scholarly journals First Report of Verticillium Wilt on Lettuce (Lactuca sativa) in Washington Caused by Verticillium tricorpus

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 996-996 ◽  
Author(s):  
M. Powell ◽  
B. Gundersen ◽  
C. Miles ◽  
K. Coats ◽  
D. A. Inglis
Keyword(s):  
Verticillium Wilt ◽  
Lactuca Sativa ◽  
Disease Incidence ◽  
The United States ◽  
Its Rdna ◽  
Post Inoculation ◽  
Potato Dextrose Agar Medium ◽  
First Report ◽  
Vascular Discoloration ◽  
Verticillium Tricorpus

Symptoms of Verticillium wilt were observed on lettuce (Lactuca sativa L.) harvested from high tunnel and open field experimental plots in annual, consecutive spring plantings in western Washington from 2010 to 2012. Leaves had v-shaped, chlorotic lesions, and yellow or brown vascular tissue was noted in the crowns. Total disease incidence increased from 0.2% in 2010 to 1.9% in 2011 and to 14.4% in 2012. Verticillium spp. obtained from infected crown tissues and cultured on half-strength potato dextrose agar medium produced yellow pigment, black microsclerotia, white mycelia, tan chlamydospores, and uniseptate conidia averaging 10.6 × 3.7 μm. Isolates were identified tentatively as Verticillium tricorpus I. (3). Three isolates, Vt.Ls.2010, Vt.Ls.2011-1, and Vt.Ls.2011-2, were evaluated for pathogenicity on 4-week-old ‘Coastal Star’ seedlings in two greenhouse trials. In Trial I, four replicates of two duplicate plants per each isolate, and in Trial II, five replicates of one plant per each isolate were inoculated with conidial suspensions adjusted to 2.0 × 106 and 5.0 × 106 conidia/ml, respectively. Additionally, in each trial, two sets of control treatments of five plants each were inoculated with either an isolate of V. dahliae at the same conidial concentration or with sterile water. Root tips were cut and exposed to the suspensions for 5 s, then seedlings were transplanted into Sunshine Mix #1 (SunGro Horticulture Distribution Inc., Bellevue, WA), and kept in a greenhouse at 17.7 ± 3.4°C. Plants were harvested 8 to 9 weeks post-inoculation, and symptoms were rated visually. Vt.Ls.2010, Vt.Ls.2011-1, and Vt.Ls.2011-2 caused chlorosis and vascular discoloration on 25, 13, and 13% of the plants in Trial I; and 40, 60, and 20% of plants in Trial II, respectively. V. dahliae caused similar symptoms on 25 and 40% of the plants in the two trials, respectively, but these plants had greater intensity and length of vascular discoloration compared with the three test isolates. None of the water control plants were symptomatic. All V. tricorpus isolates were recovered from inoculated plants, and colony morphologies were similar to the original isolates. The internal transcribed spacer (ITS) rDNA of isolate Vt.Ls.2010 was amplified with ITS4 and ITS6 primer sets. ITS rDNA sequences between Vt.Ls.2010 and two isolates of V. tricorpus in GenBank (Accession Nos. FJ900211 and AB353343) were 100% identical. V. tricorpus is considered a weak pathogen of lettuce crops in California (2), but authors in Japan recently reported pathogenic isolates of V. tricorpus on lettuce (4). To our knowledge, this is the first report of Verticillium wilt caused by V. tricorpus in Washington. Lettuce is the number two crop grown in high tunnels in the United States (1), and cropping lettuce continuously in them can increase the risk of this and other soilborne pathogens. References: (1) E. E. Carey et al. HortTechnology 19:37, 2009. (2) Q.-M. Qin et al. Plant Dis. 92:69, 2008. (3) H. C. Smith. N. Z. J. Agric. Res. 8:450, 1965. (4) T. Usami et al. J. Gen. Plant Pathol. 77:17, 2010.

scholarly journals First Report of Verticillium Wilt Caused by Verticillium dahliae on Avocado Trees in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (11) ◽  
pp. 1584-1584 ◽  
Author(s):  
E. A. Markakis ◽  
N. Kavroulakis ◽  
G. C. Koubouris
Keyword(s):  
Verticillium Wilt ◽  
Verticillium Dahliae ◽  
Vascular Tissue ◽  
Disease Incidence ◽  
Natural Infection ◽  
The United States ◽  
Persea Americana ◽  
Artificial Inoculation ◽  
Pathogenicity Test ◽  
First Report

Avocado (Persea americana) is an important crop for Chania, Crete, Greece, and is grown on more than 800 ha. In November 2013, 4-year-old trees in a new avocado grove of cv. Hass grafted onto the rootstock ‘Bacon,’ previously planted in citrus trees, showed symptoms of yellowing, leaf fall, twig and branch dieback and vascular tissue discoloration. Disease incidence was estimated at 2.3% (12 out of 530 trees affected). A fungus was consistently and readily isolated from symptomatic vascular tissue, previously surface-disinfested with 95% ethanol, on acidified potato dextrose agar (APDA). After 7 days, slow-growing colonies were transferred to PDA and the growth rate of the fungus was 2.9 mm/day at 24°C in the dark. Microscopic observations revealed hyaline hyphae with many irregular, dark microsclerotia measuring 40 to 200 × 30 to 75 μm (average 94.5 × 50.3 μm) developing after 21 days of growth. Hyaline, elliptical, single-celled conidia measuring 2.8 to 7.5 × 2.5 to 4.3 μm (average 4.8 × 3.1 μm) developed on verticillate conidiophores. For molecular characterization, Verticillium dahliae specific primer pair ITS1-F/ITS2-R that amplifies the rRNA internal transcribed spacer (ITS) region was used (2). Band of expected size was amplified, sequenced, and deposited in GenBank (Accession No. KJ818294). On the basis of morphological characteristics (3) and a BLAST search with 100% identity to the published ITS sequence of a V. dahliae isolate in GenBank (KC834733.1), the fungus was identified as V. dahliae. Five 1-year-old avocado plants of cv. Hass, grafted onto the rootstock ‘Bacon,’ were used for pathogenicity tests. Artificial inoculation was performed by making a 5.0 × 3.5 mm hole in the rootstock trunk, injecting approximately 40 μl of a 2.8 × 107 conidia/ml suspension into the vessels (spores were introduced passively), sealing with Vaseline, and covering with adhesive paper tape. Five control plants were mock inoculated with sterilized distilled water. Disease symptoms that appeared 18 days post artificial inoculation were similar to those observed under natural infection conditions. Thirty-five days post artificial inoculation, disease incidence was 80%, whereas the percentage of positive V. dahliae re-isolations from infected tissues was 95% (96.7 and 93.3% from rootstock and graft, respectively). The extent of vascular tissue discoloration from the point of inoculation ranged from 11 to 62 cm, whereas V. dahliae was successfully re-isolated even from the end of the graft (approximately 60 cm above the initial inoculation point), thus confirming Koch's postulates. Neither symptoms nor positive isolations were observed in control plants. The pathogenicity test was repeated twice with similar results. Verticillium wilt of avocado has been observed in several countries including Argentina, Chile, Ecuador, Israel, Mexico, Morocco, Spain, and the United States (1). To the best of our knowledge, this is the first report of Verticillium wilt on avocado in Greece. This disease could potentially be an increasing problem in areas where young avocado trees are established on land previously planted in vegetable crops. References: (1) J. C. Goud and J. A. Hiemstra. Chapter 3 in: A Compendium of Verticillium Wilt in Trees Species, 1998. (2) E. A. Markakis et al. Eur. J. Plant Pathol. 124:603, 2009. (3) G. F. Pegg and B. L. Brady. Verticillium Wilts. CABI Publishing, Wallingford, UK, 2002.

scholarly journals First Report of Flyspeck Caused by Zygophiala wisconsinensis on Sweet Persimmon Fruit in Korea

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 616-616 ◽  
Author(s):  
J. Kim ◽  
O. Choi ◽  
J.-H. Kwon
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Rdna ◽  
Control Treatment ◽  
Diospyros Kaki ◽  
Distilled Water ◽  
First Report ◽  
Persimmon Fruit ◽  
Fungal Isolates ◽  
Agar Disc

Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals First Report of Alternaria Leaf Spot Caused by Alternaria sp. on Highbush Blueberry (Vaccinium corymbosum) in South Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1434-1434
Author(s):  
J.-H. Kwon ◽  
D.-W. Kang ◽  
M.-G. Cheon ◽  
J. Kim
Keyword(s):  
South Korea ◽  
Leaf Spot ◽  
Disease Incidence ◽  
Vaccinium Corymbosum ◽  
Its Rdna ◽  
Universal Primers ◽  
Conidial Suspension ◽  
First Report ◽  
Representative Isolate ◽  
Alternaria Sp

In South Korea, the culture, production, and consumption of blueberry (Vaccinium corymbosum) have increased rapidly over the past 10 years. In June and July 2012, blueberry plants with leaf spots (~10% of disease incidence) were sampled from a blueberry orchard in Jinju, South Korea. Leaf symptoms included small (1 to 5 mm in diameter) brown spots that were circular to irregular in shape. The spots expanded and fused into irregularly shaped, large lesions with distinct dark, brownish-red borders. The leaves with severe infection dropped early. A fungus was recovered consistently from sections of surface-disinfested (1% NaOCl) symptomatic leaf tissue after transfer onto water agar and sub-culture on PDA at 25°C. Fungal colonies were dark olive and produced loose, aerial hyphae on the culture surfaces. Conidia, which had 3 to 6 transverse septa, 1 to 2 longitudinal septa, and sometimes also a few oblique septa, were pale brown to golden brown, ellipsoid to ovoid, obclavate to obpyriform, and 16 to 42 × 7 to 16 μm (n = 50). Conidiophores were pale to mid-brown, solitary or fasciculate, and 28 to 116 × 3 to 5 μm (n = 50). The species was placed in the Alternaria alternata group (1). To confirm the identity of the fungus, the complete internal transcribed spacer (ITS) rDNA region of a representative isolate, AAVC-01, was amplified using ITS1 and ITS4 primers (2). The DNA products were cloned into the pGEM-T Easy vector (Promega, Madison, WI) and the resulting pOR13 plasmid was sequenced using universal primers. The resulting 570-bp sequence was deposited in GenBank (Accession No. KJ636460). Comparison of ITS rDNA sequences with other Alternaria spp. using ClustalX showed ≥99% similarity with the sequences of A. alternata causing blight on Jatropha curcas (JQ660842) from Mexico and Cajannus cajan (JQ074093) from India, citrus black rot (AF404664) from South Africa, and other Alternaria species, including A. tenuissima (WAC13639) (3), A. lini (Y17071), and A. longipes (AF267137). Two base substitutions, C to T at positions 345 and 426, were found in the 570-bp amplicon. Phylogenetic analysis revealed that the present Alternaria sp. infecting blueberry grouped separately from A. tenuissima and A. alternata reported from other hosts. A representative isolate of the pathogen was used to inoculate V. corymbosum Northland leaves for pathogenicity testing. A conidial suspension (2 × 104 conidia/ml) from a single spore culture and 0.025% Tween was spot inoculated onto 30 leaves, ranging from recently emerged to oldest, of 2-year-old V. corymbosum Northland plants. Ten leaves were treated with sterilized distilled water and 0.025% Tween as a control. The plants were kept in a moist chamber with >90% relative humidity at 25°C for 48 h and then moved to a greenhouse. After 15 days, leaf spot symptoms similar to those observed in the field developed on the inoculated leaves, whereas the control plants remained asymptomatic. The causal fungus was re-isolated from the lesions of the inoculated plants to fulfill Koch's postulates. To our knowledge, this is the first report of Alternaria sp. on V. corymbosum in South Korea. References: (1) E. G. Simmons. Page 1797 in: Alternaria: An Identification Manual. CBS Fungal Biodiversity Centre, Utrecht, The Netherlands, 2007. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990. (3) M. P. You et al. Plant Dis. 98:423, 2014.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

scholarly journals First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in California

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 909-909 ◽  
Author(s):  
S. N. Wegulo ◽  
S. T. Koike ◽  
M. Vilchez ◽  
P. Santos
Keyword(s):  
United States ◽  
Downy Mildew ◽  
Disease Incidence ◽  
Leaf Tissue ◽  
The United States ◽  
Plant Diseases ◽  
Single Type ◽  
First Report ◽  
Commercial Grower ◽  
Impatiens Walleriana

During February 2004, diseased double impatiens (Impatiens walleriana) plants were received from a commercial grower in southern California. The upper surfaces of symptomatic leaves were pale yellow with no distinct lesions. Diseased leaves later wilted, and severely affected leaves abscised from the stem. At the nursery, only double impatiens plants in the Fiesta series were infected, and some cultivars were more heavily infected than others. Disease incidence in cv. Sparkler Hot pink was nearly 100%. The interior of infected leaves was colonized by coenocytic mycelium. A conspicuous white growth was observed only on the underside of leaves. Sporangiophores were hyaline, thin walled, emergent from stomata, and had slightly swollen bases. Sporangiophore branching was distinctly monopodial. Smaller sporangiophore branches were arranged at right angles to the supporting branches, and tips of branches measured 8 to 14 μm long. Sporangia were ovoid and hyaline with a single pore on the distal ends. Distal ends of sporangia were predominantly flat but occasionally had a slight papilla. Short pedicels were present on the attached ends. Sporangia measured 19.4 to 22.2 (-25.0) μm × 13.9 to 16.7 (-19.4) μm. Oospores were not observed in leaf tissue. On the basis of symptoms and morphology of the organism, the pathogen was identified as Plasmopara obducens J. Schröt. Pathogenicity tests were done on double type cvs. Fiesta, Tioga Red, and Tioga Cherry Red and on single type cvs. Cajun Watermelon and Accent Lilac. Plants were spray inoculated with sporangiospore suspensions (1 × 104 sporangiospores per milliliter), incubated for 24 h in a dew chamber (18 to 20°C), and then maintained in a greenhouse (22 to 24°C). Symptoms and signs of downy mildew developed after 12 days only on inoculated cv. Fiesta plants, and the pathogen morphology matched that of the originally observed pathogen. Nontreated control plants did not develop downy mildew. To our knowledge, this is the first report of downy mildew on impatiens in California. P. obducens is one of two causal agents of downy mildew of impatiens (2,4). The other pathogen, Bremiella sphaerosperma, has dichotomous sporangiophore branching and causes lesions with well-defined margins (2,4). In the United States, the disease has been recorded in the eastern and northeastern states and in Indiana, Minnesota, Mississippi, Montana, and Wisconsin (3). In Canada, the disease has been recorded in Manitoba and Quebec (1). References: (1) I. L. Conners. An Annotated Index of Plant Diseases in Canada and Fungi Recorded on Plants in Alaska, Canada, and Greenland. Research Branch, Canada Department of Agriculture, Publication 1251, 1967. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, 1989. (4) G. W. Wilson. Bull. Torrey Bot. Club 34:387, 1907.

scholarly journals First Report of Phomopsis citri Associated with Dieback of Citrus lemon in India

Plant Disease ◽  
2014 ◽  
Vol 98 (9) ◽  
pp. 1281-1281 ◽  
Author(s):  
S. Mahadevakumar ◽  
Vandana Yadav ◽  
G. S. Tejaswini ◽  
S. N. Sandeep ◽  
G. R. Janardhana
Keyword(s):  
Fungal Pathogen ◽  
The United States ◽  
Apical Region ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
Productivity Level ◽  
First Report ◽  
Dieback Disease

Lemon (Citrus lemon (L.) Burm. f.) is an important fruit crop cultivated worldwide, and is grown practically in every state in India (3). During a survey conducted in 2013, a few small trees in a lemon orchard near Mysore city (Karnataka) (12°19.629′ N, 76°31.892′ E) were found affected by dieback disease. Approximately 10 to 20% of trees were affected as young shoots and branches showed progressive death from the apical region downward. Different samples were collected and diagnosed via morphological methods. The fungus was consistently isolated from the infected branches when they were surface sanitized with 1.5% NaOCl and plated on potato dextrose agar (PDA). Plates were incubated at 26 ± 2°C for 7 days at 12/12 h alternating light and dark period. Fungal colonies were whitish with pale brown stripes having an uneven margin and pycnidia were fully embedded in the culture plate. No sexual state was observed. Pycnidia were globose, dark, 158 to 320 μm in diameter, and scattered throughout the mycelial growth. Both alpha and beta conidia were present within pycnidia. Alpha conidia were single celled (5.3 to 8.7 × 2.28 to 3.96 μm) (n = 50), bigittulate, hyaline, with one end blunt and other truncated. Beta conidia (24.8 to 29.49 × 0.9 to 1.4 μm) (n = 50) were single celled, filiform, with one end rounded and the other acute and curved. Based on the morphological and cultural features, the fungal pathogen was identified as Phomopsis citri H.S. Fawc. Pathogenicity test was conducted on nine healthy 2-year-old lemon plants via foliar application of a conidial suspension (3 × 106); plants were covered with polythene bags for 6 days and maintained in the greenhouse. Sterile distilled water inoculated plants (in triplicate) served as controls and were symptomless. Development of dieback symptoms was observed after 25 days post inoculation and the fungal pathogen was re-isolated from the inoculated lemon trees. The internal transcribed spacer region (ITS) of the isolated fungal genomic DNA was amplified using universal-primer pair ITS1/ITS4 and sequenced to confirm the species-level diagnosis (4). The sequence data of the 558-bp amplicon was deposited in GenBank (Accession No. KJ477016.1) and nBLAST search showed 99% homology with Diaporthe citri (teleomorph) strain 199.39 (KC343051.1). P. citri is known for its association with melanose disease of citrus in India, the United States, and abroad. P. citri also causes stem end rot of citrus, which leads to yield loss and reduction in fruit quality (1,2). Dieback disease is of serious concern for lemon growers as it affects the overall productivity level of the tree. To the best of our knowledge, this is the first report of P. citri causing dieback of lemon in India. References: (1) I. H. Fischer et al. Sci. Agric. (Piracicaba). 66:210, 2009. (2) S. N. Mondal et al. Plant Dis. 91:387, 2007. (3) S. P. Raychaudhuri. Proc. Int. Soc. Citriculture 1:461, 1981. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals First Report of Fruit Rot of Melon Caused by Fusarium asiaticum in China

Plant Disease ◽  
2020 ◽  
Author(s):  
Fangmin Hao ◽  
Quanyu Zang ◽  
Weihong Ding ◽  
Erlei Ma ◽  
Yunping Huang ◽  
...  
Keyword(s):  
Disease Incidence ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Its Region ◽  
Fruit Rot ◽  
Post Inoculation ◽  
Basal Cells ◽  
First Report ◽  
Fusarium Asiaticum ◽  
Sterile Needle

Melon (Cucumis melo L.) is a member of the Cucurbitaceae family, an important economical and horticultural crop, which is widely grown in China. In May 2020, fruit rot disease with water-soaked lesions and pink molds on cantaloupe melons was observed in several greenhouses with 50% disease incidence in Ningbo, Zhejiang Province in China. In order to know the causal agent, diseased fruits were cut into pieces, surface sterilized for 1 min with 1% sodium hypochlorite (NaClO), 2 min with 75% ethyl alcohol, rinsed in sterile distilled water three times (Zhou et al. 2018), and then placed on potato dextrose agar (PDA) medium amended with streptomycin sulfate (100 μg/ml) plates at 25°C for 4 days. The growing hyphae were transferred to new PDA plates using the hyphal tip method, putative Fusarium colonies were purified by single-sporing. Twenty-five fungal isolates were obtained and formed red colonies with white aerial mycelia at 25°C for 7 days, which were identified as Fusarium isolates based on the morphological characteristics and microscopic examination. The average radial mycelial growth rate of Fusarium isolate Fa-25 was 11.44 mm/day at 25°C in the dark on PDA. Macroconidia were stout with curved apical and basal cells, usually with 4 to 6 septa, and 29.5 to 44.2 × 3.7 to 5.2 μm on Spezieller Nährstoffarmer agar (SNA) medium at 25°C for 10 days (Leslie and Summerell 2006). To identify the species, the internal transcribed spacer (ITS) region and translational elongation factor 1-alpha (TEF1-α) gene of the isolates were amplified and cloned. ITS and TEF1-α was amplified using primers ITS1/ITS4 and EF1/EF2 (O’Donnell et al. 1998), respectively. Sequences of ITS (545 bp, GenBank Accession No. MT811812) and TEF1-α (707 bp, GenBank Acc. No. MT856659) for isolate Fa-25 were 100% and 99.72% identical to those of F. asiaticum strains MSBL-4 (ITS, GenBank Acc. MT322117.1) and Daya350-3 (TEF1-α, GenBank Acc. KT380124.1) in GenBank, respectively. A phylogenetic tree was established based on the TEF1-α sequences of Fa-25 and other Fusarium spp., and Fa-25 was clustered with F. asiaticum. Thus, both morphological and molecular characterizations supported the isolate as F. asiaticum. To confirm the pathogenicity, mycelium agar plugs (6 mm in diameter) removed from the colony margin of a 2-day-old culture of strain Fa-25 were used to inoculate melon fruits. Before inoculation, healthy melon fruits were selected, soaked in 2% NaClO solution for 2 min, and washed in sterile water. After wounding the melon fruits with a sterile needle, the fruits were inoculated by placing mycelium agar plugs on the wounds, and mock inoculation with mycelium-free PDA plugs was used as control. Five fruits were used in each treatment. The inoculated and mock-inoculated fruits were incubated at 25°C with high relative humidity. Symptoms were observed on all inoculated melon fruits 10 days post inoculation, which were similar to those naturally infected fruits, whereas the mock-inoculated fruits remained symptomless. The fungus re-isolated from the diseased fruits resembled colony morphology of the original isolate. The experiment was conducted three times and produced the same results. To our knowledge, this is the first report of fruit rot of melon caused by F. asiaticum in China.

scholarly journals First report of Alternaria alternata causing leaf blight on little millet (Panicum sumatrense) in India.

Plant Disease ◽  
2020 ◽  
Author(s):  
Boda Praveen ◽  
A. Nagaraja ◽  
M. K. Prasanna Kumar ◽  
Devanna Pramesh ◽  
K. B. Palanna ◽  
...  
Keyword(s):  
Crop Yields ◽  
Disease Incidence ◽  
Leaf Blight ◽  
Post Inoculation ◽  
Pathogenicity Test ◽  
Conidial Suspension ◽  
Pcr Assay ◽  
Causal Organism ◽  
First Report ◽  
Little Millet

Little millet (LM) is a minor cereal crop grown in the Indian sub-continent. During October 2018, dark brown, circular to oval necrotic spots surrounded by concentric rings were observed on the upper leaf surface of the LM (cv. VS-13) grown in the fields of the University of Agricultural Sciences, Bengaluru, India (13.0784oN, 77.5793oE). As the disease progressed, infected leaves became blighted. Disease incidence up to 53% was recorded in 3 fields of 0.4-hectare area each. Thirty symptomatic leaves were collected to isolate the associated causal organism. The margins of diseased tissue were cut into 5 × 5-mm pieces, surface-sterilized in 75% ethanol for 45 seconds followed by 1% sodium hypochlorite for 1 min, finally rinsed in sterile distilled water five times and placed on PDA. After 7 days of incubation at 25°C, greyish fungal colonies appeared on PDA. Single-spore isolations were performed to obtain ten isolates. Pure cultures of the fungus initially produced light gray aerial mycelia that later turned to dark grey. All isolates formed obclavate to pyriform conidia measured 22.66-48.97μm long and 6.55-13.79µm wide with 1-3 longitudinal and 2-7 transverse septa with a short beak (2.55-13.26µm) (n=50). Based on the conidial morphology, the fungus was identified as Alternaria sp. Further, the taxonomic identity of all ten isolates was confirmed as A. alternata using species-specific primers (AAF2/AAR3, Konstantinova et al. 2002) in a PCR assay. Later, one of the isolate UASB1 was selected, and its internal transcribed spacer (ITS) region, glyceraldehyde-3-phosphate dehydrogenase (gapdh), major allergen Alt a 1 (Alt a 1), major endo-polygalacturonase (endoPG), OPA10-2, and KOG1058 genes were amplified in PCR (White et al. 1990; Berbee et al. 1999; Woudenberg et al. 2015), and the resultant products were sequenced and deposited in the NCBI GenBank (ITS, MN919390; gapdh, MT637185; Alt a 1, MT882339; endoPG, MT882340; OPA10-2, MT882341; KOG1058, MT882342). Blastn analysis of ITS, gapdh, Alt a 1, endoPG, OPA10-2, KOG1058 gene sequences showed 99.62% (with AF347031), 97.36% (with AY278808), 99.58% (with AY563301), 99.10% (with JQ811978), 99.05% (with KP124632) and 99.23% (with KP125233) respectively, identity with reference strain CBS916.96 of A. alternata, confirming UASB1 isolate to be A. alternata. For pathogenicity assay, conidial suspension of UASB1 isolate was spray inoculated to ten healthy LM (cv. VS-13) plants (45 days old) maintained under protected conditions. The spore suspension was sprayed until runoff on healthy leaves, and ten healthy plants sprayed with sterile water served as controls. Later, all inoculated and control plants were covered with transparent polyethylene bags and were maintained in a greenhouse at 28±2 ◦C and 90% RH. The pathogenicity test was repeated three times. After 8 days post-inoculation, inoculated plants showed leaf blight symptoms as observed in the field, whereas no disease symptoms were observed on non-inoculated plants. Re-isolations were performed from inoculated plants, and the re-isolated pathogen was confirmed as A. alternata based on morphological and PCR assay (Konstantinova et al. 2002). No pathogens were isolated from control plants. There is an increasing acreage of LM crop in India, and this first report indicates the need for further studies on leaf blight management and the disease impacts on crop yields.

Spatial Patterns of Microsclerotia of Verticillium dahliae in Soil and Verticillium Wilt of Cauliflower

1997 ◽  
Vol 87 (3) ◽  
pp. 325-331 ◽  
Author(s):  
C. L. Xiao ◽  
J. J. Hao ◽  
K. V. Subbarao
Keyword(s):  
Spatial Patterns ◽  
Verticillium Wilt ◽  
Verticillium Dahliae ◽  
Binomial Distribution ◽  
Disease Incidence ◽  
Soil Samples ◽  
Random Pattern ◽  
Parameter Estimates ◽  
Regular Pattern ◽  
Vascular Discoloration

The spatial patterns of microsclerotia of Verticillium dahliae in soil and wilt symptoms on cauliflower were determined at three sites in each of two fields in 1994 and 1995. Each site was an 8 × 8 grid divided into 64 contiguous quadrats (2 by 2 m each). Soil samples were collected to a depth of 15 cm with a probe (2.5 cm in diameter), and samples from four sites in each quadrat were bulked. Plants in each quadrat were cut transversely, and the number of plants with vascular discoloration and the number without discoloration were recorded. The soil was assayed for microsclerotia by the modified Anderson sampler technique. Lloyd's index of patchiness (LIP) was used as an indicator to evaluate the aggregation of microsclerotia in the field. Spatial autocorrelation and geostatistical analyses were also used to assess the autocorrelation of microsclerotia among quadrats. The LIP for microsclerotia was greater than 1, indicating aggregation of propagules; however, the degree of aggregation at most sites was not high. Significant autocorrelation within or across rows was detected in some spatial autocorrelograms of propagules, and anisotropic patterns were also detected in some oriented semivariograms from geostatistical analyses for microsclerotia, indicating the influence of bed preparation in the fields on pathogen distribution. The parameter estimates p and θ in the beta-binomial distribution and the index of dispersion (D) associated with the distribution were used to assess the aggregation of diseased plants at each site. A random pattern of wilt incidence was detected at 7 of 12 sites, and an aggregated pattern was detected at 5 of 12 sites. The degree of aggregation was not high. A regular pattern of wilt severity was detected at all sites. The high disease incidence (77 to 98%) observed at 11 of the 12 sites could be explained by high inoculum density.

Sign in / Sign up

Export Citation Format

Share Document