay using polyclonal antibodies to INSV from Loewe Biochemica, Germany, and from Bioreba, Switzerland. The virus was transmitted in sap to Nicotiana benthamiana and Datura stramonium (1). Virus particles typical of a tospovirus were detected by electron microscopy. INSV is the second tospovirus member occurring in the Czech Republic. Tomato spotted wilt virus (TSWV) has occurred in this country since 1992 (2) and to date has been detected in more than 100 plant species including ornamentals, vegetables, and weeds. TSWV became a serious problem in glasshouse grown crops. From the epidemiological point of view the situation of INSV dissemination seems to be similar to that of TSWV. References: (1) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) J. Mertelik and V. Mokra. Acta Virol. 42:348, 1998.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽

10.1094/pdis-07-10-0542 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1507-1507 ◽

Cited By ~ 7

Author(s):

J. M. Crosslin ◽

L. L. Hamlin

Keyword(s):

Frankliniella Occidentalis ◽

Solanum Tuberosum L ◽

Consensus Sequence ◽

Western Flower Thrips ◽

Alternaria Solani ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Feeding Damage ◽

Rt Pcr ◽

Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

Download Full-text

First Report of Impatiens necrotic spot virus Infecting Lettuce in California

Plant Disease ◽

10.1094/pdis-92-8-1248a ◽

2008 ◽

Vol 92 (8) ◽

pp. 1248-1248 ◽

Cited By ~ 4

Author(s):

S. T. Koike ◽

Y.-W. Kuo ◽

M. R. Rojas ◽

R. L. Gilbertson

Keyword(s):

Frankliniella Occidentalis ◽

Disease Incidence ◽

Pcr Analysis ◽

Impatiens Necrotic Spot Virus ◽

Vegetable Crops ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Monterey County

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Download Full-text

Expansion of the Host Range of Impatiens necrotic spot virus to Peppers

Plant Health Progress ◽

10.1094/php-2005-0727-01-hn ◽

2005 ◽

Vol 6 (1) ◽

pp. 28 ◽

Cited By ~ 6

Author(s):

Rayapati A. Naidu ◽

Carl M. Deom ◽

John L. Sherwood

Keyword(s):

Host Range ◽

Western Flower Thrips ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Weed Species ◽

Spot Virus ◽

Horticultural Crops ◽

Flower Thrips ◽

Tobacco Thrips ◽

The U.S

This study reports the occurrence of Impatiens necrotic spot virus (INSV) on pepper under greenhouse conditions. In recent years, INSV has been detected in crops like peanut, tobacco, and potato as well as several weed species. Because INSV is vectored by western flower thrips and tobacco thrips, its expanding host range could make it an economically important problem in agricultural and horticultural crops in the U.S. Accepted for publication 11 July 2005. Published 27 July 2005.

Download Full-text

Spinach latent virus Infecting Tomato in Virginia, United States

Plant Disease ◽

10.1094/pdis-05-13-0529-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1663-1663 ◽

Cited By ~ 1

Author(s):

J. Vargas-Asencio ◽

H. McLane ◽

E. Bush ◽

K. L. Perry

Keyword(s):

United States ◽

Mosaic Virus ◽

Reference Genome ◽

Tomato Fruit ◽

The United States ◽

Latent Virus ◽

Impatiens Necrotic Spot Virus ◽

Degenerate Primers ◽

Spot Virus ◽

Serological Tests

Plants in a single field of commercial tomato (Solanum lycopersicum) of unidentified cultivars in Virginia in July, 2012, were observed showing stunting, leaf distortion, twisting and thickening, discoloration, and color streaking and ringspots on fruits. Serological tests were negative for Cucumber mosaic virus, Groundnut ringspot virus, Tomato spotted wilt virus, Tomato chlorotic spot virus, Impatiens necrotic spot virus, Tobacco mosaic virus, and Tomato bushy stunt virus (Agdia, Inc., Elkhart, IN). Using a membrane-based macroarray (3), hybridization was observed to 8 of 9 70-mer oligonucleotide probes of Spinach latent virus (SpLV; genus Ilarvirus, family Bromoviridae). To confirm the hybridization results, complementary DNA (cDNA) was synthesized using random hexamers and MMLV reverse transcriptase (Promega, Madison, WI), followed by PCR amplification using ilarvirus degenerate primers (4). Fragments of approximately 380 bp were amplified and directly sequenced (GenBank Accession KC_466090); a BLAST search showed a 99% identity to the SpLV RNA 2 reference genome (NC_003809). Primers for SpLV RNA1 (SpLVRNA1f-GGTGTCACCATGCAAACTGG, SpLVRNA1r-AGCTCTTCGTAATAGGCCTGC) and SpLV RNA3 (SpLVCPf-GAAGTCTTTCCCAGGTGAGCA, SpLVCPr-AGGTGGGCATATGGACTTGG) were designed and cDNA was amplified using the IQ supermix (Biorad, Hercules, CA) with thermocycling of 94°C for 4 min, 35× (94°C 45 s, 55°C 45 s, 72°C 45 s), and 72°C for 10 min. The resulting fragments of 538 bp for RNA1 (KC_466088) and 661 bp for RNA3 (KC_466089) showed 100% identity to reference genome sequences for SpLV (NC_003808 and NC_003810, respectively). To demonstrate virus transmissibility, Chenopodium quinoa plants were mechanically inoculated using tomato leaf material (same source described above) ground in 30 mM Na2HPO4 buffer, pH 7.0. Necrotic spots developed on the inoculated leaves 10 dpi. Younger, non-inoculated leaves showed yellow mottling and tested positive for SpLV by RT-PCR (two of two plants tested). The detection of SpLV is rarely reported, with only one record from the United States (2). Although SpLV is described as a latent virus, it has been found associated with tomato fruit symptoms in New Zealand (1). It is not known if the fruit ringspot and other symptoms on the Virginia samples were due to virus infection. Since SpLV is seed-transmissible and seed production takes place in different parts of the world, it has the potential to spread with germplasm and become more widespread in North America. References: (1) B. S. M. Lebas et al. Plant Dis. 91:228, 2007. (2) H. Y. Liu and J. E. Duffus. Phytopathology 76:1087, 1986. (3) K. L. Perry and X. Lu. Phytopathology 100:S100, 2010. (4) M. Untiveros, et al. J. Virol. Methods 165:97, 2010.

Download Full-text

First Report of Impatiens necrotic spot virus on Spiderlily in China

Plant Disease ◽

10.1094/pdis-94-4-0484c ◽

2010 ◽

Vol 94 (4) ◽

pp. 484-484 ◽

Cited By ~ 4

Author(s):

Y. T. Liu ◽

Y. X. Zheng ◽

Y. Z. Li ◽

Z. Y. Li

Keyword(s):

Infected Plant ◽

Protein S ◽

The United States ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

Nicotiana Glutinosa ◽

First Report ◽

N Protein ◽

Italian Isolate

Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) is a devastating disease in the production of ornamental flowers (1). From 2007 to 2009, a survey of 10 major parks and recreation areas in Kunming, the capital of Yunnan Province, China, indicated that approximately 60 to 70% of Spiderlily (Hymenocallis littoralis Salisb.) plants from eight parks had symptoms of concentric ring spots and necrotic spots. Symptomatic plants were tested for INSV and Tomato spotted wilt virus (TSWV) with an immunostrip (Agdia Inc. Elkhart, IN). Results indicated that only the samples designated HDL were positive for INSV and all other samples were negative for both INSV and TSWV. Mechanically inoculated Emilia sonchifolia, Nicotiana glutinosa, Impatiens balsamina, and N. rustica showed chlorotic lesions, concentric rings, and severe necrosis, symptoms typical for INSV in these hosts. Electron microscope inspection found tospovirus-like spheroidal, enveloped particles that were 90 nm in diameter. Primer 5 software (Premier, Canada) was used to design 14 primers from GenBank Accession No. NC_003625 to amplify the L RNA, nine from NC_003616 to amplify the M RNA, and six from NC_003624 to amplify the S RNA. With total RNA extracted from infected plant tissue as templates in reverse transcription (RT)-PCR, these primers generated 29 target fragments of 250 to 900 bp. These fragments were cloned with the vector pMD19 simple-T vector (Takara Bio Inc., Dalian, China) and sequenced. The sequences of the clones were aligned with the software DNAman (version 2.5; Lynnon Biosoft, Quebec, Canada), showing that RNAs L, M, and S are 8,776 bp (GenBank Accession No. GU112505), 4,948 bp (GenBank Accession No. GU112503), and 2,875 bp (GenBank Accession No. GU112504), respectively. BLAST analysis of these Spiderlily INSV sequences against the NCBI sequence database indicated that the RdRp protein (L RNA) was 99.6% identical with the RdRp protein from an Italian isolate (No. DQ425094), the Nsm protein (M RNA) has 99.0% identity with the Nsm protein from an isolate from Italy (No. DQ425095) and one from the United States (No. NC_003616), the G1G2 polyprotein (M RNA) has 99.9% identity with the analogous protein from an Italian isolate (No. DQ425095), the N protein (S RNA) has 99.6% identity with the N protein from an Italian isolate (No. DQ425096), and the NSs protein (S RNA) has 98.7% identity with the NSs protein from an isolate from Japan (No. AB109100). To our knowledge, this is the first report of INSV on Spiderlily in China. Reference: (1) A. E. Whitfield et al. Annu. Rev. Phytopathol. 43:459, 2005.

Download Full-text

First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada

Plant Disease ◽

10.1094/pdis-09-12-0868-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 291-291 ◽

Cited By ~ 1

Author(s):

X. Tian ◽

Y. Zheng ◽

K. Chintaluri ◽

B. Meng

Keyword(s):

The United States ◽

Economic Losses ◽

N Gene ◽

Impatiens Necrotic Spot Virus ◽

Necrotic Spot ◽

Spot Virus ◽

First Report ◽

Initial Symptoms ◽

Necrotic Spots ◽

The Impact

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

Download Full-text