First Report of Little Cherry Disease from Sweet Cherry (Prunus avium) and Sour Cherry (P. cerasus) in the Czech Republic

Little cherry disease (LChD), a virus disease of sweet (Prunus avium) and sour cherries (P. cerasus), is caused by members of the Closteroviridae family. Symptoms are especially visible on fruits and leaves. Leaves become red or bronze in late summer and fall. Fruit are small, angular, and pointed. Fruits are unmarketable due to a characteristic bitter flavor. LChD also causes reduction of yield (1). Sweet and sour cherries are the second (after apples) most often grown fruit species in the Czech Republic. Since LChD occurred in Germany (1) and Poland (2) in 2007 and 2008, sweet and sour cherry trees with LChD symptoms were surveyed in orchards in the East Bohemia Region of the Czech Republic. The presence of LChD was determined by reverse transcription (RT)-PCR and woody indicator plants, as recommended by the European and Mediterranean Plant Protection Organization (EPPO). Different parts of plants were taken from trees with suspicious symptoms to observe the dynamics of virus infection during the 2009 growing season. Total RNA was isolated from young leaves, blossoms, fruits, and fully developed leaves with a CONCERT Plant RNA Purification Reagent (Invitrogen, Carlsbad, CA) (3). RT-PCR was performed with a QIAGEN OneStep RT-PCR Kit (Qiagen, Hilden, Germany) and oligonucleotides previously described (4). Oligonucleotide LCV3EC (5′-GCTCTAGAGGCACCTTTTATTTTTTATATATGC-3′), complementary to position 16910 to 16934 (GenBankAccession No. Y10237) (with the addition of eight nonviral nucleotides to introduce an XbaI site), was used as a negative-sense primer in RT reactions and PCR. Oligonucleotide LCV16659 (5′-GTTATAGAATTCACTGCAAGTG-3′) was used as a positive-sense primer for PCR amplification. The program used for cDNA synthesis was 50°C for 30 min, followed by denaturation for 10 min at 95°C, 35 cycles of 45 s at 94°C, 45 s at 58°C, and 45 s at 72°C. A final incubation was at 72°C for 5 min (1). The finished PCR products (430 bp) were analyzed on 1% agarose gels (stained with SYBR green). According to the preliminary results, young leaves from buds (67% of samples of selected trees with LChD were positive), blossoms (67% positive), and leaves taken in autumn (67% positive) were optimal for the detection of LChD by RT-PCR. The trial with woody indicator plant species was established in the field. Indicators P. avium cv. Sam and P. avium cvs. Bing, F12/1, and Canindex (4) were inoculated with buds from LChD-infected trees and observed for 2 years. Woody indicators remained symptomless throughout the first year of observation, but the indicators showed red coloration of leaves in late summer of the second year. P. avium cv. Canindex seems to be the best woody indicator for testing of LChD in the climatic conditions of the Czech Republic. To our knowledge, this is the first report of LChD in the Czech Republic. References: (1) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (2) B. Komorowska and M. Cieślińska. Plant Dis. 92:1366, 2008. (3) J. Matoušek et al. Biol.Chem. 388:1, 2007. (4) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

Download Full-text

First report of Cherry virus F infecting Japanese plum in Korea

Plant Disease ◽

10.1094/pdis-08-20-1725-pdn ◽

2020 ◽

Author(s):

Yeonhwa Jo ◽

Hoseong Choi ◽

Jin Kyong Cho ◽

Won Kyong Cho

Keyword(s):

Czech Republic ◽

High Throughput Sequencing ◽

Prunus Avium ◽

De Novo ◽

Protein Database ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Japanese Plum ◽

Leaf Spots

Cherry virus F (CVF) is a tentative member of the genus Fabavirus in the family Secoviridae, consisting of two RNA segments (Koloniuk et al. 2018). To date, CVF has been documented in only sweet cherry (Prunus avium) in the Czech Republic (Koloniuk et al. 2018), Canada, and Greece. In May 2014, we collected leaf samples from four symptomatic (leaf spots and dapple fruits) and two asymptomatic Japanese plum cultivars (Sun and Gadam) grown in an orchard in Hoengseong, South Korea, to identify viruses and viroids infecting plum trees. Total RNA from individual plum trees was extracted using two commercial kits: Fruit-mate for RNA Purification Kit (Takara, Shiga, Japan) and RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). We generated six mRNA libraries from the six different plum cultivars for RNA-sequencing using the TruSeq RNA Library Preparation Kit v2 (Illumina, CA, U.S.A.) as described previously (Jo et al. 2017). The mRNA libraries were paired-end (2 X 100 bp) sequenced with a HiSeq 2000 system (Macrogen, Seoul, Korea). The raw sequence reads were de novo assembled by Trinity program v. 2.8.6, with default parameters (Haas et al. 2013). The assembled contigs were subjected to BLASTX search against the non-redundant protein database in NCBI. Of the two asymptomatic cultivars, the transcriptome of asymptomatic plum cv. Gadam contained five contigs specific to CVF. Two and three contigs were specific to CVF RNA1 (2,571 reads, coverage 42.15%) and RNA2 (2,025 reads, coverage 53.04%), respectively. The size of these five contigs ranged from 241 to 5,986 bp. Contigs of 5,986 and 3,867 bp in length, referred to as CVF isolate Gadam RNA1 (GenBank MN896996) and RNA2 (GenBank MN896995), respectively, were subjected to BLASTP search against NCBI’s non-redundant protein database. The results showed that the polyprotein sequences of RNA1 and RNA2 shared 95.3% and 93.11% amino acid identities with isolates SwC-H_1a from the Czech Republic (GenBank acc. no. AWB36326) and Stac-3B_c8 from Canada (AZZ10055), respectively. To confirm the infection of CVF in cv. Gadam, RT-PCR was conducted using CVF RNA1-specific primers designed based on the CVF reference genome sequences (MH998210 and MH998216), including 5’-CCACCAAATAGGCAAGAGGTCAC-3’ (position 3190–3212) and 5’-CACAATCACCATCAATGGTCTCTGC-3’ (position 3742–3766), and CVF RNA2-specific primers, including 5’-CTGCTTTATGATGCTAGACATCAAGATG-3’ (position 1015–1042) and 5’-ACAATAGGCATGCTCATCTCAACCTC-3’ (position 1594–1619). We amplified 577-bp RNA1-specific and 605-bp RNA2-specific amplicons that were cloned and then performed Sanger sequencing. Sequencing of the cloned amplicons for isolate Gadam RNA1 (GenBank MN896993) and RNA2 (GenBank MN896994) revealed values of 99.48% and 99.17% nucleotide identity to that of RNA1 and RNA2 determined by high-throughput sequencing, respectively. Additionally, we tested five plants for each of the six plum cultivars grown in the same orchard. The detection of CVF was carried out through PCR using the primers and protocol described above. Of the 30 trees, CVF was detected in three trees of cv. Gadam by both primer pairs. To our knowledge, this is the first report of CVF infecting Japanese plum and the first report of the virus in Korea. However, its prevalence in other Prunus species, including apricot, European plum, and peach, should be further elucidated.

Download Full-text

First Report of Prunus virus F Infecting Sour Cherry in the Czech Republic

Plant Disease ◽

10.1094/pdis-04-17-0469-pdn ◽

2017 ◽

Vol 101 (10) ◽

pp. 1828 ◽

Cited By ~ 1

Author(s):

D. Šafářová ◽

C. Faure ◽

A. Marais ◽

J. Suchá ◽

F. Paprštein ◽

...

Keyword(s):

Czech Republic ◽

Sour Cherry ◽

The Czech Republic ◽

First Report

Download Full-text

First Report of Barley yellow dwarf virus-MAV in Oat, Wheat, and Barley Grown in the Czech Republic

Plant Disease ◽

10.1094/pdis-93-9-0964b ◽

2009 ◽

Vol 93 (9) ◽

pp. 964-964 ◽

Cited By ~ 5

Author(s):

J. K. Kundu

Keyword(s):

Czech Republic ◽

Barley Yellow Dwarf Virus ◽

Virus Disease ◽

Yellow Dwarf ◽

Dwarf Virus ◽

Cereal Crops ◽

Rt Pcr ◽

The Czech Republic ◽

Barley Yellow Dwarf ◽

Yellow Dwarf Virus

Barley yellow dwarf disease, a ubiquitous virus disease of cereal crops worldwide, is caused by a group of related, single-stranded RNA viruses assigned to Luteovirus (Barley yellow dwarf virus [BYDV] spp. PAV, PAS, MAV, and GAV) or Polerovirus (Cereal yellow dwarf virus-RPV) genera or unassigned to a genera (BYDV-SGV, BYDV-RMV, and BYDV-GPV) in the family Luteoviridae (1). Incidence of BYDV in cereal crops (e.g., barley, wheat, and oats) was high, and in recent years, reached epidemic levels in many regions of the Czech Republic. BYDV-PAV and BYDV-PAS have been identified in Czech cereal crops (2,4). Surveys of the incidence of BYDV were carried out using ELISA (SEDIAG SAS, Longvic, France) and one-step reverse transcription (RT)-PCR (Qiagen, Hilden, Germany) (2) during 2007 and 2008. Samples (125) were collected from different fields around the Czech Republic and 96 were BYDV positive. Three of the field isolates, CZ-6815, CZ-1561, and CZ-10844, from oat (Avena sativa; cv. Auron), winter wheat (Triticum aestivum; cv. Apache), and winter barley (Hordeum vulgare; cv. Merlot), respectively, were identified as BYDV-MAV by sequencing of the RT-PCR product (641-bp fragment) used to identify BYDV, which spanned 2839–3479 of the BYDV genome (GenBank Accession Nos. EF043235 and NC_002160) (2). The partial coat protein gene sequence of 483 nt was compared with the available sequences of 12 BYDV-PAV isolates (PAV-JP, PAV-NY, PAV-ILL, PAV-AUS, PAV-WG2, PAV-whG4y3, PAV-on21-4, Tahoe1, CA-PAV, HB3, FH3, and MA9501); nine BYDV-PAS isolates (PAS-129, PAS-64, WS6603, WG13, PAS-Tcb4-1, PASwaw5-9, FL2, PAS-Vd29, and PAS-MA9516); and six BYDV-MAV isolates (MAV-CA, MAV-PS1X1, MAV-Alameds268, LMB2a, SI-o4, and MAV-CN) by MEGA4 (3). Nucleotide and amino acid sequence identities for the three isolates ranged from 92.9 to 99.4% and 88.0 to 95.8%, respectively, for available BYDV-MAV isolates; 76.8 to 78.2% and 62.7 to 67.6%, respectively, for available BYDV-PAS isolates; and 77.6 to 79.3% and 65.5 to 70.4%, respectively, for available PAV isolates. The sequence data indicates that these isolates (CZ-6815, CZ-1561, and CZ10844; GenBank Accession Nos. FJ645747, FJ645758, and FJ645746, respectively) are BYDV-MAV. To my knowledge, this is the first record of BYDV-MAV in the Czech Republic. References: (1) C. J. D'Arcy and L. L. Domier. Page 891 in: Virus Taxonomy-8th Report of the ICTV. C. M. Fauquet et al., eds. Springer-Verlag, NY, 2005. (2) J. K. Kundu. Plant Dis. 92:1587, 2008. (3) K. Tamura et al. Mol. Biol. Evol. 24:1596, 2007. (4) J. Vacke. Page 100 in: Sbornik Referatu z Odborneho Seminare, Aktualni Problemy Ochrany Polnich Plodin, Praha, 1991.

Download Full-text

First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽

10.1094/pdis.2003.87.12.1537b ◽

2003 ◽

Vol 87 (12) ◽

pp. 1537-1537 ◽

Cited By ~ 1

Author(s):

M. Hassan ◽

P. Rysanek ◽

F. Di Serio

Keyword(s):

Czech Republic ◽

Stone Fruit ◽

Reference Sequence ◽

Mixed Infections ◽

Rt Pcr ◽

The Czech Republic ◽

First Report ◽

Stunt Viroid ◽

Hop Stunt Viroid ◽

Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

Download Full-text

First Report of Little cherry virus 2 from Sweet Cherry in Poland

Plant Disease ◽

10.1094/pdis-92-9-1366a ◽

2008 ◽

Vol 92 (9) ◽

pp. 1366-1366 ◽

Cited By ~ 3

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Coat Protein ◽

Sweet Cherry ◽

Prunus Avium ◽

Late Summer ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

Nontranslated Region ◽

Methyltransferase Gene ◽

Cherry Trees

Little cherry disease (LChD) is a serious viral disease of sweet (Prunus avium) and sour (P. cerasus) cherry trees. Infection of sensitive cultivars results in small, angular, and pointed fruits with reduced sweetness. In late summer, leaves show a characteristic red coloration or bronzing of the surfaces. One Ampelovirus species, Little cherry virus 2 (LChV-2) (2), and one unassigned species in the Closteroviridae, Little cherry virus 1 (LChV-1) (3), have been associated with LChD. Twenty-seven sour and sweet cherry trees of six varieties from orchards located in several regions of Poland were tested for LChV-1 and LChV-2. Leaf samples were taken either from trees showing fruit symptoms or from asymptomatic trees during the summer of the 2006 growing season. RNA was isolated from the leaves with an RNeasy Kit (Qiagen, Hilden, CA), and reverse transcription (RT)-PCR was performed using primer pairs LCV1U/LCV1L and LCV2UP2/LCV2LO2, which are specific for a 419-bp fragment of the LChV-1 3′ nontranslated region and a 438-bp fragment of the LChV-2 methyltransferase gene, respectively (1). The primer pair L2CPF (5′-GTTCGAAAGTGTTTCTTGAT-3′) and L2CPR (5′-GCAACAGAAAAACATATGACTCA-3′) was designed from existing LChV-2 sequences (GenBank Accession Nos. AF416335 and NC_005065) to amplify the entire LChV-2 coat protein (CP) gene (nucleotides 13,007 to 14,134). The amplified cDNA fragments of LChV-2 genome were ligated to the bacterial vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA), which was used to transform Escherichia coli TOP10 competent cells following the manufacturer's protocol. Both strands of three clones for each amplified LChV-2 genome fragment were sequenced with an automated nucleotide sequencer at the Institute of Biochemistry and Biophysics in Warsaw. RT-PCR results showed that 6 of 27 trees were infected, with LChV-1 detected in five sweet cherry trees and LChV-2 singly infecting one sweet cherry tree cv Elton (isolate C4/14). The nucleotide sequence of the 438-bp methyltransferase gene fragment of isolate C4/14 showed 86, 85, and 84% identity to GenBank Accession Nos. AF333237, AF531505, and AJ430056, respectively, all previously reported LChV-2 sequences from cherry trees. Sequence analysis of the 1,088-bp coat protein gene showed 89 to 91% and 92 to 93% nucleotide and amino acid identity, respectively, with the aforementioned three LChV-2 isolates. The tree infected with LChV-2 was indexed by graft transmission to the woody indicator, Prunus avium cv. Canindex, which showed reddening of the leaves characteristic of LChD 3 months after inoculation. Since cherry production in Poland is 230,000 t per year, the disease may have a significant economic impact because the affected fruits are unsuitable either for consumption or sale. To our knowledge, this is the first report of LChV-2 in Poland. References: (1) M. E. Rott and W. Jelkmann. Phytopathology 91:261, 2001. (2) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005. (3) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

Download Full-text

Distribution of Plum pox virus strains in natural sources in the Czech Republic

Plant Protection Science ◽

10.17221/31/2009-pps ◽

2009 ◽

Vol 45 (No. 4) ◽

pp. 144-147 ◽

Cited By ~ 3

Author(s):

J. Polák ◽

P. Komínek

Keyword(s):

Monoclonal Antibodies ◽

Czech Republic ◽

Sweet Cherry ◽

Polyclonal Antibodies ◽

Sour Cherry ◽

Plum Pox Virus ◽

Rt Pcr ◽

The Czech Republic ◽

Natural Sources ◽

Das Elisa

The distribution of <i>Plum pox virus</i> (PPV) strains, PPV-D, PPV-M and PPV-Rec, was investigated in the Czech Republic in 2005–2008. Fifty-two to ninety-four samples of flowers or leaves of plum, myrobalan and blackthorn trees from different regions were tested in individual years. The presence of PPV was detected by DAS-ELISA with serotype-specific polyclonal antibodies. PPV-M was proved by DASI-ELISA with serotype-specific monoclonal antibodies; PPV-D, PPV-M and PPV-Rec were detected by RT-PCR in leaf samples from PPV infected trees. The presence of PPV-D ranged from 94.6% to 100%, the presence of PPV-M from 0.0% to 2.3% and the presence of PPV-Rec from 0.0% to 3.1% during 2005–2008. More than 95% of analysed samples of PPV were infected with PPV-D and less than 2.5% of analysed samples of PPV were infected with PPV-M or PPV-Rec. The presence of PPV-C was not proved in sweet cherry and sour cherry trees. The presence of PPV-EA was not proved in apricot trees.

Download Full-text

First Report of Colletotrichum acutatum on Tomato and Apple Fruits in the Czech Republic

Plant Disease ◽

10.1094/pdis-10-11-0849-pdn ◽

2012 ◽

Vol 96 (5) ◽

pp. 769-769 ◽

Cited By ~ 4

Author(s):

J. Víchová ◽

B. Staňková ◽

R. Pokorný

Keyword(s):

Czech Republic ◽

Tomato Fruit ◽

Colletotrichum Acutatum ◽

Distilled Water ◽

Species Determination ◽

Specific Primers ◽

The Czech Republic ◽

First Report ◽

Pcr Products ◽

Apple Fruits

Apple (Malus domestica Borkh.) is a fruit traditionally grown in the Czech Republic, and tomatoes (Solanum lycopersicum Mill.), too, are widely raised in this region. Colletotrichum acutatum J. H. Simmonds is a polyphagous fungal plant pathogen. Earlier, this pathogen caused disease on strawberry in the Czech Republic (2), and now it has become an important pathogen on safflower (4). During the 2010 harvest, anthracnose symptoms were noticed on the fruits of apple and tomato. Infected apples fruits (localities Velká Bíteš and Znojmo) and tomatoes (localities Velká Bíteš and Žabčice) were collected. Typical symptoms on fruit surfaces were round, brown, shriveled and sunken spots, 1.2 to 2.0 cm, with orange conidial masses appearing on the spots. A fungus was isolated from each host on potato dextrose agar and cultured at 25 ± 2°C for 10 days. Mycelium was superficial, partly immersed, and white to gray with occurrence of orange conidial masses. Conidia of the tomato and apple isolates were colorless and fusiform. The size of conidia from the apple and tomato isolates, respectively, ranged from 11 to 15 × 2.5 to 3.5 μm and 11 to 16 × 2.5 to 4 μm. Morphological characteristics suggested that the isolated fungi was a Colletotrichum sp. To fulfill Koch's postulates, healthy tomato and apple fruits were disinfected with 3% sodium hypochlorite for 2 min and rinsed in sterile distilled water. Fruits were pinpricked with a sterile needle and 10 μl of a spore suspension (1 × 105 conidia ml–1) was inoculated by pipetting into the wound. Control fruits were treated with sterile distilled water. The fruits were transferred to a growth cabinet and maintained at a temperature of 25 ± 2°C, relative humidity of 70 ± 5%, and a photoperiod of 12 h. Similar disease symptoms as in the collected fruits were observed on tomato fruits at 7 days and apple fruits at 20 days after inoculation, while no symptoms appeared on control fruits. The pathogen was reisolated from infected fruits. Species determination of the isolates was confirmed by PCR. Specific primers designed in region ITS1, the 5.8S RNA gene, and region ITS2 of the pathogen DNA were selected. Specific primers CaInt2 and ITS4 were used to identify C. acutatum (3), and primers CgInt and ITS4 were used to determine C. gloeosporioides isolate CCM 177 (1), which was used as a control. Our isolates yielded PCR products (490 bp) only with primers designed for C. acutatum. The C. gloeosporioides isolate yielded a PCR product (450 bp) only with CgInt and ITS4 primers. PCR products were sequenced and identified with the BLAST program. The sequence of the tomato fruit isolate (Accession No. JN676199) and apple fruit isolate (Accession No. JN676198) matched with 100% similarity to the C. acutatum sequences in GenBank. The control isolate of C. gloeosporioides matched 100% to sequences AJ749682 and AJ749692. To our knowledge, this is the first report of C. acutatum on tomato and apple fruits in the Czech Republic. This pathogen can endanger the production and storage of apples and tomatoes in this region. References: (1) P. R. Mills et al. FEMS Microbiol. Lett. 98:137, 1992. (2) D. Novotný et al. Plant Dis. 91:1516, 2007. (3) S. Sreenivasaprasad et al. Plant Pathol. 45:650, 1996. (4) J. Víchová et al. Plant Dis. 95:79, 2011.

Download Full-text

First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State

Plant Disease ◽

10.1094/pd-90-1461a ◽

2006 ◽

Vol 90 (11) ◽

pp. 1461-1461 ◽

Cited By ~ 8

Author(s):

M. J. Soule ◽

K. C. Eastwell ◽

R. A. Naidu

Keyword(s):

New York ◽

Economic Impact ◽

Virus Disease ◽

The United States ◽

Washington State ◽

The State ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Table Grapes

Washington State is the largest producer of juice grapes (Vitis labruscana ‘Concord’ and Vitis labrusca ‘Niagara’) and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of ‘Concord’ and three samples from one nursery of ‘Niagara’ were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One ‘Niagara’ nursery sample and eleven ‘Concord’ samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The ‘Niagara’ and six of the ‘Concord’ RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from ‘Concord’ and ‘Niagara’ share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the ‘Niagara’ and two of the ‘Concord’ isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

Download Full-text

The First Report of Downy Mildew Caused by Peronospora belbahrii on Sweet Basil in Greenhouses in the Czech Republic

Plant Disease ◽

10.1094/pdis-07-13-0747-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1579-1579 ◽

Cited By ~ 3

Author(s):

I. Šafránková ◽

L. Holková

Keyword(s):

Czech Republic ◽

Downy Mildew ◽

Width Ratio ◽

Specific Sequence ◽

The Czech Republic ◽

First Report ◽

Sweet Basil ◽

Potted Plants ◽

Length Width ◽

Necrotic Spots

Sweet basil (Ocimum basilicum L.) is an aromatic plant that is cultivated as a pot plant in greenhouses or in fields in the Czech Republic. The plants are intended for direct consumption or for drying. In April of 2012, the first large chlorotic from the middle necrotic spots occurred gradually on leaves of pot plants O. basilicum cv. Genovese in greenhouses in Central Bohemia. The characteristic gray to brown furry growth of downy mildew appeared on abaxial surfaces of leaves in the place of chlorotic spots within 3 to 4 days. The infested leaves fell off in the late stages of pathogenesis. The infestation gradually manifested itself in ever-younger plants and in July, cotyledons and possibly the first true leaves were already heavily infected and damaged and these plants rapidly died. The plant damage reached 80 to 100%, so it was necessary to stop growing the plants in the greenhouse at the end of July. The causal agent was isolated and identified as Peronospora belbahrii Thines by means of morphological and molecular characters (2,3). Conidiophores were hyaline, straight, monopodial, 280 to 460 μm, branched three to five times, ended with two slightly curved branchlets with a single conidia on each branchled tip. The longer branchlets measured 13 to 24 μm (average 18.2 μm), the shorter one 4 to 15 μm (average 9.7 μm). Conidia were rounded or slightly ovoid, from brownish to dark brownish, measured 22 to 31 × 20 to 28 μm (length/width ratio 1.2). A pathogen-specific sequence was detected with the help of the pathogen ITS rDNA specific primers in symptomatic leaves (1). DNA from plant tissues was isolated using the DNeasy plant Mini Kit (Qiagen, Germany) following the standard protocol. PCR was performed using KAPA2G Robust HotStar kit (Kapa Biosystems, United States) according to the conditions recommended in Belbahri et al. (1). The specific products were visualized by electrophoresis through 1.5% agarose gels. Leaves of 20-day-old potted plants O. basilicum ‘Genovese’ were inoculated by spraying with 5 × 105 conidia/ml of the pathogen. Each pot contained 10 plants. Sterilized distilled water was applied to control plants. Plants were covered with polyethylene bags during the entire incubation period to maintain high humidity, and kept at a temperature of 22 to 24°C. Typical disease symptoms appeared on leaves 5 to 9 days after inoculation. Control plants were symptomless. P. belbahrii was re-isolated from the lesions of inoculated plants, thus fulfilling Koch's postulates. Downy mildew on sweet basil was reported in countries in Africa, Europe, and South and North America (4). To our knowledge, this is the first report of downy mildew on sweet basil in the Czech Republic. References: (1) L. Belbahri et al. Mycol. Res. 109:1276, 2005. (2) Y.-J. Choi et al. Mycol. Res. 113:1340, 2009. (3) M. Thines et al. Mycol. Res. 113:532, 2009. (4) C. A. Wyenandt et al. HortScience 45:1416, 2010.

Download Full-text

First Report of Plum pox virus (Sharka Disease) in Prunus persica in the United States

Plant Disease ◽

10.1094/pdis.2000.84.2.202b ◽

2000 ◽

Vol 84 (2) ◽

pp. 202-202 ◽

Cited By ~ 65

Author(s):

L. Levy ◽

V. Damsteegt ◽

R. Welliver

Keyword(s):

Prunus Persica ◽

Virus Disease ◽

Sandwich Elisa ◽

Pcr Amplification ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Plum Pox Virus ◽

Rt Pcr ◽

Peach Fruit ◽

First Report

Plum pox (Sharka) is the most important virus disease of Prunus in Europe and the Mediterranean region and is caused by Plum pox potyvirus (PPV). In September 1999, PPV-like symptoms were observed in peach fruit culls in a packinghouse in Pennsylvania. All symptomatic fruit originated from a single block of peach (P. persica cv. Encore) in Adams County. Trees in the block exhibited ring pattern symptoms on their leaves. A potyvirus was detected in symptomatic fruit using the Poty-Group enzyme-linked immunosorbent assay (ELISA) test from Agdia (Elkhart, IN). Reactions for symptomatic peach fruit and leaves also were positive using triple-antibody sandwich ELISA with the PPV polyclonal antibody from Bioreba (Carrboro, NC) for coating, the Poty-Group monoclonal antibody (MAb; Agdia) as the intermediate antibody, and double-antibody sandwich ELISA with PPV detection kits from Sanofi (Sanofi Diagnostics Pasteur, Marnes-La-Coquette, France) and Agdia and the REAL PPV kit (Durviz, Valencia, Spain) containing universal (5B) and strain typing (4DG5 and AL) PPV MAbs (1). PPV also was identified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) amplification and subsequent sequencing of the 220-bp 3′ noncoding region (2) (>99% sequence homology to PPV) and by IC-RT-PCR amplification of a 243-bp product in the coat protein (CP) gene (1). The virus was identified as PPV strain D based on serological typing with strainspecific MAbs and on PCR-restriction fragment length polymorphism of the CP IC-RT-PCR product with Rsa1 and Alu1 (1). This is the first report of PPV in North America. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) L. Levy and A. Hadidi. EPPO Bull. 24:595, 1994.

Download Full-text